Abstract
The slow-intrinsic-pacemaker dopaminergic (DA) neurons originating in the ventral tegmental area (VTA) is implicated in various mood- and emotion-related disorders, such as anxiety, fear, stress and depression. Abnormal activity of projection-specific VTA DA neurons is the key factor in the development of these disorders. Here, we describe the crucial role for the NALCN and TRPC6, non-selective cation channels in mediating the subthreshold inward depolarizing current and driving the firing of action potentials of VTA DA neurons in physiological condition. Otherwise, we demonstrate that downregulation of TRPC6 protein expression in the VTA DA neurons likely contributes to the reduced activity of projection-specific VTA DA neuron in CMUS depressive mice. Furthermore, selective knockdown of TRPC6 channels in the VTA DA neurons conferred mice with depression-like behavior. This current study suggests down-regulation of TRPC6 expression/function is involved in reduced VTA DA neuron firing and depression-like behavior in the mouse models of depression.
Introduction
Dopaminergic (DA) neurons in the ventral tegmental area (VTA) play a key role in mood, reward and addictive behaviors1. These DA neurons project, through mesocorticolimbic dopaminergic system, to brain regions including the nucleus accumbens (NAc), medial prefrontal cortex (mPFC) and basolateral amygdala (BLA), and modulate these target neuronal circuits through their regulated activity (firing of action potentials)2, 3. As such, understandably, the altered functional activity of the VTA DA neurons is found to be the key determinants in abnormal behaviors related to the diseased conditions such as depression states4. Thus, the mechanism underlying the firing activity of the VTA DA neurons is crucial for understanding the function of the DA circuitry and the pathogenesis of related mental diseases4–8.
The VTA DA neurons are slow intrinsic pacemakers, which are further modulated by synaptic inputs from multiple excitatory and inhibitory projections9, 10. Firing activity controls the release of DA, thus function of the VTA DA neurons. The altered activity of the VTA DA neurons in a pathological state includes altered firing frequency and switch of the firing patterns7, 11.
Mechanism for spontaneous firing of action potential (AP) is the key to understand functional regulation of the VTA DA neurons. A variety of ion channels (e.g. voltage-gated Na+ channels, high-threshold-activated Ca2+ channels, Kv2, large conductance calcium-activated potassium channels, A- and M-type potassium channels) are reported to be involved in regulation of the autonomic firing activity of midbrain DA neurons (including the substantial nigra compact par, SNc and VTA)12–22. However, it is not completely clear how this spontaneous firing is initiated. AP fires when the resting membrane potential (RMP) is depolarized to the activation threshold for the voltage-dependent Na+ channels, which results in opening of Na+ channel and the upstroke of AP12. Therefore, a controlled depolarization of the RMP to the activation threshold of AP is the first key step in a cascade leading to firing of AP. In the VTA DA neurons, the identity of ion channels contributing to this subthreshold depolarization has not been unambiguously established.
In some cells with spontaneous firing of AP, such as cardiomyocytes and certain neurons (including a subset of midbrain SNc DA neurons23), the ionic mechanism for the auto-rhythmicity is the HCN, a non-selective cation channel that would depolarize the membrane potential after being activated at a hyperpolarized membrane potential23. However, in the VTA DA neurons, results concerning the HCN channels to the spontaneous firing are controversial15, 23–25.
Another non-selective cation channel, NALCN, which unlike HCN, is a non-voltage dependent channel26, and is reported to be among the candidates for molecular correlates of the persistent background Na+ leak currents in the VTA DA neurons 27, 28. The NALCN-mediated background Na+ leak currents are found to be involved in modulation of firing activity in a variety of neurons including DA neurons in the SNc26, 28–31. However, it has not been reported if NALCN play a role in spontaneous firing of the VTA DA neurons, although the VTA DA neurons have larger Na+ leak currents than SNc DA neurons do 15.
TRP channels are a large class of non-selective cation channels, and are widely distributed in the peripheral and central nervous system. TRPC3, which has a high homology with TRPC632, is found to be involved in the regulation of cardiac and SNc DA neuronal excitability, generating depolarizing currents, triggering action potentials and participating in cellular rhythmic firing31, 33, 34. The role of TRP channels in the regulation of VTA DA neuronal excitability has not been described.
In this study, we drove to find channel conductance which contribute to the subthreshold depolarization and thus the spontaneous firing of the VTA DA neurons. And further more we investigated if these channels are the molecular mechanism for the altered function activity of the VTA DA neurons related to depression-like behaviors in mouse model of depression. We started by profiling the expression of non-selective cation channels (NSCCs) of the VTA DA neurons using method of Patch-Seq from midbrain DA neurons projecting to different brain regions, and then focused on HCN, NALCN, TRPC6 and TRPV2 channels which are dominantly expressed in these DA neurons.
Results
Inflow of extracellular Na+ contribute to the subthreshold depolarization of the VTA DA neurons
One key feature of the midbrain DA neurons is that these neurons are relatively depolarized in the resting condition; the resting membrane potential (RMP) is far from the K+ equilibrium potential (∼-55 mV vs ∼-90 mV)15, which enable the spontaneous firing possibly. Thus there must exist persistent inward depolarizing conductance counterbalancing the hyperpolarizing K+ conductance which otherwise would maintain the RMP at a hyperpolarized level. The main aim of this study is to identify the subthreshold depolarizing conductances which contribute to the spontaneous firing of the VTA DA neurons. For this, we first observed firing frequency and the RMP of the VTA DA neurons using patch clamp recordings. The midbrain DA neurons, marked by dopamine transporter (DAT), mainly located in the VTA and SNc (Fig. 1Ai). We recorded neurons from the VTA brain slices of mice, and performed single-cell PCR post electrophysiologic recordings to identify the DA neurons with established markers for DA neurons (TH, DAT, D2R (type 2 dopamine receptor), and GIRK2 (G protein-gated inward rectifier K inwardly rectifying K+ channels)). Although the majority of cells in the VTA area are DA neurons (∼60%), there are still about 30% GABA neurons and a small number of glutamatergic neurons 35, 36. Glutamatergic- and GABAergic neurons were also single-cell PCR typed by using markers of vGluT2 (vesicular glutamate transporter 2) and GAD1 (glutamic acid decarboxylase 1), respectively (Fig. 1Aii).

The effects of extracellular Ca2+ and Na+ on firing activity of the VTA DA neurons. A. Identification of the VTA DA neurons. i: confocal images showing the anatomical distribution of DA neurons in the VTA and SNc; the DA neurons were identified to be DAT-immunofluorescence positive (magnification,10X; scale bar, 100 µm). ii: single-cell PCR results; four cells showed the presence of genes indicated. B. The effect of replacing extracellular Ca2+ with Mg2+ on firing frequency of the VTA DA neurons. Example time-course (i) and traces (ii) of the spontaneous firing before and after replacement of extracellular Ca2+ (2 mM) by an equimolar amount of Mg2+. iii: Summarized data for ii. Firing of the VTA DA neurons were recorded using loose cell-attached patch from a brain slice of the VTA (n=6). C. The effect of replacing extracellular Ca2+ with Mg2+ on the resting membrane potential (RMP) of the VTA DA neurons, in the presence of 1 μM TTX. Example time-course (i) and summarized data (ii) for the resting membrane potential before and after replacement of extracellular Ca2+ (2 mM) by an equimolar amount of Mg2+ (n=6). D. i: Replacement of external Na+ by equimolar NMDG resulted in hyperpolarization of the resting membrane potential of the VTA DA neurons, in the presence of 1 μM TTX. ii: Summarized data for i (n=5). Paired-sample T test, *** P < 0.001, ** P < 0.01, * P < 0.05, n.s. P > 0.05. n is number of neurons recorded.
To focus on the intrinsic channel conductance for spontaneous firing, potential input modulation from fast-type transmitter transmission to the VTA DA neurons, namely activation of AMPA/kainite/NMDA receptor and GABAA receptor were blocked by receptor antagonists CNQX, DL-AP5 and picrotoxin 15, respectively, in the following experiments.
We first studied whether inflow of extracellular Ca2+ contributed to initiation of spontaneous firing in the VTA DA neurons. It has been shown that, unlike the SNc DA neurons, the VTA DA neurons do not have subthreshold Ca2+ oscillatory waves 15, suggesting that subthreshold Ca2+ should not be an important component of subthreshold depolarizing conductance in the VTA DA neurons. In line with this finding, we found in our study, replacing Ca2+ with Mg2+ from the extracellular recording solution (ACSF, artificial cerebral spinal solution) did not reduce, but rather instead, increased the firing frequency of the VTA DA neurons (Fig. 1B, from 1.90 ± 0.22 Hz to 3.05 ± 0.33 Hz, n = 6, P < 0.001). In consistent with this, the RMP of the VTA DA neurons was also not affected by replacing Ca2+ with Mg2+ from ACSF (Fig. 1C, from -50.76 ± 1.16 mV to -48.83 ± 1.76 mV, n = 6, P > 0.05).
We then, in comparison with Ca2+, observed the role of extracellular Na+ in the RMP of the VTA DA neurons. For this, we followed the method of a previous study15, by replacing Na+ in ACSF with NMDG (N-methyl-d-glucamine); TTX (Tetrodotoxin) was also added to block the TTX-sensitive Na+ currents, which is known to be the main contributor to the suprathreshold depolarization component of the action potential. Replacement of the extracellular Na+ with NMDG resulted in a hyperpolarization of the RMP, from -46.00 ± 2.92 mV to -66.80 ± 1.53 mV (n = 5, P < 0.05, Figure 1D), indicating a persistent inflow of Na+ through a TTX-insensitive conductance which caused significant depolarization of the neurons, contributing significantly to the subthreshold depolarization of the VTA DA neurons.
Taken together, above results indicate persistent Na+ influx contribute to the subthreshold depolarization of the VTA DA neurons.
Potential candidates of channel conductance contributing to subthreshold depolarization of the VTA DA neurons
The channel conductance mediating the above-described persistent Na+ influx should come from a cation channel(s) permeating to Na+. We thus investigated the presence and expression level of non-selective cation channels (NSCCs) in the VTA DA neurons using a combination of patch clamp and single-cell RNA-Seq (Patch-seq) technology37. In this part of the study, we considered the heterogeneity and projection-specificity of the VTA DA neurons, i.e. VTA DA neurons projecting to different brain regions have different electrophysiological characteristics38. Using retrograde labelling techniques using retrobeads, sixty VTA neurons projecting to five different brain regions (medial prefrontal cortex, mPFC; basal lateral amygdala, BLA; nucleus accumben core, NAc c; nucleus accumben lateral shell, NAc ls; nucleus accumben medial shell, NAc ms) (sFig.1) were collected for RNA-Seq, using patch-clamp electrodes. Consistent with previous study38, the VTA DA neurons projected to above different brain regions were anatomically congregated into subregions of the VTA (sFig.2). The high expression of biomarkers (TH, Ddc and DAT) in the 45 cells of 60 cells (Fig. 2A) indicates that these are DA neurons. In addition, a significant proportion of neurons (predominantly those projecting to NAc ms, BLA, and mPFC) have biomarkers (VGluT1-3) of glutamatergic neurons, predicting a possible coexistence of neurotransmitters (DA and glutamate)39. In contrast, fewer GABAergic neuronal markers (GAD1/2 and VGAT) co-expressed with the DA neurons, which is consistent with previous studies that VTA DA neurons coexpressing GABAergic neuronal markers mainly project to the lateral habenula40. It needs to be noted that some neurons in the VTA only expressed markers for glutamatergic or GABAergic neurons, these neurons were excluded from further analysis as we focused our study on the DA neurons.

Gene expression profile of non-selective cation channels (NSCCs) in the VTA DA neurons. Single-cell RNA-Seq was performed on the VTA neurons projecting to five different brain regions of mice (NAc c, NAc ms, NAc ls, BLA, mPFC). A. Gene expression profile of markers for neuron subtypes from 45 VTA neurons; the neuron subtypes included: dopaminergic (Th, Ddc DAT), GABAergic (Gad1, Gad2, VGAT) and glutamatergic (VGluT2, VGluT1, VGluT3), which was arranged in different rows indicated in the right labels and in the left-colored vertical lines; projection targets of these neurons were indicated at the top by the colored lines and labels. Relative expression levels of these genes were indicated by the dark-blue color intensity which was transformed from the log2 values of the number of transcripts per million (FPKM) plus 1. B. Relative gene expression levels of TRP channels (i) and other NSCCs (ii) in 45 individual VTA DA neurons and the population average (mean, right columns). Each column of the individual neurons in (i) and (ii) corresponded to the columns in A. (iii) Bar graph of the mean log2 (FPKM +1) for the top 8 NSCCs in descending order. Error bars indicate SEM.C. Gene expression profile of aforementioned top 8 NSCCs from 45 VTA neurons.
Expression files of NSCCs in the VTA DA neurons classified by projection specificity were analyzed and shown in Fig. 2B. Different colored strips on the top of the figure corresponded to the projection specificity coded by the same colors in Fig. 2A. Multiple transient receptor potential channels (TRP) were present in the VTA DA neurons, with prominent expression level of TRPC6 and TRPV2 (Fig. 2Bi). Other prominently expressed NSCCs included HCN2, HCN3, NALCN and pannexin 1 (Panx1) (Fig. 2Bii). Summarized averaged relative expression levels for eight most richly expressed NSCCs were shown in Fig. 2Biii. Furthermore, projection-specific expression of these dominantly expressed NSCCs were analyzed and shown in Fig 2C; interestingly only TRPC6 seemed expressed in a projection-specific manner, namely, the VTA DA neurons projecting to the NAc have higher TRPC6 expression than the VTA DA neurons projecting to the BLA and the mPFC (Fig 2C). In our subsequent study, we focused our study on HCN, NALCN, TRPC6 and TRPV2, one for they are the prominently expression channels, and two for some of these channels have been indicated in modulation of excitability of different neuron types23, 24, 26, 28–31, 41. Panx1 was investigated in a separate study since it normally composes the semi channels which are different from these more conventional ion channels.
HCN does not contribute to the spontaneous firing of the VTA DA neurons
We mainly used two pharmacological tools of HCN channel blockers, CsCl and ZD728815, 24 to explore the role of HCN channels in the spontaneous firing of the VTA DA neurons. Efficient blocking effect of these blockers on HCN channel were first verified. For this, the sag potential produced by a hyperpolarizing current (-100 pA) injection was used to assess HCN activity24. Both CsCl (3 mM) and ZD7288 (60 μM) effectively reduced the sag potential (from 16.43 ± 2.96 mV to 3.84 ± 1.92 mV, n = 4, P < 0.05; from 19.38 ± 3.14 mV to 4.18 ± 2.60 mV, n = 4, respectively, P < 0.05) (sFig. 3A and B).
However, these same HCN blockers did not inhibit the spontaneous firing of the VTA DA neurons; CsCl slightly increased (1.96 ± 0.19 Hz to 2.14 ± 0.34 Hz, n = 7) whereas ZD7288 slightly decreased the firing frequency (1.65 ± 0.25 Hz to 1.50 ± 0.24 Hz, n = 13), but none of these effects were statistically significant (P > 0.05) (sFig. 3C and D). It has been reported that VTA DA neurons projecting to the NAc lateral shell have more pronounced HCN/Ih currents than other VTA DA neurons 38. However, even the VTA DA neurons projecting to the NAc lateral shell (retrogradely labelled by retrobeads), no effect of CsCl or ZD7288 on the spontaneous firing of the VTA DA neurons were observed (from 2.04 ± 0.24 Hz to 1.93 ± 0.22 Hz, n = 5, by CsCl, and from 1.71 ± 0.29 Hz to 1.65 ± 0.33 Hz, n = 5, by ZD7288, P > 0.05) (sFig. 4).
HCN are activated by membrane hyperpolarization, with an activation threshold around -70∼-90 mV (HCN2, HCN3)42, 43. At a depolarized RMP like these in the VTA DA neurons (-51.28 ± 1.85 mV, n = 8; e.g. -54.50 mV, sFig 3Ai, and -53.50mV, sFig. 3Bi), HCH are mostly likely not activated thus would not participate in generation of spontaneous firing. To further prove this, we tested if a more hyperpolarized RMP would involve HCN in the spontaneous firing of the VTA DA neurons. For this, we first lowered the K+ concentration in the extracellular ACSF from 3 mM to 1.5 mM to increase the gradient between inside and outside cellular K+; this maneuver indeed hyperpolarized the cell membrane from -55.00 ± 2.74 mV to -66.40 ± 3.28 mV (n = 5, P < 0.05 mV) (sFig. 4C). Interestingly, under 1.5 mM extracellular K+, the spontaneous firing of the VTA DA neurons was almost totally blocked by ZD7288 (sFig. 4D), although an initial enhancement was seen in some neurons (sFig. 4Di).
We tested another possible mechanism for HCN’s failure to participate in generation of VTA DA firing. It has been reported that in the midbrain SNc DA neurons, HCN is involved in the spontaneous firing in young but not in adult mice, due to a more hyperpolarization-shifted activation threshold of HCN in SNc DA neurons in adult mice. We tested if this could also be the case in the VTA DA neurons. Indeed, as shown in sFig. 4E, in contrast to what we saw in adult mice, the spontaneous firing frequency of the VTA DA neurons in young mice (less than 15 days postnatal) was significantly reduced by ZD7288 (from 1.86 ± 0.29 Hz to 0.98 ± 0.24 Hz, n = 9, P < 0.01).
Taken together, above results suggest HCN is not involved in the spontaneous firing of the VTA DA neurons in adult mice, due to a depolarized RMP and a hyperpolarization-shifted activation property.
NALCN contributes to subthreshold depolarization and spontaneous firing of the VTA DA neurons
The Na+ currents produced by NALCN have been suggested to be an important component of background Na+ currents in multiple central neurons including DA neurons in the substantia nigra28. We next investigated if NALCN also play a role in setting the RMP and in the spontaneous firing of the VTA DA neurons. In consistent with above RNA-Seq results, both immunofluorescence (Fig. 3A) and single-cell PCR (Fig. 3B) results confirmed broad expression of NALCN in the VTA DA neurons.

NALCN contributes to subthreshold depolarization and spontaneous firing of the VTA DA neurons. A. Confocal images showing co-expression of NALCN (green) and DAT (red) representing DA neurons (scale bar, 10 µm). B. i: Single-cell PCR from the VTA DA neurons with the expression of NALCN. ii: Percentage of NALCN positive neurons from 15 DA neurons (with expression of DAT). C. Example time course (i) and summarized data (ii) showed that NALCN channel blockers (GdCl3) significantly hyperpolarized the resting membrane potential (RMP) (n=5). Paired-sample T test, * P < 0.05. D. Example time-course and traces (i) and summarized data (ii) of the effect of GdCl3 on spontaneous firing frequency in DA neurons (n=7). Paired-sample T test, ** P < 0.01. E. shRNA against NALCN carried by AAV virus (i) (NALCN-shRNA) was injected into the VTA of mice, the mRNA level in the shRNA-NALCN transfected VTA (NALCN-KD) and the scramble shRNA transfected VTA (Control) was analyzed using qPCR (ii) (n=6). Two-sample T test, ** P < 0.01. F. Confocal images showing the expression of AAV9-NALCN-shRNA-GFP (green) in the VTA DA neurons (DAT, red) (scale bar, 10 µm). G. Loose cell-attached current clamp recordings of the spontaneous firing of the VTA DA neurons transfected with either NALCN-shRNA (n=12) or scramble-shRNA (Con, n=10) (both GFP and DAT positive). Examples of firing traces (i) and summarized data (ii) were shown. Two-sample T test, **** P < 0.0001. H. Whole-cell current clamp recordings of the resting membrane potential (RMP) of the VTA DA neurons transfected with either NALCN-shRNA (NALCN-KD, n=18) or scramble-shRNA (Con, n=15) (both GFP and DATpositive). Examples of firing traces (i) and summarized data (ii) were shown. Two-sample T test, **** P < 0.0001. n is number of neurons recorded.
GdCl3 (100 μM), a nonspecific NALCN blocker 29, 30, depolarized the RMP of the VTA DA neurons from -53.60 ± 4.78 mV to -67.80 ± 3.23 mV (n = 5, P < 0.05) (Fig. 3C), reduced the spontaneous firing frequency of the VTA DA neurons from 1.89 ± 0.29 Hz to 1.32 ± 0.37 Hz (n = 7, P < 0.01) (Fig. 3D).
To observe a more specific effect on NALCN, a shRNA against NALCN was used to knockdown NALCN. For this, AAV9 viral construct (AAV9-U6-shRNA(NALCN)-CMV-GFP) was injected into the VTA of a mouse; similar AAV viral construct containing scramble-shRNA of nonsense sequences was utilized as controls. The qPCR results show sufficient knockdown of NALCN mRNA (NALCN-shRNA: 0.32 ± 0.07, control scramble-shRNA: 1.07 ± 0.19, n = 6, P < 0.01, Fig. 3E) in the VTA tissue. Immunofluorescence results (Fig. 3F) show efficient infection of the VTA DA neurons (GFP expression in the DAT-positive neurons) by the virus. Knockdown of NALCN in the VTA DA neurons by shRNA almost completely silenced the firing of the VTA DA neurons (0.07 ± 0.04 Hz vs 1.84 ± 0.25 Hz in shRNA (n = 12) and scramble-shRNA (n = 10) infected VTA DA neurons, respectively, P < 0.0001, Fig. 3G). Furthermore, the RMP of the VTA DA neurons was significantly hyperpolarized (-60.67 ± 2.33 mV vs -48.9 ± 1.45 mV in shRNA and scramble-shRNA infected VTA DA neurons, respectively, n = 18 and 15, P < 0.0001, Fig. 3H).
Taken together, above results suggest that NALCN is a major contributor to the subthreshold depolarization and contribute significantly to the generation of spontaneous firing in the VTA DA neurons.
TRPC6 contributes to subthreshold depolarization and spontaneous firing of the VTA DA neurons
Above RNA-Seq results suggest a broad and strong expression of TRPC6 and TRPV2 channels in the VTA DA neurons. This part of the experiments was focused on the role of these two TRP channels in subthreshold depolarization and spontaneous firing of the VTA DA neurons.
In consistent with the RNA-Seq results, single-cell PCR experiments confirmed high proportion expression of TRPC6 and TRPV2 in the VTA DA neurons (Fig. 4A); among the 28 VTA DA neurons (DAT+), 20 neurons expressed TRPV2 (71.4%), and 18 neurons (64.3%) expressed TRPC6. TRPC3, which is highly homologous with TRPC644 and has been reported to be involved in the firing activity of the SNc DA neurons31, was not detected in RNA-Seq study (Fig. 2B), nor in the single-cell PCR experiment (Fig. 4A). These results reciprocally confirmed the reliability of both RNA-Seq and single cell PCR results.

TRP channels contributes to subthreshold depolarization and spontaneous firing of the VTA DA neurons. A. The expression of TRP channels in VTA DA neurons. i: Single-cell PCR from 5 VTA cells (C1-C5). ii: Percentage of TRP channels (C3, C6 and V2) positive neurons in the VTA DA neurons (DAT positive). B and C. Example time-course (i), traces (ii) and the summarized data (iii) for the effect of nonselective cation channel blockers 2-APB (100 μM, n=12) (B), FFA (100 μM, n=13) (C) on the spontaneous firing frequency in the VTA DA neurons. B: Wilcoxon matched-pairs signed rank test, C: Paired-sample T test, *** P < 0.001. n is number of neurons recorded. D and E. Example time-course (i) and the summarized data (ii) for the effect of nonselective cation channel blockers 2-APB (n=6) (D), FFA (n=6) (E) in the resting membrane potential (RMP) of the VTA DA neurons. Paired-sample T test, ** P< 0.01. n is number of neurons recorded.
General roles of TRP channels in subthreshold depolarization and spontaneous firing of the VTA DA neurons were first assessed using two non-specific broad-spectrum TRP channel blockers, 2-aminoethoxydiphenylborane (2-APB; 100 μM) and flufenamicacid (FFA; 100 μM). Both TRP channel blockers significantly reduced the firing frequency of the VTA DA neurons (2-APB: from 1.32 ± 0.27 Hz to 0.06 ± 0.02 Hz, n = 12, P < 0.001; FFA: from 1.38 ± 0.17 Hz to 0.52 ± 0.06 Hz, n = 13, P < 0.001; Fig. 4B, 4C). Accordingly, both blockers also significantly hyperpolarized the RMP of the VTA DA neurons (2-APB: from -51.01 ± 2.20 mV to -61.64 ± 1.28 mV, n = 6, P < 0.01; FFA: from -50.50 ± 2.36 mV to -69.65 ± 2.06 mV, n = 6, P < 0.01; Fig. 4D, 4E).
We then tested a more TRPV channel-specific blocker ruthenium red (RR), to study possible role of TRPV2 (and other TRPV) in the spontaneous firing of the VTA DA neurons. RR (60 μM), on average statistically, did not affect the spontaneous firing of the VTA DA neurons (from 2.30 ± 0.31 Hz to 2.18 ± 0.32 Hz, n = 9, P > 0.05) (sFig. 5). However, it needs to be noted that among the nine VTA DA neurons we tested, both increase (sFig. 5B) and decrease (sFig. 5C) of firing frequency by RR were seen, thus with opposite changes of firing frequency in different populations of neurons (sFig. 5A), no overall effect of RR was obtained from the current analysis.
We then focused our next study on TRPC6. In consistent with both RNA-Seq (Fig. 2B) and single-cell PCR (Fig. 4A) results, the mRNA level of TRPC6 in mPFC-projecting VTA single DA neuron is significantly lower than that in NAc c-projecting VTA single DA neuron (0.56 ± 0.12, n = 25 for mPFC-projecting TH-positive cells vs 1.09 ± 0.10, n = 28 for NAc c-projecting TH-positive cells, ** P < 0.01, Fig. 5A) The immunofluorescence results also demonstrated strong expression of TRPC6 protein in the VTA DA neurons (Fig. 5B, TH-positive). A AAV viral construct with shRNA against TRPC6 (AAV9-U6-shRNA (TRPC6)-CMV-GFP) was injected into the VTA of mice, to knockdown TRPC6; efficiency of this knockdown was assessed by using qPCR measuring the mRNA level of TRPC6 in the VTA tissue (Fig. 5C), and efficiency of viral infection into the VTA DA neurons (marked by DAT) was observed through visualization of GFP (Fig. 5D). Both qPCR (Fig. 5C) and immunofluorescence (Fig. 5D) results indicated a sufficient repression of TRPC6 in the VTA DA neurons. Indicative of a significant role in the spontaneous firing and subthreshold depolarization, knockdown of TRPC6 (TRPC6-KD) resulted in a substantial reduction in the spontaneous firing frequency (0.80 ± 0.25 Hz, n = 9 for TRPC6-KD vs 1.90 ± 0.27 Hz, n = 9 for scramble-shRNA, P < 0.01, Fig. 5E), and hyperpolarization of the RMP (-58.21 ± 1.79 mV, n = 10 for TRPC6-KD vs -50.02 ± 0.67 mV, n = 10 scramble-shRNA, P < 0.001, Fig. 5G) of the VTA DA neurons. In addition, the inhibitory effect of 2-APB on the firing of VTA DA neurons infected with TRPC6-shRNA largely diminished, with no statistical difference in firing frequency before and after dosing (from 0.58 ± 0.15 Hz to 0.40 ± 0.15 Hz, n = 7, P > 0.05, Fig. 5F).

TRPC6 contributes to subthreshold depolarization and spontaneous firing of the VTA DA neurons. A. The normalized expression profile of TRPC6 in NAc c and mPFC-projecting VTA DA neurons was verified using single cell-qPCR, (NAc c: n=28; mPFC: n=25, Both TH positive) Mann-Whitney U test, ** P <0.01. B. Confocal images showing co-expression of TRPC6 (green) and TH (red) representing DA neurons (scale bar, 10 µm). C. The efficiency of shRNA knockdown of TRPC6 in the VTA verified by qPCR. Two-sample T test, ** P <0.01. shRNA against TRPC6 carried by AAV virus (i) (TRPC6-shRNA) was injected into the VTA of mice, the mRNA level in the shRNA-TRPC6 transfected VTA (TRPC6-KD) and the scramble shRNA transfected VTA (Con) was analyzed using qPCR (ii). D. Immunofluorescence labeling showing the expression of AAV9-shRNA(TRPC6)-GFP (green) and DAT (red) in the VTA (scale bar, 10 µm). E. Loose cell-attached current clamp recordings of the spontaneous firing of the VTA DA neurons from the mice transfected with either TRPC6-shRNA (TRPC6-KD, n=9) or scramble-shRNA (Con, n=9) (both GFP and DAT positive). Examples of firing traces (i) and summarized data (ii) were shown. Two-sample T test, ** P < 0.01. F. Example time-course (i) and summarized data (ii) showed that shRNA knockdown of TRPC6 in the VTA decreased the 2-APB-inhibited firing responses of the VTA DA neurons. (n=7, both GFP and DAT positive), Wilcoxon matched-pairs signed rank test, n.s. P > 0.05. G. Whole-cell current clamp recordings of the resting membrane potential (RMP) of the VTA DA neurons transfected with either TRPC6-shRNA (TRPC6-KD, n=10) or scramble-shRNA (Con, n=10) (both GFP and DAT positive). Examples of firing traces (i) and summarized data (ii) were shown. Two-sample T test, *** P < 0.001.
Taken together, above results indicate TRPC6 is an important contributor in subthreshold depolarization and spontaneous firing of the VTA DA neurons.
Down-regulation of TRPC6 contributes to the altered firing activity of the VTA DA neurons in depression model
In multiple depression models, the depression-like behavior was directly linked to the altered firing activity of the VTA DA neurons [10-15]. In consideration of the evidence we described above that NALCN and TRPC6 play key roles in firing activity of the VTA DA neurons, we went further to study if these channels also contributed to the altered firing activity of the VTA DA neurons and to the development of the depression-like behavior in depression models of mice.
We first established a mice depression model of chronic mild unpredictable stress (CMUS) 45, which, after 5 weeks subjecting to two different stressors every day (Fig. 6A), manifested depression-like behaviors in the sucrose preference test (SPT) and the tail suspension test (TST) (Fig. 6B), with reduced sucrose preference and lengthened immobility time, respectively. Multiple other behaviors tests were also performed on these CMUS mice (sFig. 6), all indicating depression/anxiety behaviors.

CMUS depression mice have a decreased firing activity and downregulated TRPC6 expression in the VTA DA neurons. A. Experimental procedure timeline. B. i: Sucrose preference test for CMUS mice. Mann-Whitney U test, *** P < 0.001, compared with control mice. ii: Tail suspension test for CMUS mice, Two-sample T test, *** P < 0.001, compared with control mice. C. Loose cell-attached current clamp recordings of the spontaneous firing of the VTA DA neurons from the CMUS (n = 28 cells, DAT positive) and the control (n = 18 cells, DAT positive) mice. Mann-Whitney U test, **P < 0.01. D. Representative Western blot assay (i) and summarized data (ii) showing the expression of TRPC6 and GAPDH in the VTA of the control (Con) and the CMUS mice. Two-sample T test, ** P < 0.01. n is the number of mice used. E. i and ii: Example time-course (up) and traces (bottom) showing the characteristic firing responses of 2-APB-inhibited mPFC-projecting VTA DA neurons in Con (i) and CMUS (ii) groups. iii. The effects of TRP channel inhibitor (2-APB) on the spontaneous firing activity of the mPFC-projecting VTA DA neurons in the control (n = 12 cells, DAT positive) and CMUS (n = 15 cells, DAT positive) mice. One-way repeated measures ANOVA with Dunnett’s multiple comparisons test, n.s. P > 0.05, * P < 0.05, *** P < 0.001. iv. The inhibition rate (%) on firing rate by 2-APB in the control group (n = 12) and the CMUS group (n = 15). Mann-Whitney U test, *** P < 0.001.
It has been shown that a reduced firing activity in the VTA DA neurons is responsible for the depression-like behavior in the CMUS model46, 47. In consistent with this finding, we also found the firing frequency of the VTA DA neurons from the CMUS mice was significantly reduced as compared with that from the control mice (2.83 ± 0.42 Hz, n = 18 for control mice vs 1.30 ± 0.14 Hz, n = 28 for CMUS mice, P < 0.01, Fig. 6C). In agreement with a role for TRPC6 in this reduced firing activity, TRPC6 protein in the VTA tissue was found to be down-regulated in western blot experiments (Fig. 6D). On the other hand, NALCN protein in the VTA was not altered in the CMUS mice model of depression (sFig. 7).
We also tested if this down-regulation of TRPC6 protein could also be found in a similar but different model of depression. For this, a chronic restraint stress (CRS) model was used. After 3 weeks of restraint stress stimulation, the CRS mice developed similar depression/anxiety behavior in the behavior tests like these similarly performed in the CMUS model (sFig. 8A-G). Importantly, mice with CRS-induced depression also showed a significant downregulation of TRPC6 protein in the VTA (0.43 ± 0.09-fold, n = 6 for control and n = 9 for CRS, P < 0.001, sFig. 8H).
It is known that CMUS mainly decreases the activity of VTA dopamine neurons that project to mPFC11, 47. To prove further that the decreased firing activity of the mPFC-projecting VTA DA neurons in the CMUS mice was associated with the down-regulation of TRPC6 expression, we reasoned that a down-regulated TRPC6 would play a less role in a reduced firing activity like that found in the CMUS mice, thus the firing activity in these mice would respond less to the TRP channel inhibitors. Indeed, TRP channel inhibitor 2-APB lost its inhibitory effect on the firing activity of the mPFC-projecting VTA DA neurons from the CMUS mice (1.61 ± 0.23Hz to 1.19 ± 0.22 Hz, n = 15, P > 0.05) but not from the control mice (3.74 ± 0.42 Hz to 0.17 ± 0.09 Hz, n = 12, P < 0.001) (Fig. 6E).
Taken together, above results suggest downregulation of TRPC6 is a key determinant for the altered firing activity of the VTA DA neuron in mice models of depression
Down-regulation of TRPC6 in the VTA DA neurons confer the mice with depression-like behavior
If down-regulation of TRPC6 is crucial for the depression-like behaviors, like that indicated above in the CMUS and the CRS depression models, then down regulation of TRPC6 in non-stressfully treated mice should also develop depression-like behavior. We tested this possibility by selectively knocking down TRPC6 in the VTA DA neurons, using DAT-Cre mice injected with a AAV viral construct (AAV9-hSyn-DIO-shRNA (TRPC6) -RFP) (Fig. 7A), driving the expression of shRNA against TRPC6 selectively in the VTA DA neurons. Three weeks after the AAV injection, the qPCR (Fig. 7B) and the immunofluorescence results (Fig. 7C) indicated an efficient downregulation of TRPC6 in the VTA DA neurons.

Selective knockdown of TRPC6 in the VTA DA neurons produces depression-like and anxiety-like behaviors and selective overexpression of TRPC6 in the VTA DA neurons rescues the TRPC6-knockdown-mediated depression-like and anxiety-like behaviors. A. shRNA against TRPC6 carried by AAV-loxp virus (TRPC6-shRNA) was injected into the VTA of the DAT-Cre mice. B. The mRNA level in the shRNA-TRPC6 transfected VTA (TRPC6-cKD) and the scramble shRNA transfected VTA (Con) was analyzed using qPCR (Con: n=4; TRPC6-cKD: n=6). Mann-Whitney U test, * P < 0.05. C. Immunofluorescence labeling showing the expression of AAV9-hSyn-DIO-shRNA(TRPC6)-RFP (red) and DAT (green) in the VTA of the DAT-Cre C57BL/6 mice (scale bar, 10 µm). D. The effects of Cre-induced conditional knockdown of TRPC6 in the VTA on the behaviors of mice in the sucrose preference test (i), the tail suspension test (ii), and the elevated plus-maze test (iii) (Con: n=9; TRPC6-cKD: n=13). Two-sample T test, ** P < 0.01, *** P < 0.001. E. AAV9-DIO-TRPC6-GFP was injected into the VTA of the DAT-Cre mice, 7 days after injection of AAV9-hSyn-DIO-shRNA(TRPC6)-RFP. F. The protein level in the AAV9-DIO-TRPC6-GFP transfected TRPC6-cKD VTA (TRPC6-cKD+TRPC6-cOE) and the scramble RNA transfected Con and TRPC6-cKD VTA (Con and TRPC6-cKD) was analyzed using Western blot (Con: n=7; TRPC6-cKD: n=8; TRPC6-cKD+TRPC6-cOE: n=7). Kruslal-Wallis-H test with Dunnett’s multiple comparisons test, **P < 0.01. G. Immunofluorescence labeling showing the expression of AAV9-hSyn-DIO-shRNA(TRPC6)-RFP (red), AAV9-DIO-TRPC6-GFP (green) and DAT (blue) in the VTA of the DAT-Cre C57BL/6 mice (scale bar, 10 µm). H. The effects of Cre-induced conditional overexpression of TRPC6 in the VTA on the selective-knockdown-TRPC6-induced depression-like behaviors of mice in the sucrose preference test (i), the tail suspension test (ii), and the elevated plus-maze test (iii) (Con: n=11; TRPC6-cKD: n=11; TRPC6-cKD+TRPC6-cOE: n=11). One-way ANOVA with Dunnett’s multiple comparisons test, * P < 0.05, ** P < 0.01, *** P < 0.001.
We next compared the depression- and anxiety-like behaviors in these conditionally TRPC6-knockout mice (TRPC-cKD) with that in the control mice (infected with virus carrying the scrambled shRNA). As shown in Fig. 7D, in the TRPC6-cKD mice, the sucrose preference was significantly reduced (7Di, 72.60 ± 3.52 %, n = 13 for TRPC-cKD, vs 92.74 ± 0.86 %, n = 9 for control, P < 0.01), the immobility time in the TST was significantly lengthened (7Dii, 192.10 ± 3.13 s vs 133.20 ± 8.89 s, P < 0.001), and the time spent in the open arm in the elevated plus maze test was significantly reduced (7Diii, 7.29 ± 1.45 s vs 44.33 ± 3.78 s, P < 0.001). What’s more, the Cre-dependent TRPC6-overexpression in VTA DAT-Cre mice rescued the selective-TRPC6-knockdown-induced depression-like behaviors (Fig.7E-H). These results suggest downregulation of TRPC6 in the VTA DA neurons confers the mice with phenotypes of depression/anxiety.
Discussion
In this study, we made a systematic study on the molecular mechanism for the subthreshold depolarization that drive spontaneous firing of the VTA DA neurons. We identified TRPC6 channels, alongside NALCN, as major contributors to this subthreshold depolarization and related spontaneous firing, and further importantly, we also demonstrated that TRPC6 contributed to the altered firing activity of the VTA DA neurons under states of depression behaviors.
The featured nature of a relatively depolarized resting membrane potential in the VTA DA neurons imposes a need for a full understanding of the channel conductance underlying this depolarization. It is first clear from this current and previous studies that this conductance is mediated by a persistent Na+ influx. Unlike the DA neurons in the SNc, where Ca2+ influx is needed for the spontaneous firing 48, the results in our and others’ studies indicate Ca2+ influx are not necessary for the spontaneous firing of the VTA DA neurons, rather, replacement of Ca2+ ions in the extracellular fluid with Mg2+ accelerates the frequency of spontaneous firing (Fig. 1B) 15, possibly due to a reduced activity of the Ca2+-activated K+ currents. In consistent with these finding and more precisely for a role of Ca2+ influx on the subthreshold depolarization, removing extracellular Ca2+ did not hyperpolarize the RMP. On the other hand, in consistent the previous study 15, a TTX-insensitive Na+ influx clearly contributed to the subthreshold depolarization (Fig. 1D).
A TTX-insensitive nature of this Na+ conductance suggests it is likely that cation conductance permeable to Na+ are the molecular correlates. We first focused on the HCN channels because, (1) it has been suggested HCN channels are important regulators for the spontaneous firing of VTA DA neurons under states of depression behaviors7, 11; (2) HCN are among most highly expressed NSCCs in the VTA DA neurons in our single cell RNA-Seq study; (3) HCN are permeable to Na+ 49. However, it is clear from our study that HCN does not contribute to the spontaneous firing of the VTA DA neurons in the adult mice; none of the known HCN blockers we used had any significant effects on the firing activity. Presence of HCN has long been used as a signature of DA neurons50, also as a differentiating factor for the projection-specificity of the VTA DA neurons38. Nonetheless, contribution of HCN to the spontaneous firing of the VTA DA neurons has been controversial; the HCN blockers ZD7288 and CsCl have been reported as both effective23, 24, 51 and non-effective 15 on the spontaneous firing of the VTA DA neurons. A closer inspection into our and others’ results present a possible explanation for these different results: in the younger rodents (less than one month old) (sFig. 4) 52, the HCN in the DA neurons play a more important role whereas in the adult mice (∼ 8 weeks)52, like the ones we used in this study, the HCN do not contribute to the spontaneous firing of the VTA DA neurons. This is likely due to a shift of activation gating of HCN channels in a hyperpolarization direction with age, thus the modulation of HCN on the firing activity diminishes with age, as it is described in the SNc DA neurons52. In consistent with this, we found hyperpolarizing the RMP rendered the VTA DA neurons of the adult mice with sensitivity to the HCN blockers. Thus, the VTA DA neurons in adult mice do not use HCN to depolarize the membrane to generate action potentials.
NALCN is widely expressed in central neurons53, 54, and is a popular candidate considered for the ion mechanism of the subthreshold depolarization currents and Na+ leaky currents. NALCN has been shown to be an important component of background Na+ currents and to be important for neuronal excitability in the hippocampal neurons, posterior rhomboid nucleus (Retrotrapezoid nucleus/RTN)) chemo-sensitive neurons (CO2/H+-sensitive neurons), GABA neurons and DA neurons in the substantia nigra, spinal projection neurons 26, 28–31, 41. Our results with single cell RNA-Seq and immunofluorescence methods validated high level expression of NALCN in the VTA DA neurons; both the pharmacological and the NALCN-gene-knockout experiments demonstrated convincingly involvement of NALCN in subthreshold depolarization and spontaneous firing of the VTA DA neurons.
We did not detect alteration of NALCN protein expression in the depression model of CMUS in the VTA tissue. However, this does not completely exclude a possible contribution of NALCN to the altered functional activity of the VTA DA neurons which underlies the depression behaviors. Future study focusing on the functional property of NALCN in the cellular level of the VTA DA neurons under a state of depression is needed to clarify this issue. NALCN is after all a potential drug target in consideration of its important contribution to the resting membrane potential and functional activity of neurons.
The most interesting and important finding of this study is the role of TRPC6 in regulation of the firing activity of the VTA DA neurons in both physiological and depression-state conditions, and its involvement in depression-like behaviors; the experimental evidence from pharmacological, gene silencing, electrophysiological and behavior results unambiguously support this conclusion. It is interesting to note, although with an unclear neuronal circuit mechanism of action, the TRPC6 channel opener hyperforin was previously reported to have antidepressant effects in corticosterone-depressed mice, which were reversed by prior administration of the TRPC6 blocker larixyl acetate55. Also, in a CMUS rat model, TRPC6 expression was found to be downregulated in the hippocampus, and administration of the TRPC6 opener hyperforin was effective in alleviating depression-like behavior56. Our study provides strong and convincing evidence that TRPC6 is a key regulator of the VTA DA neurons which are known to be a key player in depression states 7, 21, 57–59.
The above-mentioned role for TRPC6 should come from its contribution to the subthreshold depolarization, through a persistent permeation to the influx of Na+. Although TRPC channels has been better recognized for their permeability to Ca2+ and their regulation on cellular Ca2+ homeostasis, the importance of TRPC channels for the permeability of monovalent cations, especially Na+, is now gradually being appreciated 60. In the substantial nigra GABA and DA neurons, TRPC3 has been reported to play an important role in maintaining depolarization membrane potential, pacemaking, and firing regularity31, 33. TRPC6 and TRPC3 belong to the same TRPC family subclass and TRPC6 is more than 75% homologous to TRPC344. Interestingly, our results with RNA-Seq and single-cell PCR demonstrated the rich expression of TRPC6 in the VTA DA neurons among all TRP channels but no expression of TRPC3 was found in these neurons. These results present an opportunity for selectively targeting a single TRPC channel to exert selective pharmacological results.
It has also been demonstrated in cell types other than neurons, such as rat portal vein smooth muscle cells, the activation of α-adrenergic receptor can open TRPC6, which leads to cell depolarization, activation of voltage-dependent Ca2+ channels, and ultimately the contraction of smooth muscle cell61; it is also shown that angiotensin II and endothelin I can activate TRPC3/C6 heterodimers via vascular G protein-coupled receptors (GPCR), thereby depolarizing cells 62, 63. Following this line, it would be very interesting to know if TRPC6 in the VTA DA neurons, where multiple GPCR reside receiving input and auto modulation by neuronal transmitters 64, 65, could also be a target of modulation with similar mechanism. In consideration of the important role we described here in this study, this type of modulation will present possible explanations for some unsolved mechanism for physiological and pathophysiological functions of the VTA DA neurons.
The facts that downregulation of TRPC6 proteins was correlated with reduced firing activity of the VTA DA neurons, the depression-like behaviors, and that knocking down of TRPC6 in the VTA DA neurons confer the mice with depression behaviors strongly suggest a crucial role for TRPC6 in the development of depression-like behaviors under stressful conditions like CMUS. To reinforce this, downregulation of TRPC6 was also found in another depression model of CRS, a model with similar neuronal alteration of reduced firing activity in the VTA DA neurons to that described in the CMUS model66. These facts with the fact that TRPC6 activator hyperforin is an effective antidepressant in multiple depression model55, 56, and that hyperforin is the principal component of St. John’s wort, a well-known antidepressant herb67, present TRPC6 as very attractive drug target for new lines of antidepressants.
Materials and methods
Animal Preparation
Male 6-8-week-old C57BL/6 (Vital River, China) and DAT-Cre mice with a C57BL/6 background (Stock No: 006660, the Jackson Laboratories, USA) were used for the studies. All experiments were conducted in accordance with the guidelines of Animal Care and Use Committee of Hebei Medical University and approved by the Animal Ethics Committee of Hebei Medical University.
Brain slice preparation
The details for the preparation of coronal brain slice containing VTA were the same as described in our previously published work21, 64. Briefly, mice were anesthetized with chloral hydrate (200 mg/kg, i.p.). After intracardial perfusion with ice-cold sucrose solution, the brains of the mice were removed quickly and placed into the slicing solution. The ice-cold sucrose-cutting solution contained (in mM): sucrose 260, NaHCO3 25, KCl 2.5, NaH2PO4 1.25, CaCl2 2, MgCl2 2, and D-glucose 10; osmolarity, 295-305 mOsm). Using the vibratome (VT1200S; Leica, Germany), the coronal midbrain slices (250 µm-thick) containing VTA were sectioned. The slices were incubated for 30 min at 36°C in oxygenated artificial cerebrospinal fluid (ACSF) (in mM: NaCl 130, MgCl2 2, KCl 3, NaH2PO4-2H2O 1.25, CaCl2 2, D-Glucose 10, NaHCO3 26; osmolarity, 280-300 mOsm), and were then left for recovery for 60 min at room temperature (23-25°C) until use.
The brain slices were transferred to the recording chamber and were continuously perfused with fully oxygenated ASCF during recording.
Identification of DA neurons and electrophysiological recordings
Recordings in the slices were performed in whole-cell current-clamp and voltage-clamp configurations on the Axoclamp 700B preamplifier (Molecular Devices, USA) coupled with a Digidata 1550B AD converter (Molecular Devices, USA). Neurons in the VTA were visualized with a 40X water-immersion objective equipped by an optiMOS microscope camera (Qimaging, Canada) on an Olympus-BX51 microscope (Olympus, Japan). Projection-specific or GFP-positive VTA neurons were identified by infrared-differential interference contrast (IR-DIC) video microscopy and epifluorescence (Olympus, Japan) for detection of retrobeads (red) positive or GFP-positive neurons.
For whole-cell recording, glass electrodes (3-5 MΩ) were filled with internal solution (in mM): K-methylsulfate 115, KCl 20, MgCl2 1, HEPES 10, EGTA 0.1, MgATP 2 and Na2GTP 0.3, pH adjusted to 7.4 with KOH. And the extracellular solution was the ACSF.
In whole-cell current-clamp mode, HCN function was judged by the inwardly rectifying characteristic sag potential generated by giving a hyperpolarizing current (-100 pA).
When recording the effect of removing extracellular Ca2+ on spontaneous cell discharge, CaCl2 in the ACSF was replaced with MgCl2, and the final MgCl2 concentration was 4 mM.
The resting membrane potential (RMP) was measured in current clamp mode (I = 0); the composition of the recording solution (mM) contained: NaCl 151, KCl 3.5, CaCl2 2, MgCl2 1, glucose 10, and HEPES 10, and the pH was adjusted to about 7.35 with NaOH. 1 μM tetrodotoxin was added to the extracellular solution to abolish action potential during measurement of the RMP.
To observe the effect of extracellular Na+ on the RMP, NaCl in the original recording solution was replaced with equimolar NMDG, and the NMDG-recording solution (mM) contained: NMDG 151, KCl 3.5, CaCl2 2, MgCl2 1, glucose 10, and HEPES 10, and the pH was adjusted to 7.35 with KOH.
For recording spontaneous firing of the neurons, cell-attached “loose-patch” (100-300 MΩ) recordings were used68. In this case, patch-pipettes (2-4 MΩ) were filled with ACSF, and the spontaneous activity was recorded in the current-clamp mode (I = 0). The synaptic blockers (CNQX, 10 μM; APV, 50 μM and gabazine, 10 μM) were added to isolate the intrinsic firing properties.
At the end of electrophysiological recordings, the recorded VTA neurons were collected for single-cell PCR. VTA DA neurons were identified by single-cell PCR for the presence of TH and DAT.
Retrograde labelling
Briefly, under general chloral hydrate anaesthesia (200 mg/kg, i.p.) and stereotactic control (RWD Instruments, Guangzhou, China), the skull surface was exposed. All coordinates are relative to bregma in mm using landmarks and neuroanatomical nomenclature that was described in the Franklin and Paxinos mouse brain atlas69 . Red retrobeads (100 nl for single injection; Lumafluor Inc., Naples, FL, USA) were injected into the following sites using KD scientific syringe pump (KD scientific, Holliston MA, USA): bilaterally into NAc core (NAc c), NAc lateral shell (NAc ls), NAc medial shell (NAc ms) and basolateral amygdala (BLA), 4 separate sites (2 per hemisphere) into medial prefrontal cortex (mPFC). Coordinates for infusions were as follows: NAc c (AP +1.50, LM 0.84, DV -4.0; 100 nl beads); NAc ls (AP +0.86, LM 1.72, DV -4.0; 100 nl beads); NAc ms (AP +1.70, LM 0.53, DV -4.0; 100 nl beads); mPFC (AP +2.05 and 2.15, LM 0.27, DV -2.1 + 1.7; 200 nl beads); BLA (AP -1.46, LM 2.85, DV -4.3; 100 nL beads). Retrobeads were delivered through a pulled glass pipette using a PAP107 Multipipette Puller (MicroData Instrument, Inc., USA) and at a rate of 100 nl/min; the injection needle was left in place for at least 5 minutes after each infusion. Following surgery, mice were returned to single housing. For sufficient labelling, survival periods for retrograde tracer transport depended on respective injection areas: NAc c, NAc ls, NAc ms, 14 days; mPFC, 21 days; BLA 14 days. Coronal sections of injection sites were stained with 4, 6-diamidino-2-phenylindole (DAPI, Sigma, USA) to confirm representative target location. Then, serial analyses of the injection-sites were carried out routinely.
AAV for gene knockdown or overexpression and viral construct and injection
For knockdown of NALCN and TRPC6, AAV9-U6-shRNA (NALCN)-CMV-GFP (300 nl) or AAV9-U6-shRNA (TRPC6)-CMV-GFP or its control AAV9-scramble-shRNA was delivered into the VTA (AP, −3.08 mm; ML, ±0.50 mm; DV, −4. 50 mm) of the mice. AAV9-hSyn-DIO-shRNA (TRPC6)-RFP (300 nl) or its control AAV9-scramble-shRNA was delivered into the VTA of the DAT-Cre C57BL/6 mice.
The shRNA hairpin sequences used in this study: NALCN shRNA: AAGATCGCACAGCCTCTTCAT26; TRPC6 shRNA: 5’-CCAGGATCAATGCATACAA-3’.
For Cre-dependent overexpression of TRPC6, AAV9-DIO-TRPC6-GFP (300 nl) or its control AAV9-scramble-RNA was delivered into the VTA of the DAT-Cre C57BL/6 mice.
Single cell PCR
mRNA was reversely transcribed to cDNA by PrimeScriptTMII1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings, the recorded neuron was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture. The mixture was heated to 65°C for 5 min to denature the nucleic acids and then cooled on ice for 2 min. Reverse transcription from mRNA into cDNA was performed at 50°C for 50 min and then 85°C for 5 sec. cDNA was stored at -40°C. Then two rounds of conventional PCR with pairs of gene-specific outside (first round) and inner primers (second round) for GAPDH (positive control), TH, DAT, D2, GIRK2, Vgult2, GAD1, NALCN, TRPC6, TRPV2 and TRPC3 using GoTaq Green Master Mix (Promega, Madison, USA) were performed. After adding the specific outside primer pairs into each PCR tube, first-round synthesis conditions were as follows: 95 °C (5 min); 30 cycles of 95 °C (50 s), 58-62 °C (50 s), 72 °C (50 s); 72 °C (5 min). Then, the product of the first PCR was added in the second amplification round by using specific inner primer (final volume 25 μl). The second amplification round consisted of the following: 95 °C (5 min); 35 cycles of 95 °C (50 s), 58 °C-62 °C (45 s), 72 °C (50 s) and 5 min elongation at 72 °C. The final PCR products were separated by electrophoresis on 2% agarose gels. The negative control reactions with no added template were also performed in each experiment.
The “outer” primers (from 5′ to 3′) as follows:
GAPDH:
AAATGGTGAAGGTCGGTGTGAACG (sense)
AGTGATGGCATGGACTGTGGTCAT (antisense)
TH:
GCCGTCTCAGAGCAGGATAC
GGGTAGCATAGAGGCCCTTC
DAT:
CTGCCCTGTCCTGAAAGGTGT
GCCCAGTGATCACAGACTCC
D2-R:
AGCATCGACAGGTACACAGC
CCATTCTCCGCCTGTTCACT
GIRK2:
TGGACCAGGATGTGGAAAGC
AAACCCGTTGAGGTTGGTGA
Vgult2:
CTGCTTCTGGTTGTTGGCTACTCT
ATCTCGGTCCTTATAGGTGTACGC
GAD1:
ACAACCTTTGGCTGCATGTGGATG
AATCCCACGGTGCCCTTTGCTTTC
NALCN:
TCCATCTGTGGGAAGCATGT
CAAAAGCTGGTCCTCTTCAGTG
TRPC6:
AGCCTGTCTATTGAGGAAGAAC
AGCGAGAATGATTGGGGTCA
TRPV2:
CTGCACATCGCCATAGAGAA
AGGCTGGTGGTAGGCAACTA
TRPC3:
GCTGGCCAACATAGAGAAGG
CCTGCACGTGACTATCCACA
The “inner” primers (from 5′ to 3′) as follows:
GAPDH:
GCAAATTCAACGGCACAGTCAAGG
TCTCGTGGTTCACACCCATCACAA
TH:
AGGAGAGGGATGGAAATGCT
ACCAGGGAACCTTGTCCTCT
DAT:
ATTTTGAGCGTGGTGTGCTG
TGCCTCACAGAGACGGTAGA
D2-R:
CCATTGTCTGGGTCCTGTCC
GTGGGTACAGTTGCCCTTGA
GIRK2:
AGCCGAGACAGGACCAAAAG
ATGTACGCAATCAGCCACCA
Vgult2:
CATCTCCTTCTTGGTGCTTGCAGT
ACAGCGTGCCAACGCCATTTGAAA
GAD1:
AGTCACCTGGAACCCTC
GCTTGTCTGGCTGGAA
NALCN:
GCCTTTGCTGGAGTTGTTCTG
CCCTGCATAATTGCCACAGTC
TRPC6:
TGCTAGAAGAGTGTCATTCCCT
CCTCCACAATCCGTACATAACC
TRPV2:
GTGGGATGTGGTGACCTACC
GCTGGTACAGCCCTGAGAAC
TRPC3:
CCTTGGGTCTTCCATTCCTC
CACAACTGCACGATGTACTCC
RT-qPCR
Total RNA was prepared using Trizol. RNA was reversely transcribed into cDNA by TAKARA PrimeScripttm RT reagent Kit with gDNA Eraser for Reverse transcription. Subsequently, the SYBR Green Master Mix (TaKaRa) was used to do the qRT-PCR assays.
The specific primers were:
GAPDH:
GCAAATTCAACGGCACAGTCAAGG
TCTCGTGGTTCACACCCATCACAA
TRPC6:
GCAGAAACACAGAGGAAGTGG
GCTCTTTCCAGCTTGGCATATC
NALCN:
TAATGAGATAGGCACGAGTA
TGATGAAGTAGAAGTAGGAG
Single cell RT-qPCR
Following the retrograde labelling and VTA brain slice preparation, projection-specific VTA neurons were identified by infrared-differential interference contrast (IR-DIC) video microscopy and epifluorescence (Olympus, Japan) for detection of retrobeads (red) positive neurons. mRNA was reversely transcribed to cDNA by PrimeScriptTMII1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). The projection-specific neurons was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture. The mixture was heated to 65°C for 5 min to denature the nucleic acids and then cooled on ice for 2 min. Reverse transcription from mRNA into cDNA was performed at 50°C for 50 min and then 85°C for 5 sec. cDNA was stored at -40°C. The targeted pre-amplification was done, with pairs of targeted primers for GAPDH, TH and TRPC6, to quantify multiple targets per cell. After adding the targeted primer pairs into each PCR tube, the synthesis conditions were as follows: 95 °C (5 min); 10 cycles of 95 °C (50 s), 58-62 °C (50 s), 72 °C (50 s); 72 °C (5 min). After targeted pre-amplification, Quantitative PCR (qPCR) is the final laboratory step of the scRT-qPCR workflow with the SYBR Green Master Mix (TaKaRa).
The targeted primers for pre-amplification (from 5′ to 3′) as follows:
GAPDH:
AAATGGTGAAGGTCGGTGTGAACG (sense)
AGTGATGGCATGGACTGTGGTCAT (antisense)
TH:
AAGGTTCATTGGACGGCGG
ACATCGTCAGACACCCGAC
TRPC6:
AGCCTGTCTATTGAGGAAGAAC
AGCGAGAATGATTGGGGTCA
The primers for qPCR (from 5′ to 3′) as follows:
GAPDH:
GCAAATTCAACGGCACAGTCAAGG
TCTCGTGGTTCACACCCATCACAA
TH:
TCTCCTTGAGGGGTACAAAACC
ACCTCGAAGCGCACAAAGT
TRPC6:
TGCTAGAAGAGTGTCATTCCCT
CCTCCACAATCCGTACATAACC
Immunofluorescence
After intracardial perfusion with 4% paraformaldehyde (PFA) in 0.01 M PBS (pH 7.4). The brains were post-fixed in 4% paraformaldehyde. 48 h later, the brain tissue was placed in 30% sucrose solution (PBS preparation) to dehydrate. The brain tissue was sectioned coronally, including the nucleus accumben (NAc), medial prefrontal cortex (mPFC), basolateral amygdala (BLA), and VTA, using a vibrating microtome. The section thickness was 40 μm. The sections were placed in PBS solution and stored in a refrigerator at 4°C for storage.
The brain section was incubated in 0.3% triton/3% BSA for 1 h at room temperature and then was blocked with 10% donkey serum at 37℃ for 1 h. After that, the brain section was incubated in the corresponding antibodies in PBS at 4℃ for 24 h. The section was washed three times (10 min) with PBS. Finally, the brain section was incubated in the secondary antibodies for 2 h at 37℃. Images were obtained on a Leica TCS SP5 confocal laser microscope (Leica, Germany) equipped with laser lines for 405 mm, 488 mm, 561 mm and 647 mm illumination. Images were analyzed with LAS-AF-Lite software (Leica, Germany).
Single-cell whole-transcriptome gene sequencing
After retrobeads injection, following brain slice preparation and 1 h recording, the recorded and retrobeads-labeled neurons were aspirated into the patch pipette and were then broken into the PCR tube containing 1 μl lysis buffer. For mRNA in individual cells, mRNA was amplified and cDNA by SMARTer Ultra Low Input RNA for Illumina Kit, which was qualified and reversely transcribed to cDNA by Qubit and Agilent Bioanalyzer 2100 electrophoresis. After fragmentation of cDNA (300 bp) by ultrasound, sequencing libraries (end repair, addition of poly(A), and ligation of sequencing connectors) were built using the Ovation Ultralow Library System V2. After that, the constructed libraries were sequenced using Illumina HiseqXten (Sinotech Genomics Co., Ltd.).
Depression models
Chronic Mild Unpredictable Stress (CMUS) procedure
The CMUS procedures consisted of food and water deprivation (24 h), day/night inversion, damp bedding (12 h), cage tilt (12 h), no bedding (12 h), rat bedding (12 h), 4°C cold bath (5 min), restraint (2 h) and tail pinching (30 min). mice were subjected to consecutive 35 days of CMUS with two stressors per day. Non-stressed controls were handled only for cage changes and behavioral tests.
Chronic Restraint Stress (CRS) procedure
The mice were immobilized in a special restraint device for 6 h per day from 9:00 to 15:00 for 21 days.
Behavior tests
Sucrose preference test
Mice were single-housed and trained to drink from two drinking bottles with 1 bottle of tap water and 1 bottle of 1% sucrose water, for 48 hours, and the positions of the drinking bottles were exchanged every 12 h to exclude the interference of position preference. After the training, the mice were deprived of food and water for 12 h, and then the sucrose preference test was performed for 24 h. One bottle of tap water and one bottle of 1.0 % sucrose water were given again, and the positions of the drinking bottles were exchanged at 12 h. Finally, the consumption of tap water and sugar water at 24 h were recorded to calculate the sucrose solution preference rate. Sucrose preference rate = sucrose solution consumption/(tap water consumption + sucrose solution consumption).
Tail suspension test, TST
Mouse was suspended by taping the tail (1 cm from the tip of the tail) to the fixation device for 6 min. The cumulative immobility time within last 4 min was recorded, and the time when all limbs were immobile except for respiration was considered as immobility time.
Forced swimming test, FST
Forced swimming test (FST) was performed in a glass cylinders, filled with the water depth about 10 cm at room temperature. The experiment was conducted for 5 min, of which the first 1 min was the adaptation time and the mice were allowed to move freely, and the immobility time was recorded for last 4 min after the adaptation.
Open field test, OFT
The mice were placed in a topless chamber (40 cm × 40 cm × 30 cm) with a camera mounted on top of the chamber and connected to ANY-maze video tracking system on the computer to automatically track and record the activity of mice during the experiment and to obtain behavioral data. The bottom of the chamber was divided into 16 small square grids (10 cm × 10 cm) on the computer, and four square grids in the central area were defined as the central zone. During the 10 min test session, Total distance traveled and time spent in the center were recorded.
Elevated plus maze, EPM
The EPM apparatus consists of two closed arms (25 x 5 cm) across from each other and perpendicular to two open arms (25 x 5 cm) that are connected by a center platform (5 x 5 cm), with a camera in the center ceiling to automatically track and record the activity of mice. Mice were placed in the center platform facing a closed arm and allowed to freely explore the maze for 7 min, of which the first 2 min was the adaptation time. The time spent in open arms was analyzed for last 5 min after the adaptation.
Western Blot
The VTA protein was isolated by100 µl RIPA and 1 µl PMSF. The total protein for each sample was transferred onto the polyvinylidene difluoride (PVDF) membranes after SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and blocked 2 h at room temperature with 5% bovine serum albumin (KeyGen Biotechnology). Subsequently, all these membranes were incubated overnight at 4 °C with the primary antibodies as below: TRPC6, NALCN, and GAPDH. Following 2 h secondary antibodies incubation, all the bands were detected. The relative expression was calculated based on the internal control GAPDH.
Drugs and reagents
Drugs were bath applied at the following concentrations: 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX; 10 μM; Sigma), DL-2-amino-5-phosphonopentanoic acid (APV; 50 μM; Sigma) and gabazine (10 μM; Sigma), CsCl (3mM; sigma), ZD7288(60 μm; Abcam), TTX (1 μM; MCE), GdCl3 (100 μM; Sigma), 2-Aminoethyldiphenylborinate (2-APB, 100 μM; Sigma), Flufenamic acid (100 μM; alomone), Ruthenium Red (60 μM; TCI).
Commercial antibodies used were: Anti-Tyrosine Hydroxylase Antibody (1:400, Millipore, MAB318, RRID:AB_2201528, for Immunofluorescence), Anti-Dopamine Transporter (N-terminal) antibody (1:400, sigma, D6944, RRID:AB_1840807, for Immunofluorescence), Anti-NALCN (1:100, Thermo Fisher Scientific, MA5-27593, RRID:AB_2735285, for Immunofluorescence), Anti-TRPC6 (1:100, Alomone, ACC-017, RRID:AB_2040243, for Immunofluorescence), Anti-GAPDH (1:10000, Santa Cruz, sc-137179, RRID:AB_2232048, for Western Blot), Anti-NALCN (1:100, GeneTex, GTX54808, for Western Blot), Anti-TRPC6 (1:100, Cell Signaling Technology, 16716, RRID:AB_2798768, for Western Blot).
Secondary antibodies: Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (Alexa Fluor 488, Thermo Fisher Scientific, A-21202, 1:1000), Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (Alexa Fluor 546, Thermo Fisher Scientific, A10037, 1:1000), Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (Alexa Fluor 488, Thermo Fisher Scientific, A21206, 1:1000), Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (Alexa Fluor 546, Thermo Fisher Scientific, A10040, 1:1000), Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (Alexa Fluor 647, Thermo Fisher Scientific, A31573, 1:1000)
Quantification and statistical analysis
Software such as GraphPad Prism6, OriginPro 8.0 (Origin Lab) and Adobe Illustrator CS6 were used for data analysis and image processing. All experimental data were expressed as mean ± standard error (mean ± S.E.M.). When the data were normally distributed, the difference between two groups was statistically analyzed by two-sample T-test or paired-sample T-test; when the data were not normally distributed, the difference between two groups was statistically analyzed by Mann-Whitney U test or Wilcoxon matched-pairs signed rank test. P < 0.05 was considered as a statistically significant difference between two groups. For the data between multiple groups, when the data were normally distributed and there was no significant variance inhomogeneity, one-way ANOVA with Dunnett’s multiple comparisons test was used; when the data were not normally distributed, Kruslal-Wallis-H test with Dunnett’s multiple comparisons test and Student-Newman-Keuls test with Dunnett’s multiple comparisons test were used.
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Author Contributions
Hailin Zhang conceived, designed and supervised the experiments; Jing Wang performed the experiments, acquired and analyzed the data and prepared the figures; Dongmei Zhang and Min Su performed immunofluorescence of the brain slices and performed some preliminary electrophysiological experiments; Yuqi Sang and Chaoyi Li performed part of single-cell PCR; Yongxue Zhang performed part of statistical analysis; Ludi Zhang and Chenxu Niu took care of mice; Hailin Zhang and Jing Wang wrote the manuscript; Hailin Zhang and Xiaona Du prepared the final version of the manuscript.
Funding
This work was supported by the National Natural Science Foundation of China (81871075, 82071533) grants to HZ; National Natural Science Foundation of China (81870872) grants to XD; Science Fund for Creative Research Groups of Natural Science Foundation of Hebei Province (no. H2020206474); Basic Research Fund for Provincial Universities (JCYJ2021010); Science-Technology Research Foundation of the Higher Education Institutions of Hebei (Z2017073) and Scientific research project of Hebei administration of traditional Chinese Medicine (2017021) grants to WJ.
Acknowledgements
We would like to thank Dr. Lili for the technical assistance.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1.Dopamine in motivational control: rewarding, aversive, and alertingNeuron 68:815–834Google Scholar
- 2.Reward and aversion in a heterogeneous midbrain dopamine systemNeuropharmacology 76 Pt B:351–359Google Scholar
- 3.Getting connected in the dopamine systemProg Neurobiol 85:75–93Google Scholar
- 4.Rapid regulation of depression-related behaviours by control of midbrain dopamine neuronsNature 493:532–536Google Scholar
- 5.Function and developmental origin of a mesocortical inhibitory circuitNat Neurosci 18:872–882Google Scholar
- 6.Aversive stimuli differentially modulate real-time dopamine transmission dynamics within the nucleus accumbens core and shellJ Neurosci 32:15779–15790Google Scholar
- 7.Enhancing depression mechanisms in midbrain dopamine neurons achieves homeostatic resilienceScience 344:313–319Google Scholar
- 8.Molecular adaptations underlying susceptibility and resistance to social defeat in brain reward regionsCell 131:391–404Google Scholar
- 9.Regulation of firing of dopaminergic neurons and control of goal-directed behaviorsTrends Neurosci 30:220–227Google Scholar
- 10.Two types of neurone in the rat ventral tegmental area and their synaptic inputsJ Physiol 450:455–468Google Scholar
- 11.HCN2 channels in the ventral tegmental area regulate behavioral responses to chronic stressElife 7Google Scholar
- 12.The action potential in mammalian central neuronsNat Rev Neurosci 8:451–465Google Scholar
- 13.Robust pacemaking in substantia nigra dopaminergic neuronsJ Neurosci 29:11011–11019Google Scholar
- 14.Roles of subthreshold calcium current and sodium current in spontaneous firing of mouse midbrain dopamine neuronsJ Neurosci 27:645–656Google Scholar
- 15.Pacemaking in dopaminergic ventral tegmental area neurons: depolarizing drive from background and voltage-dependent sodium conductancesJ Neurosci 30:7401–7413Google Scholar
- 16.Vesicular dopamine release elicits an inhibitory postsynaptic current in midbrain dopamine neuronsNeuron 42:939–946Google Scholar
- 17.Kappa opioid inhibition of somatodendritic dopamine inhibitory postsynaptic currentsJ Neurophysiol 97:883–891Google Scholar
- 18.Differential Somatic Ca2+ Channel Profile in Midbrain Dopaminergic NeuronsJ Neurosci 36:7234–7245Google Scholar
- 19.Somatodendritic ion channel expression in substantia nigra pars compacta dopaminergic neurons across postnatal developmentJ Neurosci Res 92:981–999Google Scholar
- 20.Differential Regulation of Action Potential Shape and Burst-Frequency Firing by BK and Kv2 Channels in Substantia Nigra Dopaminergic NeuronsJ Neurosci 35:16404–16417Google Scholar
- 21.Selective targeting of M-type potassium K(v) 7.4 channels demonstrates their key role in the regulation of dopaminergic neuronal excitability and depression-like behaviourBr J Pharmacol 174:4277–4294Google Scholar
- 22.Enhanced Sensitivity to Hyperpolarizing Inhibition in Mesoaccumbal Relative to Nigrostriatal Dopamine Neuron SubpopulationsJ Neurosci 37:3311–3330Google Scholar
- 23.Evidence for a modulatory role of Ih on the firing of a subgroup of midbrain dopamine neuronsNeuroreport 12:255–258Google Scholar
- 24.I(h) channels contribute to the different functional properties of identified dopaminergic subpopulations in the midbrainJ Neurosci 22:1290–1302Google Scholar
- 25.On the properties of identified dopaminergic neurons in the mouse substantia nigra and ventral tegmental areaEur J Neurosci 45:92–105Google Scholar
- 26.Nalcn Is a “Leak” Sodium Channel That Regulates Excitability of Brainstem Chemosensory Neurons and BreathingJ Neurosci 36:8174–8187Google Scholar
- 27.Peptide neurotransmitters activate a cation channel complex of NALCN and UNC-80Nature 457:741–744Google Scholar
- 28.G(i/o) protein-coupled receptors in dopamine neurons inhibit the sodium leak channel NALCNElife 7Google Scholar
- 29.The leak channel NALCN controls tonic firing and glycolytic sensitivity of substantia nigra pars reticulata neuronsElife 5Google Scholar
- 30.NALCN channels enhance the intrinsic excitability of spinal projection neuronsPain 159:1719–1730Google Scholar
- 31.TRPC3 and NALCN channels drive pacemaking in substantia nigra dopaminergic neuronsElife 10Google Scholar
- 32.Nonselective cation channels are essential for maintaining intracellular Ca2+ levels and spontaneous firing activity in the midbrain dopamine neuronsPflugers Arch 455:309–321Google Scholar
- 33.Constitutively active TRPC3 channels regulate basal ganglia output neuronsJ Neurosci 28:473–482Google Scholar
- 34.Transient receptor potential channels in cardiac health and diseaseNat Rev Cardiol 16:344–360Google Scholar
- 35.Midbrain dopaminergic neurons (nuclei A8, A9, and A10): three-dimensional reconstruction in the ratJ Comp Neurol 331:297–309Google Scholar
- 36.Stereological estimates of dopaminergic, GABAergic and glutamatergic neurons in the ventral tegmental area, substantia nigra and retrorubral field in the ratNeuroscience 152:1024–1031Google Scholar
- 37.Electrophysiological, transcriptomic and morphologic profiling of single neurons using Patch-seqNat Biotechnol 34:199–203Google Scholar
- 38.Unique properties of mesoprefrontal neurons within a dual mesocorticolimbic dopamine systemNeuron 57:760–773Google Scholar
- 39.Particular subpopulations of midbrain and hypothalamic dopamine neurons express vesicular glutamate transporter 2 in the rat brainJ Comp Neurol 498:581–592Google Scholar
- 40.A unique population of ventral tegmental area neurons inhibits the lateral habenula to promote rewardNeuron 80:1039–1053Google Scholar
- 41.The neuronal channel NALCN contributes resting sodium permeability and is required for normal respiratory rhythmCell 129:371–383Google Scholar
- 42.Interdependence of receptor activation and ligand binding in HCN2 pacemaker channelsNeuron 67:75–85Google Scholar
- 43.The murine HCN3 gene encodes a hyperpolarization-activated cation channel with slow kinetics and unique response to cyclic nucleotidesJ Biol Chem 280:27056–27061Google Scholar
- 44.The TRP ion channel familyNat Rev Neurosci 2:387–396Google Scholar
- 45.The chronic mild stress (CMS) model of depression: History, evaluation and usageNeurobiol Stress 6:78–93Google Scholar
- 46.Brain-derived neurotrophic factor-mediated projection-specific regulation of depressive-like and nociceptive behaviors in the mesolimbic reward circuitryPain 159:175Google Scholar
- 47.Involvement of Infralimbic Prefrontal Cortex but not Lateral Habenula in Dopamine Attenuation After Chronic Mild StressNeuropsychopharmacology 42:904–913Google Scholar
- 48.A whole cell patch-clamp study on the pacemaker potential in dopaminergic neurons of rat substantia nigra compactaNeurosci Res 18:209–221Google Scholar
- 49.HCN channels: function and clinical implicationsNeurology 80:304–310Google Scholar
- 50.Properties of the hyperpolarization-activated cation current Ih in rat midbrain dopaminergic neuronsEur J Neurosci 7:462–469Google Scholar
- 51.Hyperpolarization-activated cation current (Ih) is an ethanol target in midbrain dopamine neurons of miceJ Neurophysiol 95:619–626Google Scholar
- 52.’Rejuvenation’ protects neurons in mouse models of Parkinson’s diseaseNature 447:1081–1086Google Scholar
- 53.Cloning of a novel four repeat protein related to voltage-gated sodium and calcium channelsFEBS Lett 445:231–236Google Scholar
- 54.NALCN: a regulator of pacemaker activityMol Neurobiol 45:415–423Google Scholar
- 55.Hyperforin Potentiates Antidepressant-Like Activity of Lanicemine in MiceFront Mol Neurosci 11:456Google Scholar
- 56.The change of spatial cognition ability in depression rat model and the possible association with down-regulated protein expression of TRPC6Behav Brain Res 294:186–193Google Scholar
- 57.Dopamine neurons modulate neural encoding and expression of depression-related behaviourNature 493:537–541Google Scholar
- 58.Amygdala-ventral pallidum pathway decreases dopamine activity after chronic mild stress in ratsBiol Psychiatry 76:223–230Google Scholar
- 59.Mesolimbic dopamine neurons in the brain reward circuit mediate susceptibility to social defeat and antidepressant actionJ Neurosci 30:16453–16458Google Scholar
- 60.Na(+) entry and modulation of Na(+)/Ca(2+) exchange as a key mechanism of TRPC signalingPflugers Arch 451:99–104Google Scholar
- 61.Molecular candidates for capacitative and non-capacitative Ca2+ entry in smooth muscleNovartis Found Symp 246:81–90Google Scholar
- 62.Phosphorylation of TRPC6 channels at Thr69 is required for anti-hypertrophic effects of phosphodiesterase 5 inhibitionJ Biol Chem 285:13244–13253Google Scholar
- 63.Cilostazol suppresses angiotensin II-induced vasoconstriction via protein kinase A-mediated phosphorylation of the transient receptor potential canonical 6 channelArterioscler Thromb Vasc Biol 31:2278–2286Google Scholar
- 64.Kv7.4 Channel Contribute to Projection-Specific Auto-Inhibition of Dopamine Neurons in the Ventral Tegmental AreaFront Cell Neurosci 13:557Google Scholar
- 65.GIRK Channel Activity in Dopamine Neurons of the Ventral Tegmental Area Bidirectionally Regulates Behavioral Sensitivity to CocaineJ Neurosci 39:3600–3610Google Scholar
- 66.A POMC-originated circuit regulates stress-induced hypophagia, depression, and anhedoniaMol Psychiatry 25:1006–1021Google Scholar
- 67.Mechanism of action of St John’s wort in depression : what is known?CNS Drugs 17:539–562Google Scholar
- 68.Direct and indirect excitation of laterodorsal tegmental neurons by Hypocretin/Orexin peptides: implications for wakefulness and narcolepsyJ Neurosci 22:2862–2872Google Scholar
- 69.The mouse brain in stereotaxic coordinatesIn: Psychoneuroendocrinology New York: Academic Press Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.88319. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2023, Wang et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,858
- downloads
- 164
- citations
- 7
Views, downloads and citations are aggregated across all versions of this paper published by eLife.