Abstract
Wnt signaling plays crucial roles in embryonic patterning including the regulation of convergent extension during gastrulation, the establishment of the dorsal axis, and later, craniofacial morphogenesis. Further, Wnt signaling is a crucial regulator of craniofacial morphogenesis. The adapter proteins Dact1 and Dact2 modulate the Wnt signaling pathway through binding to Disheveled. However, the distinct relative functions of Dact1 and Dact2 during embryogenesis remain unclear. We found that dact1 and dact2 genes have dynamic spatiotemporal expression domains that are reciprocal to one another suggesting distinct functions during zebrafish embryogenesis. Both dact1 and dact2 contribute to axis extension, with compound mutants exhibiting a similar convergent extension defect and craniofacial phenotype to the wnt11f2 mutant. Utilizing single-cell RNAseq and an established noncanonical Wnt pathway mutant with a shortened axis (gpc4), we identified dact1/2 specific roles during early development. Comparative whole transcriptome analysis between wildtype and gpc4 and wildtype and dact1/2 compound mutants revealed a novel role for dact1/2 in regulating the mRNA expression of the classical calpain capn8. Over-expression of capn8 phenocopies dact1/2 craniofacial dysmorphology. These results identify a previously unappreciated role of capn8 and calcium-dependent proteolysis during embryogenesis. Taken together, our findings highlight the distinct and overlapping roles of dact1 and dact2 in embryonic craniofacial development, providing new insights into the multifaceted regulation of Wnt signaling.
Introduction
Wnt signaling is a crucial regulator of embryogenesis through its regulation of body axis patterning, cell fate determination, cell migration, and cell proliferation (Logan and Nusse 2004, Steinhart and Angers 2018, Mehta, Hingole et al. 2021). Current mechanistic understanding of Wnt signaling during embryogenesis includes an extensive catalog of ligands, receptors, co-receptors, adaptors, and effector molecules (Clevers and Nusse 2012, Niehrs 2012, Loh, van Amerongen et al. 2016, Mehta, Hingole et al. 2021). The intricate spatiotemporal integration of Wnt signaling combinations is an important focus of developmental biology and tissue morphogenesis (Petersen and Reddien 2009, Clevers and Nusse 2012, Loh, van Amerongen et al. 2016, Wiese, Nusse et al. 2018). Disruptions of Wnt signaling-associated genes lead to several congenital malformations which often affect multiple organ systems given their pleotropic developmental functions (Hashimoto, Morita et al. 2014, Shi 2022). Craniofacial anomalies are among the most common structural congenital malformations and genes in the Wnt signaling pathway are frequently implicated (Ji, Hao et al. 2019, Reynolds, Kumari et al. 2019, Huybrechts, Mortier et al. 2020).
Genetic approaches in zebrafish have identified a number of key Wnt regulators of early development, with gastrulation and craniofacial phenotypes (Brand, Heisenberg et al. 1996, Hammerschmidt, Pelegri et al. 1996, Heisenberg, Brand et al. 1996, Piotrowski, Schilling et al. 1996, Solnica-Krezel, Stemple et al. 1996, Schilling and Le Pabic 2009). The silberblick (slb) mutant, later identified as a wnt11f2 mutant allele, exhibits gastrulation and midline craniofacial phenotypes that encompassed aspects of multiple mutant classes. During early segmentation in the somite stage, the wnt11f2 mutant developed a shortened anterior-posterior axis and partially fused eyes (Heisenberg, Brand et al. 1996). Subsequently, as the cranial prominences converge and the ethmoid plate (EP) formed, instead of a fan-shaped structure observed in wildtype embryos, the wnt11f2 mutant formed a rod-like EP with a significant deficiency of the medio-lateral dimension (Heisenberg, Brand et al. 1996, Heisenberg and Nusslein-Volhard 1997). Another mutant knypek (kny), identified as having a nonsense mutation in gpc4, an extracellular Wnt co-receptor, was identified as a gastrulation mutant that also exhibited a shortened body axis due to a defect in embryonic convergent extension (CE) (Solnica-Krezel, Stemple et al. 1996). In contrast to the slb/wnt11f2 mutant, the gpc4 mutant formed an EP that is wider in the medio-lateral dimension than the wildtype, in the opposite end of the EP phenotypic spectrum compared to wnt11f2 (Topczewski, Sepich et al. 2001, Rochard, Monica et al. 2016). These observations beg the question of how defects in early patterning and CE of the embryo may be associated with later craniofacial morphogenesis. The observation that wnt11f2 and gpc4 mutant share similar CE dysfunction and axis extension phenotypes but contrasting craniofacial morphologies (Heisenberg and Nusslein-Volhard 1997) supports a hypothesis that CE mechanisms regulated by these Wnt pathway genes are specific to the temporal and spatial contexts during embryogenesis.
Dact (aka Frodo, Dapper) are scaffolding proteins that regulate Dishevelled (Dvl)-mediated Wnt signaling, both positively and negatively (Cheyette, Waxman et al. 2002, Gloy, Hikasa et al. 2002, Waxman, Hocking et al. 2004, Gao, Wen et al. 2008, Wen, Chiang et al. 2010, Ma, Liu et al. 2015, Lee, Cheong et al. 2018). Dact proteins bind directly to Dvl (Gloy, Hikasa et al. 2002, Brott and Sokol 2005, Lee, Cheong et al. 2018) and interact with and inhibit members of TGF-β and Nodal signaling pathways (Zhang, Zhou et al. 2004, Su, Zhang et al. 2007, Meng, Cheng et al. 2008, Kivimae, Yang et al. 2011). In chick and Xenopus, Dact2 and Dact1 (respectively) are expressed in the neural folds during neural crest delamination and are important in epithelial-mesenchymal transition (EMT), Wnt signaling, and TGF-β signaling (Hikasa and Sokol 2004, Schubert, Sobreira et al. 2014, Rabadan, Herrera et al. 2016). In mouse embryos, Dact1 is expressed predominantly in mesodermal tissues, as well as ectodermal-derived tissues, (Hunter, Hikasa et al. 2006) and ablation of Dact1 results in defective EMT and primitive streak morphogenesis, with subsequent posterior defects (Wen, Chiang et al. 2010). Mouse embryonic Dact2 expression has been described in the oral epithelium and ablation of Dact2 causes increased cell proliferation (Li, Florez et al. 2013) and re-epithelialization in mice (Meng, Cheng et al. 2008) and zebrafish (Kim, Kim et al. 2020).
Previous experiments using morpholinos to disrupt dact1 and dact2 in zebrafish found dact1 morphants to be slightly smaller and to develop a normal body. In contrast, dact2 morphants were found to phenocopy described zebrafish gastrulation mutants, with impaired CE, shortened body axis, and medially displaced eyes. Importantly, prior work using morpholino-mediated gene disruption of dact1 and dact2 did not examine craniofacial morphogenesis except to analyze dact1 and dact2 morphants head and eye shapes under light microscopy (Waxman, Hocking et al. 2004). These experiments were carried out at a time when morpholino was the accessible tool of gene disruption (Nasevicius and Ekker 2000, Corey and Abrams 2001, Heasman 2002). Since CRISPR/Cas9 targeted gene mutagenesis became popularized, many reports of germline mutant phenotypes being discrepant from prior morpholino studies warranted revisiting many of the prior work (Kok, Shin et al. 2015) and careful interpretation given the caveats of each technology (Morcos, Vincent et al. 2015, Rossi, Kontarakis et al. 2015). More recently, a zebrafish CRISPR/Cas9 genetic dact2 mutant has been generated and studied, but unlike in the dact2 morphant, no developmental phenotypes were described (Kim, Kim et al. 2020).
Here we investigated the genetic requirement of dact1 and dact2 during embryogenesis and craniofacial development using germline mutant alleles. We found an early developmental role for dact1 and dact2 during gastrulation and body axis elongation. We also characterized the abnormal craniofacial development of the dact1/2 compound mutants. We identified distinct transcriptomic profiles of wildtype, dact1/2, and gpc4 mutants during early development, including finding calpain 8 (capn8) calcium-dependent protease to be ectopically expressed in the dact1/2 mutants. These results elaborate on the cellular roles of dact1/2 and identify capn8 as a novel regulatory candidate of embryogenesis.
Results
dact1 and dact2 have distinct expression patterns throughout embryogenesis
To determine the spatiotemporal gene expression of dact1 and dact2 during embryogenesis we performed wholemount RNA in situ hybridization (ISH) across key time points (Fig. 1). Given that the described craniofacial phenotypes of the dact2 morphant and the wnt11f2 mutant are similar (Heisenberg and Nusslein-Volhard 1997, Waxman, Hocking et al. 2004), we also performed wnt11f2 ISH to compare to dact1 and dact2 expression patterns.

Unique and shared dact1 and dact2 gene expression domains during zebrafish development.
(A-C) Representative images of wholemount in situ hybridization showing dact1, dact2, and wnt11f2 gene expression patterns. A) At 8 hpf, dact2 and wnt11f2 are highly expressed in the dorsal margin and presumptive Nieuwkoop center of the gastrulating embryo, with dact1 being weakly detected (arrowhead). In contrast to wnt11f2, dact1 and dact2 are expressed in the presumptive dorsal mesoderm (asterisk). B) Lateral (anterior to the left of page) and anterior (dorsal side toward top of page) views of bud-stage embryos. dact2 and wnt11f2 transcripts are both detected in the tailbud (asterisk) while dact2 is additionally expressed in the axial mesoderm (arrow). dact1 gene expression is concentrated to the paraxial mesoderm and the neuroectoderm (open arrowheads). C) Lateral and flat-mount views of 4 ss embryos. dact2 is expressed in the anterior neural plate and polster (P), notochord (N), paraxial and presomitic mesoderm (PM) and tailbud (TB). In contrast, dact1 is expressed in the midbrain (MB) and the paraxial and presomitic mesoderm. (D-E) Representative lateral (anterior to left of page) images of wholemount in situ hybridization showing dact1 and dact2 expression patterns. D) At 24 hpf expression is detected in the developing head. E) At 48 hpf expression is detected in the developing craniofacial structures (arrow). F) Representative images of RNAscope in situ hybridization analysis of dact1 (white) and dact2 (yellow) and irf6 (green) expression in transverse section of 72 hpf embryos. dact1 is expressed in the ethmoid plate (ep) and palatoquadrate (pq) orofacial cartilage, while dact2 is expressed in the oral epithelium (oe). The epithelial marker irf6 is expressed in the oe and surface epithelium (se). Dapi (blue). Scale bar: 100 μm.
During gastrulation at 8 hours post-fertilization (hpf; 75% epiboly), some regions of dact1 and dact2 gene expression were shared and some areas are distinct to each dact gene (Fig. 1A). Further, dact gene expression was distinct from wnt11f2 in that wnt11f2 expression was not detected in the presumptive dorsal mesoderm. Transcripts of dact1, dact2, and wnt11f2 were all detected in the blastoderm margin, as previously described (Makita, Mizuno et al. 1998, Heisenberg, Tada et al. 2000, Gillhouse, Wagner Nyholm et al. 2004). Transcripts of dact2, and to a lesser extent dact1, were also detected in the prechordal plate and chordamesoderm (Fig. 1A). Additionally, dact2 gene expression was concentrated in the shield and presumptive organizer or Nieuwkoop center along with wnt11f2. This finding is consistent with previously described expression patterns in zebrafish and supports a role for dact1 and dact2 in mesoderm induction and dact2 in embryo dorsalization (Thisse 2001, Gillhouse, Wagner Nyholm et al. 2004, Muyskens and Kimmel 2007, Oteiza, Koppen et al. 2010). At the end of gastrulation and during somitogenesis the differences in the domains of dact1 and dact2 gene expressions became more distinct (Fig. 1B,C). At tailbud stage, dact1 transcripts were detected in the neuroectoderm and the posterior paraxial mesoderm, whereas dact2 transcripts were detected in the anterior neural plate, notochord, and tailbud. Anterior notochord and tailbud expression overlapped with wnt11f2 gene expression (Makita, Mizuno et al. 1998, Heisenberg, Tada et al. 2000).
The expression of dact2 was unique in that its expression demarcated the anterior border of the neural plate. As dact2 morphants exhibited a craniofacial defect with medially displaced eyes and midfacial hypoplasia (Waxman, Hocking et al. 2004), we examined dact1 and dact2 expression in the orofacial tissues. At 24 hpf we found some overlap but predominantly distinct expression patterns of dact1 and dact2 with dact1 being more highly expressed in the pharyngeal arches and dact2 being expressed in the midbrain/hindbrain boundary. Both dact1 and dact2 appeared to be expressed in the developing oral cavity. At 48 hpf dact1 expression is consistent with expression in the developing craniofacial cartilage elements, while dact2 expression appears within the developing mouth. The distinct cellular expression profiles of dact1 and dact2 were more clear in histological sections through the craniofacial region at 72 hpf. Utilizing RNAscope in situ hybridization, we found that dact2 and the epithelial gene irf6 were co-expressed in the surface and oral epithelium that surround the cartilaginous structures (Fig. 1F). This is in contrast to dact1 which was expressed in the developing cartilage of the anterior neurocranium (ANC)/EP and palatoquadrate of the zebrafish larvae (Fig. 1F).
We examined the overall expression patterns of dact1, dact2, gpc4, and wnt11f2 using Daniocell single-cell sequencing data (Farrell, Wang et al. 2018). In general, we found dact1 spatiotemporal gene expression to be more similar to gpc4 while dact2 gene expression was more similar to wnt11f2 (Fig. S1). These results of shared but also distinct domains of spatiotemporal gene expression of dact1 and dact2 suggest that the dact paralogs may have some overlapping developmental functions while other roles are paralog-specific.
dact1 and dact2 contribute to axis extension and dact1/2 compound mutants exhibit a convergent extension defect
dact1 and dact2 are known to interact with disheveled and regulate non-canonical Wnt signaling (Gloy, Hikasa et al. 2002, Waxman, Hocking et al. 2004, Gao, Wen et al. 2008, Wen, Chiang et al. 2010, Ma, Liu et al. 2015, Lee, Cheong et al. 2018) and we have previously described the craniofacial anomalies of several zebrafish Wnt mutants (Dougherty, Kamel et al. 2012, Kamel, Hoyos et al. 2013, Rochard, Monica et al. 2016, Ling, Rochard et al. 2017, Alhazmi, Carroll et al. 2021). Previous work investigated the effect of dact1 and dact2 disruption during zebrafish embryogenesis using morpholinos and reported morphant phenotypes in embryonic axis extension and eye fusion (Waxman, Hocking et al. 2004). However, the limitations associated with morpholino-induced gene disruption (Kok, Shin et al. 2015, Morcos, Vincent et al. 2015, Rossi, Kontarakis et al. 2015) and the fact that craniofacial morphogenesis was not detailed for the dact1 and dact2 morphants, warranted the generation of mutant germline alleles (Fig. S2). We created a dact1 mutant allele (22 bp deletion, hereafter dact1−/−) and a dact2 mutant allele (7 bp deletion, hereafter dact2−/−), both resulting in a premature stop codon and presumed protein truncation (Fig. S2A,B). Gene expression of dact1 and dact2 was measured in pooled dact1−/−, dact2−/−, and dact1/2−/− embryos (Fig. S2C). We found a decrease in dact1 mRNA and an increase in dact2 mRNA levels in the respective CRISPR single mutants. We hypothesize that dact2 mRNA levels are maintained or elevated in the dact2−/− mutant due to the relative 3’ position of the deletion. In the dact2−/− embryos we found a slight increase in dact1 mRNA levels, suggesting a possible compensatory effect of dact2 disruption. The specificity of the gene disruption was demonstrated by phenotypic rescue of the rod-like EP with the injection of dact1 or dact2 mRNA. Injection of dact1 mRNA or dact2 mRNA or in combination decreased the percentage of rod-like EP phenotype from near the expected 25% (35% actual) to 2-7% (Fig. S2D,E).
Analysis of compound dact1 and dact2 heterozygote and homozygote alleles during late gastrulation and early segmentation time points identified embryonic axis extension anomalies (Fig. 2A,B). dact1−/− or dact2−/− homozygotes develop to be phenotypically normal and viable. However, at 12 hpf, dact2−/− single mutants have a significantly shorter body axis relative to wildtype. In contrast, body length shortening phenotype was not observed in dact1−/− homozygotes. Compound heterozygotes of dact1+/−; dact2+/− also developed normally but exhibited shorter body axis relative to wildtype. The most significant axis shortening occurred in dact1−/−; dact2−/− double homozygotes with a less severe truncation phenotype in the compound heterozygote dact1+/−; dact2−/− (Fig. 2A,B). Interestingly, these changes in body axis extension do not preclude the compound heterozygous larvae from reaching adulthood, except in the dact1−/−; dact2−/− double homozygotes which did not survive from larval to juvenile stages.

Impaired convergent extension in dact1/2 compound mutants.
A) Inter-cross of compound heterozygotes yield embryos with different degrees of axis extension that correspond to the dact1 and dact2 genotypes. Representative lateral images of embryos at 12 hpf. The yellow line indicates body axis angle measured from the anterior point of the head, the center of the yolk, to the end of the tail. B) Quantification of body axis angle. Numbers represent the difference in angle relative to the average wildtype embryo. Asterisk indicates genotypes with angles significantly different from wildtype. ANOVA p<0.5 n= 3-21 embryos. C) Representative bud stage wildtype and dact1/2−/− mutant embryos stained for gsc (prechordal plate), pax2a (midbrain/hindbrain boundary) and krox20 (rhombomere 3). Asterisk indicates lack of krox20 expression in dact1/2−/− mutant. Scale bar = 200 μm D) Representative flat mounts of 1-2 ss wildtype and dact1/2 mutant embryos stained for zic1 (telencephalon), pax2a and tbx6 (ventrolateral mesoderm). E) Representative flat mounts of 10 ss wildtype and dact1/2−/− mutant embryos stained for ctsl1b (hatching gland), zic1, pax2a, krox20, and myo1d (somites).
Body axis truncation has been attributed to impaired CE during gastrulation (Tada and Heisenberg 2012). To delineate CE hallmarks in the dact1−/−; dact2−/− mutants, we performed wholemount RNA ISH detecting genes that are expressed in key domains along the body axis. At bud stage, dact1−/−; dact2−/− embryos demonstrate bifurcated expression of pax2a and decreased anterior extension of gsc expression, suggesting impaired midline convergence and anterior extension of the mesoderm (Fig. 2C). At the 1-2 somite stage, zic1, pax2a and tbx6 are expressed in neural plate, prospective midbrain and the tailbud, respectively, in both the wildtype and dact1−/−; dact2−/− embryos. However, the spacing of these genes clearly revealed the shortening of the anteroposterior body axis in the dact1−/−; dact2−/− embryos. Midline convergence is decreased and the anterior border of the neural plate (marked by zic1 expression) was narrower in the dact1−/−; dact2−/− embryos (Fig. 2D). At the 10-somite stage (ss), dact1−/−; dact2−/− embryos demonstrated decreased spacing between ctslb1 and pax2a gene expression, suggesting impaired lengthening of the anterior portion of the embryo. Detection of muscle marker myo1d in the dact1−/−; dact2−/− embryos delineated impaired posterior lengthening as well as reduced somitogenesis, evidenced by the decreased number of somites (Fig. 2E). These data point to impaired CE of the mesoderm in dact1/2−/− double mutants, which resulted in a shorter body axis. The aberrant CE and axis extension in the dact1/2−/− phenotypes were similar to findings in other Wnt mutants, such as slb and kyn (Heisenberg, Tada et al. 2000, Topczewski, Sepich et al. 2001) in that the body axis is truncated upon segmentation.
dact1/dact2 compound mutants exhibit axis shortening and craniofacial dysmorphology
Given the defective converge phenotype and shortened axis in the dact mutants during gastrulation, we examined the fish at 4 dpf for axis defects and for evidence of defective morphogenesis in the craniofacial cartilages. Craniofacial morphology is an excellent model for studying CE morphogenesis as many craniofacial cartilage elements develop through this cellular mechanism (Kamel, Hoyos et al. 2013, Mork and Crump 2015, Sisson, Dale et al. 2015, Rochard, Monica et al. 2016). No craniofacial phenotype was observed in dact1 or dact2 single mutants (data not shown). However, in-crossing to generate dact1/2−/− compound homozygotes resulted in dramatic craniofacial malformation (Fig. 3). Specificity of this phenotype to dact1/2 was confirmed via rescue with dact1 or dact2 mRNA injection (Fig. S2D,E). The dact1/2−/− mutant embryos exhibited fully penetrant midfacial hypoplasia (Fig. 3A) however the degree of eye field convergence in the midline varied between individuals. The forebrain protruded dorsally and the mouth opening and ventral cartilage structures were displaced ventrally (Fig. 3A). Alcian blue staining of cartilage elements revealed severe narrowing of the EP into a rod-like structure in 100 percent of double mutants, while the ventral cartilage elements were largely unaffected (Fig. 3B). Notably the trabeculae extending posteriorly from the EP and the rest of the posterior neurocranium exhibit wildtype morphology in dact1/2. This dact1/2−/− double mutant phenotype is highly similar to that described for wnt11f2 (slb) mutants, a key regulator of non-canonical Wnt signaling and CE (Kimmel, Miller et al. 2001).

Midface development requires dact1 and dact2.
A) Representative brightfield images of wildtype and dact1/2−/− compound mutants at 4 dpf. 100 individuals were analyzed from a dact1/2+/− double het cross. Lateral and ventral views show dact1/2−/− compound mutants have a hypoplastic midface, medially displaced eyes, and a displaced lower jaw. B) Representative flat-mount images of Alcian blue stained ethmoid plate (EP) and visceral cartilage (VC) elements from 4 dpf wildtype and dact1/2−/− compound mutants. dact1/2−/− mutants have a rod-shaped EP with no distinct lateral and medial elements. No obvious differences were found in dact1/2 mutant VC. C) Representative brightfield image of 4 dpf wildtype and dact1/2−/− mutant. Bar indicates vertebral spine length. Scale bar: 100 μm. D) Representative images of Alcian blue stained dact1/2−/−, wnt11f2−/−, and wnt11f2−/−,dact1/2−/− compound mutants. Embryos resulted from a dact1+/−,dact2+/−,wnt11f2+/− in-cross. Lateral and ventral views show similar craniofacial phenotypes in each mutant. E) Representative flat-mount images of Alcian blue stained EP show a similar phenotype between dact1/2−/−, wnt11f2−/−, and wnt11f2−/−,dact1/2−/− compound mutants. Scale bar: 200 μm.
As axis lengthening was found to be affected by loss of dact1 and dact2 (Fig. 2A) we measured body length in 5 dpf dact1/2 compound mutants. Using the length of the vertebral spine as a measure of body length we found a trend (p=0.06) towards an effect of dact1 and dact2 on shortening of the body length. Similar to axis length during gastrulation/segmentation, the shortening was most pronounced in dact1/2−/− double homozygous mutants versus wildtype clutch-mates (Fig. 3C, Fig. S3A,B).
As wnt11f2 signals via disheveled and since dact proteins are known to interact with disheveled (Wong, Bourdelas et al. 2003, Zhang, Gao et al. 2006, Kivimae, Yang et al. 2011), it is suspected that dact has a role in wnt11f2 signaling. Combinatorial gene disruption with morpholinos showed that dact2 morpholino exasperated the wnt11 morpholino midfacial/eye fusion defect (Waxman, Hocking et al. 2004). We hypothesized that the shared phenotypes between wnt11f2 and dact1/2 mutants point to these genes acting in the same signaling pathway. To test for genetic epistasis between wnt11f2, dact1, and dact2 genes we generated wnt11f2/dact1/2−/− triple homozygous mutants. If wnt11f2 and dact1/2 had independent developmental requirements, the wnt11f2/dact1/2−/− mutant may exhibit a phenotype distinct from wnt11f2−/− or dact1/2−/− mutants. We found that the wnt11f2/dact1/2−/− triple homozygous mutant phenotype of the linear rod-like EP was the same as the wnt11f2−/− mutant or dact1/2−/− double mutant, without exhibiting additional or neo-phenotypes in the craniofacial cartilages or body axis (Fig. 3D,E). This result supports dact1 and dact2 acting downstream of wnt11f2 signaling during ANC morphogenesis, where loss of dact1/2 function recapitulates a loss of wnt11f2 signaling.
Lineage tracing of dact1/2 mutant NCC movements reveals their ANC composition
The EP forms from the convergence of a central frontal prominence-derived structure with bilateral maxillary prominence-derived elements (Wada, Javidan et al. 2005, Swartz, Sheehan-Rooney et al. 2011, Dougherty, Kamel et al. 2012, Mork and Crump 2015, Rochard, Monica et al. 2016).The stereotypic convergent migration of cranial neural crest cells and their derivatives presents an excellent model to examine CE movements and their effects on tissue morphogenesis. The zebrafish EP is formed from the joining of a midline frontal prominence derived from the anteromost cranial neural crest cell (NCC) population that migrate over the eyes and turn caudally, to join paired lateral maxillary prominences derived from the second stream of cranial NCC population that migrate rostrally (Kimmel, Miller et al. 2001, Wada, Javidan et al. 2005, Schilling and Le Pabic 2009, Dougherty, Kamel et al. 2012, Mork and Crump 2015). The EP that forms is a planar fan-shaped structure where we and others have shown that the morphology is governed by Wnt signaling (Kimmel, Miller et al. 2001, Rochard, Monica et al. 2016).
Given the rod-like EP we observed in the dact1/2−/− double mutants, we hypothesized that the dysmorphology could be due to aberrant migration of the anteromost midline stream of cranial NCCs resulting in fusion of the lateral maxillary components. Conversely, an abrogated contribution from the second paired stream of maxillary NCCs could lead to an EP composed entirely of the medial component. To distinguish between these possibilities, we carried out lineage tracing of the cranial NCC populations in wildtype and dact1/2 mutants. The dact1/2 compound mutants were bred onto a sox10:kaede transgenic background, where we and others have shown that the sox10 reporter is a reliable driver of cranial neural crest labeling (Wada, Javidan et al. 2005, Dutton, Antonellis et al. 2008, Swartz, Sheehan-Rooney et al. 2011, Dougherty, Kamel et al. 2012, Kague, Gallagher et al. 2012, Mork and Crump 2015). Cranial NCC populations in wildtype and dact1/2 mutants were targeted at 19 hpf to photoconvert Kaede reporter protein in either the anterior cranial NCCs that contribute to the frontal prominence, or the second stream of NCCs that contribute to the maxillary prominence, where the labeled cells were followed longitudinally over 4.5 days of development (Fig. 4). We found that the anterior NCCs of wildtype embryos migrated antero-dorsally to the eye and populated the medial EP. To our surprise, the anterior cranial NCC also migrated to contribute to the median element of the rod-like EP, suggesting the complex anterior then caudal migration of the anterior NCC is not disrupted by dact1/2 mutation (Fig. 4A, arrows). This finding is in contrast to lineage tracing in another midline mutant with a similarly shaped rod-like EP, the syu (sonic hedgehog null) mutant, where the anterior NCCs failed to populate the ANC (Wada, Javidan et al. 2005).

Anterior neural crest cells of the dact1/2−/− mutant migrate to the midline and populate the dysmorphic ethmoid plate. Lineage tracing of wildtype and dact1/2−/− double mutant zebrafish embryos using Tg(sox10:kaede) line. sox10:kaede fluorescence is shown in green and photo-converted kaede is shown in magenta and highlighted with an arrow. Asterisks indicate that the cell population is absent.
A,B)19 hpf embryo sagittal views showing photoconversion of anterior-most neural crest population. At 36 hpf frontal images show the migration of photoconverted neural crest cells to the frontal prominence in wildtype and dact1/2−/− double mutants. At 55 hpf, frontal images show photoconverted neural crest cells populating the region of the developing ANC in wildtype and dact1/2−/− mutants. At 4.5 dpf ventral images show photoconverted neural crest cells populating the medial ethmoid plate in wildtype. Similarly, neural crest cells in dact1/2−/− mutants populate the rod-shaped ethmoid plate. Scale bar:100 μm. Representative images of 3 individual experiments.
Next, the second stream of NCC population that contribute to the maxillary prominence was labeled, where they migrate and contribute to the lateral element of the EP as expected in the wildtype (Fig. 4B). When the second stream of cranial NCCs were labeled and followed in the dact1/2 mutants, the cells were found to migrate normally up to 36 hpf, but did not ultimately populate the EP in the mutant (arrows). These results suggest that NCC migration itself is not regulated by dact1/2 but that loss of dact1/2 hinders the second stream of NCCs’ ability to populate the ANC by an alternative means. Further, we have found that a rod-like EP can be formed from 2 different NCC origins, where in the dact1/2 mutants the EP is contributed by the anteromost frontonasal NCCs, in contrast to the similar rod-shaped EP of the syu mutants that is formed from the more posterior stream of maxillary NCCs (Wada, Javidan et al. 2005).
Genetic interaction of dact1/2 with gpc4 and wls to determine facial morphology
Given the role of Dact/dapper as modifiers of Wnt signaling, we hypothesized that genetic interaction of dact1/2 with wls and gpc4 will modify facial morphology. Gpc4 is a glycoprotein that binds Wnt ligands and modulates Wnt signaling. gpc4 zebrafish mutants have impaired CE which leads to a shortened body axis (Topczewski, Sepich et al. 2001). Wls is a posttranslational modifier of Wnt ligands which promotes their secretion (Banziger, Soldini et al. 2006, Bartscherer, Pelte et al. 2006). We previously described that these components of the Wnt/PCP pathway (gpc4 receptor, wls intracellular ligand chaperon, and Wnt ligands wnt9a and wnt5b) are required for craniofacial morphogenesis, where each gene affects particular morphologic aspects of chondrocytes arrangement in the cardinal axis of the ANC and Meckel’s cartilage (Rochard, Monica et al. 2016, Ling, Rochard et al. 2017). Using the EP as a morphologic readout, we examined the genetic interaction of dact1 and dact2 with wls and gpc4. Compound mutants of dact1, dact2, gpc4 or wls were generated by breeding the single alleles. Compared to wildtype ANC morphology, abrogation of gpc4 led to increased width in the transverse axis, but shorter in the antero-posterior axis (Rochard, Monica et al. 2016). Disruption of wls leads to ANC morphology that is also wider in the transverse dimension, but to a lesser degree than observed in gpc4. Additionally, in the wls mutant, chondrocytes stack in greater layers in the sagittal axis (Rochard, Monica et al. 2016).
Disruption of gpc4 or wls in addition to dact1/2 generated EP morphology that contained phenotypic attributes from each single mutant, so that the resultant ANC morphology represented a novel ANC form. The EP of a triple homozygous gpc4/dact1/2−/− mutant was triangular, wider in the transverse axis and shorter in the antero-posterior axis compared to the rod-like ANC observed in the dact1/2−/− double mutant (Fig. 5A,B). Similarly, the ANC of a triple homozygous wls/dact1/2−/− mutant was in the shape of a rod, shorter in the antero-posterior axis and thicker in the sagittal axis compared to the dact1/2−/− double mutant, reflecting attributes of the wls mutant (Fig. 5C,D). In addition to the EP phenotypes, the triple homozygous gpc4/dact1/2−/− mutant also had a short body axis and truncated tail similar but more severe than the gpc4 mutant (Fig. 5A). Since compound disruption of dact1, dact2, and gpc4 or wls resulted in a new phenotype we conclude that these genes function in different components of Wnt signaling during craniofacial development.

A nonoverlapping functional role for dact1, dact2, and gpc4 and wls.
A) Representative Alcian blue stained wholemount images of wildtype, dact1/2−/− double mutant, gpc4−/− mutant, and gpc4/dact1/2−/− triple mutants at 4 dpf. Low magnification lateral images of embryos showing tail truncation in dact1/2−/− mutants, shortened and kinked tail in gpc4−/− mutants, and a combinatorial effect in gpc4/dact1/2−/− triple mutants. Higher magnification lateral images show a shortened midface and displaced lower jaw in dact1/2−/− mutants, a shortened midface in gpc4−/− mutant, and a combinatorial effect in gpc4/dact1/2−/− triple mutants. B) Representative flat-mount images of dissected Alcian blue-stained cartilage elements. dact1/2−/− mutants have a narrow rod-shaped ethmoid plate (EP) while gpc4−/− mutants have a broad and shortened EP. dact1/2/gpc4 triple mutants have a combinatorial effect with a short, broad rod-shaped EP. In ventral cartilages (VC), dact1/2−/− mutants have a relatively normal morphology while Meckel’s cartilage in gpc4−/− mutants and gpc4/dact1/2−/− triple mutants is truncated. C,D) Same as above except wls−/− mutant and wls/dact1/2−/− triple mutant, with similar findings. E) Combinatorial genotypes of dact1, dact2, and gpc4. dact2−/− contributed the dact/gpc4 compound phenotype while dact1−/− did not. Scale bar: 200 μm.
As we analyzed the subsequent genotypes of our dact1/dact2/gpc4 triple heterozygote in-cross we gleaned more functional information about dact1 and dact2. We found that dact1 heterozygosity in the context of dact2−/−; gpc4−/− was sufficient to replicate the triple dact1/dact2/gpc4 homozygous phenotype (Fig. 5E). In contrast, dact2 heterozygosity in the context of dact1−/−; gpc4−/− double mutant produced ANC in the opposite phenotypic spectrum of ANC morphology, appearing similar to the gpc4−/− mutant phenotype (Fig. 5E). These results show that dact1 and dact2 do not have redundant function during craniofacial morphogenesis, and that dact2 function is more indispensable than dact1. These results also suggest that dact1 and gpc4 may have overlapping roles in craniofacial development.
dact1/2 and gpc4 regulate axis extension via overlapping and distinct cellular pathways
Our analyses of axis extension and the hallmarks of a CE defect (namely decreased length and increased width between early tissues) demonstrate that dact1 and/or dact2 are required for CE and anterior-posterior axis lengthening during gastrulation (Fig. 3). An axis lengthening and CE defect has also been described in gpc4 (aka kny) mutants (Topczewski, Sepich et al. 2001). We also observe a defect in axis lengthening in gpc4−/− in our hands (representative image Fig. 6A) that is grossly similar to the dact1/2−/− mutants. Interestingly, the midfacial hypoplasia of the wnt11f2 (slb) mutant has been attributed to a defect in axis extension and anterior neural plate patterning (Heisenberg and Nusslein-Volhard 1997), whereas defective axis extension does not lead to midfacial hypoplasia in the gpc4−/− mutant. Therefore, we hypothesized that by comparing and contrasting the gene expression changes in dact1/2 versus gpc4 mutants during axis extension we could identify cell programs specifically responsible for the anterior axis defect and subsequent midfacial hypoplasia. We performed single-cell transcriptional analysis to compare dact1/2 mutants, gpc4 mutants, and wildtype embryos during the segmentation stage. Single-cell encapsulation and barcoded cDNA libraries were prepared from individual dissociated 4 ss wildtype, dact1/2−/− compound mutant and gpc4−/− mutant embryos using the 10X Genomics Chromium platform and Illumina next-generation sequencing. Genotyping of the embryos was not possible but quality control analysis by considering the top 2000 most variable genes across the dataset showed good clustering by genotype, indicating the reproducibility of individuals in each group. Twenty clusters were identified using Louvain clustering and identity was assigned by reviewing cluster-specific markers in light of published expression data (Farrell, Wang et al. 2018, Farnsworth, Saunders et al. 2020, Bradford, Van Slyke et al. 2022) (Fig. 6B,C). Qualitatively, we did not observe any significant difference in cluster abundance between genotype groups (Fig. S4). We found that dact1, dact2, and gpc4 were detected at various levels across clusters, though dact1 expression was lower than dact2 (Fig. 6D), consistent with what we observed in RNA wholemount ISH analysis (Fig. 1).

Single-cell RNAseq of 4 ss wildtype, dact1/2−/− mutant and gpc4−/− mutants.
A) Summary schematic showing similar phenotypes in dact1/2−/− and gpc4−/− mutants at 12 hpf and divergent phenotypes at 4 dpf. Single-cell RNAseq was performed during axis extension to compare and contrast dact1/2−/− and gpc4−/− transcriptional programs. UMAP showing cluster identification. B) UMAP of cell clusters identified by Single-cell RNAseq. C) Dot plot showing the most differentially expressed genes between clusters. C) UMAP showing dact1, dact2, and gpc4 expression in wildtype embryos.
To assess the relative differences in gene expression between genotype groups, we merged clusters into broader cell lineages: ectoderm, axial mesoderm, and paraxial mesoderm (Fig. 7A). We focused on these cell types because they contribute significantly to CE processes and axis establishment. For each of these cell lineages, we performed independent pseudo-bulk differential expression analyses (DEA) of wildtype vs. dact1/2−/− mutant and wildtype vs. gpc4−/− mutant (Fig. 7A). In all 3 cases, we found differentially expressed genes (DEGs) that were commonly in dact1−/−;dact2−/− and gpc4−/− mutant relative to wildtype (Fig. 7B). To address the hypothesis that dact1 and dact2 regulate molecular pathways distinct from those regulated by gpc4 we also identified genes that were differentially expressed only in dact1/2−/− mutants or only in gpc4−/− mutants (Fig. 7B). Functional analysis of these DEGs found unique enrichment of intermediate filament genes in gpc4−/− whereas dact1/2−/− mutants had enrichment for pathways associated with proteolysis (Fig. 7C, S5). Enrichment for pathways associated with calcium-binding were found in both gpc4−/− and dact1/2−/−, although the specific DEGs were distinct (Fig. S5). We performed functional analyses specifically for genes that were differentially expressed in dact1/2−/− mutants, but not in gpc4−/− mutants, and found enrichment in pathways associated with proteolysis (Fig. 7C) suggesting a novel role for Dact in embryogenesis.

Pseudobulk differential expression analysis of single-cell RNAseq data.
A) Heatmaps showing the 50 most differentially expressed genes in 3 major cell types; ectoderm (clusters 4,5,6,7), paraxial mesoderm (clusters 10,11,12), and lateral plate mesoderm (clusters 15, 16, 17,18) between dact1/2−/− mutants and wildtype and gpc4−/− mutants and wildtype. B) Venn diagrams showing unique and overlapping DEGs in dact1/2−/− and gpc4−/− mutants. C) GO analysis of dact1/2−/− mutant-specific DEGs in ectoderm showing enrichment for proteolytic processes.
Interrogation of dact1/2−/− mutant-specific DEGs found that the calcium-dependent cysteine protease calpain 8 (capn8) was significantly overexpressed in dact1/2−/− mutants in paraxial mesoderm (103 fold), axial mesoderm (33 fold), and in ectoderm (3 fold; Fig. 7A). We also found that loss of dact1/2 causes significant changes to capn8 expression pattern (Fig. 8A). Whereas capn8 gene expression is principally restricted to the epidermis of wildtype embryos, loss of dact1/2 leads to significant expansion of ectopic capn8 gene expression in broader cell types such as in mesodermal tissues (Fig. 8A). We corroborated this finding with wholemount RNA ISH for capn8 expression in wildtype versus dact1/2−/− 12 hpf embryos (Fig. 8B). The expression of smad1 was found to be decreased uniquely in the ectoderm of dact1/2−/− embryos relative to wildtype (Fig. 7A), however this finding was not investigated further,

Expression of capn8 is significantly dysregulated in dact1/2−/− mutants.
A) Single-cell RNAseq gene expression analysis of capn8 in wildtype and dact1/2−/− mutants. In wildtype embryos, capn8 expression is restricted predominantly to the epidermis whereas capn8 is widely expressed throughout the embryo in dact1/2−/− mutants, especially in the mesoderm. B) Wholemount in situ hybridization of capn8 expression in wildtype and dact1/2−/− mutant embryos at 2 ss. Staining corroborates the single-cell RNAseq data, with expanded ectopic expression of capn8 throughout the embryo. Flat mounts are oriented anterior to the left. Scale bar: 100 μm. C) Brightfield images and Alcian blue staining of the ethmoid plate show ectopic expression of capn8 mRNA (200 pg) at the 1-cell stage in dact1+/−,dact2+/− embryos recapitulates the dact1/2−/− compound mutant craniofacial phenotype. The mutant craniofacial phenotype did not manifest in gfp mRNA (200 pg) injected 1-cell stage dact1+/−,dact2+/− embryos. Scale bar: 100 μm D) Quantification of mutant and normal craniofacial phenotype in 4 dpf larvae after mRNA injection at the 1-cell stage. Larvae were derived from dact1/2+/− interbreeding. Larvae were uninjected or injected with 200 pg gfp control or capn8 mRNA. A Fisher exact test showed a significant effect of capn8 mRNA injecting in the dact1/2 double heterozygotes. p= 0.013.
Capn8 is considered a “classical” calpain, with domain homology similar to Capn1 and Capn2 (Macqueen and Wilcox 2014). In adult human and mouse tissue, Capn8 expression is largely restricted to the gastrointestinal tract (Sorimachi, Ishiura et al. 1993, Macqueen and Wilcox 2014), however embryonic expression in mammals has not been characterized. Proteolytic targets of Capn8 have not been identified, however, other classical calpains have been implicated in Wnt and cell-cell/ECM signaling (Konze, van Diepen et al. 2014), including in Wnt/Ca+2 regulation of CE in Xenopus (Zanardelli, Christodoulou et al. 2013). To determine whether the dact1/2−/− mutant craniofacial phenotype could be attributed to capn8 overexpression, we performed injection of capn8 or gfp control mRNA into 1 cell-stage zebrafish embryos. In wildtype zebrafish, exogenous capn8 mRNA caused the distinct dact1/2−/− craniofacial phenotype including a rod-like ANC at a very low frequency (1 in 142 injected embryos).
This craniofacial phenotype was not observed in wildtype larvae, or when wildtype embryos were injected with an equal concentration of gfp mRNA (0 in 192 injected embryos) (data not shown). When mRNA was injected into 1 cell-stage embryos generated from dact1/2+/− interbreeding, capn8 caused a significant increase in the number of larvae with the mutant craniofacial phenotype when on a dact1/2+/− genetic background (Fig. 8D, 0.0% vs. 7.5%). We did not find an effect of exogenous capn8 on any other genotype, including dact1−/−,dact2+/− which we suspect to be due to the smaller number of those individuals in our experimental population. These findings suggest a new contribution of capn8 to embryonic development as well as anterior neural plate patterning and craniofacial development. Further, the regulation of capn8 by dact may be required for normal embryogenesis and craniofacial morphogenesis.
Discussion
In this study, we examined the genetic requirement of dact1 and dact2 during early embryogenesis and craniofacial morphogenesis in zebrafish. Wnt signaling is central to the orchestration of embryogenesis and numerous proteins have been identified as modulators of Wnt signaling, including Dact1 and Dact2 (Cheyette, Waxman et al. 2002). Several studies across Xenopus, zebrafish, and mouse have ascribed roles to dact1 and dact2, including both promoting and antagonizing Wnt signaling, depending on the developmental context (Cheyette, Waxman et al. 2002, Gloy, Hikasa et al. 2002, Waxman, Hocking et al. 2004, Gao, Wen et al. 2008, Wen, Chiang et al. 2010, Ma, Liu et al. 2015, Lee, Cheong et al. 2018). Here, we show that dact1 and dact2 are required for axis extension during gastrulation and show an example of CE defects during gastrulation associated with craniofacial defects. During axis extension, we show that genetic disruption of dact2, but not dact1, resulted in a significantly shortened axis relative to wildtype. This result is similar to what was previously found using morpholinos to disrupt dact1 and dact2. Interestingly, genetically disrupted mutants of dact1 or dact2 developed to be phenotypically normal whereas dact1/2 compound mutants displayed a severe dysmorphic craniofacial phenotype. Again, this is largely similar to the previous morpholino study that found disruption of each gene to cause only a slight and occasional dysmorphic cranial phenotype at 24 hpf (Waxman, Hocking et al. 2004). Notably, embryos injected with a mixture of dact1 and dact2 morpholino were not characterized after 10 ss, and the singly injected embryos were not characterized after 24 hpf (Waxman, Hocking et al. 2004). Therefore, by analyzing genetic mutants of dact1 and dact2 our findings have largely validated the previous morpholino literature as well as added new data on later developmental outcomes.
The gene expression and genetic epistasis experiments carried out here support that the dact paralogs are not redundant and have unique functions during different stages of embryonic and larval development. We observed that dact1 and dact2 have distinct spatiotemporal expression patterns throughout embryogenesis, suggesting unique roles for each paralog in developmental processes. Differential expression of Dact1 and Dact2 was also described during odontogenesis in mice (Kettunen, Kivimae et al. 2010). This aligns with previous findings of differential roles of dact1 and dact2 in canonical vs. non-canonical Wnt signaling (Waxman, Hocking et al. 2004) and a specific role for dact2, but not dact1, in TGF-β signaling (Su, Zhang et al. 2007, Schubert, Sobreira et al. 2014). However, the lack of a resultant phenotype upon genetic ablation of dact1 or dact2 individually suggests the capability of functional compensation. This is puzzling given their distinct expression patterns and needs to be examined further.
We found that dact1 and dact2 contribute to axis extension, and their compound mutants exhibit a shortened and widened body axis that is consistent with a CE defect during gastrulation. This finding aligns with previous studies that have implicated dact1 and dact2 in non-canonical Wnt signaling and regulation of embryonic axis extension (Waxman, Hocking et al. 2004). Based on our gene expression and combinatorial genetic analyses, we offer the hypothesis that dact1 expression in the paraxial mesoderm is required for dorsal CE during gastrulation through its role in noncanonical Wnt/PCP signaling, similar to the defect observed upon gpc4 disruption. Conversely, we posit that dact2 functions in the prechordal mesoderm to promote anterior migration during gastrulation, a function which has also been ascribed to wnt11f2 (Heisenberg and Nusslein-Volhard 1997). It is only upon loss of both dact1 and dact2 functions that the axis is significantly truncated and a craniofacial malformation results. Further experiments with spatially restricted gene ablation or cell transplantation are required to test this hypothesis.
Our results underscore the crucial roles of dact1 and dact2 in embryonic development and suggest a connection between gastrulation movements and subsequent craniofacial morphogenesis. Our finding that in dact1−/−;dact2−/− compound mutants the first stream of cranial NCC migrate and contribute to the ANC, while the second stream fails to contribute suggests the possibility of an anatomical barrier to migration, rather than an autonomous defect of the cranial NCCs. Disruption of the sonic hedgehog signaling pathway in zebrafish results in a similar phenotype to dact1/2−/− and wnt11f2−/− mutants where the eyes converge medially and the EP narrows to a rod shape. Interestingly, lineage tracing analysis in hedgehog-disrupted embryos found the rod-like EP to consist solely of second stream-derived cranial NCCs (Wada, Javidan et al. 2005). This is in contrast to the dact1/2−/− mutants, demonstrating two different cellular mechanisms that result in a similar anatomical dysmorphology. It will be important to test the generality of this phenomenon and determine if other mutants with craniofacial abnormalities have early patterning differences. Further, a temporally conditional genetic knockout is needed to definitively test the connection between early and later development.
By comparing the transcriptome across different Wnt genetic contexts, i.e. gpc4−/− with that of the dact1/2−/− compound mutant, we identified a novel role for dact1/2 in the regulation of proteolysis, with significant misexpression of capn8 in the mesoderm of dact1/2−/− mutants. Although at a very low frequency, ectopic expression of capn8 mRNA recapitulated the dact1/2−/− mutant craniofacial phenotype, suggesting that inhibition of capn8 expression in the mesoderm by dact is required for normal morphogenesis. Genes involved in calcium ion binding were also differentially expressed in the dact1/2−/− mutants and we predict that altering intracellular calcium handling in conjunction with capn8 overexpression would increase the frequency of the recapitulated dact1/2−/− mutant phenotype.
Capn8 is described as a stomach-specific calpain and a role during embryogenesis has not been previously described. Calpains are typically calcium-activated proteases and it is feasible that Capn8 is active in response to Wnt/Ca2+ signaling. A close family member, Capn2 has been found to modulate Wnt signaling by degradation of beta-catenin (Zanardelli, Christodoulou et al. 2013, Konze, van Diepen et al. 2014). Our findings suggest that dact-dependent suppression of capn8 expression is necessary for normal embryogenesis and craniofacial morphogenesis, further expanding the functional repertoire of dact1/2. Continued research is required to test a direct regulatory role of dacts on capn8 expression. While our data suggests an interaction between dact signaling and capn8 function, we did not find capn8 overexpression to be wholly sufficient to cause the rod-like EP phenotype, Further, we did not test the necessity of capn8 for craniofacial development in this study. This study does however identify capn8 as a novel embryonic gene warranting further investigation into its role during embryogenesis, with possible implications for known craniofacial or other disorders. Recently, Capn8 has been implicated in EMT associated with cancer metastasis (Zhong, Xu et al. 2022, Song, Cui et al. 2024) and Xenopus capn8 was found to be required for cranial NCC migration (Cousin, Abbruzzese et al. 2011) which further supports a role of capn8 in cranial NCC migration and craniofacial morphogenesis.
Another gene identified in our scRNA-seq data to be differentially expressed in the dact1/22−/− but not the gpc4−/− embryos was smad1. Smad1 acts in the TGF-β signaling pathway and dact2 has been described to inhibit TGF-β and Nodal signaling by promoting the degradation of Nodal receptors (Zhang, Zhou et al. 2004, Su, Zhang et al. 2007, Meng, Cheng et al. 2008, Kivimae, Yang et al. 2011). Zebrafish Nodal pathway mutants (cyc/ndr2, oep/tdgf1, sqt/ndr1) exhibit medially displaced eyes (Hatta, Kimmel et al. 1991, Brand, Heisenberg et al. 1996, Heisenberg and Nusslein-Volhard 1997, Feldman, Gates et al. 1998, Zhang, Talbot et al. 1998) and it is robustly feasible that dysregulation of TGF-β signaling in the dact1/2−/− mutant contributes to the craniofacial phenotype. Future research will examine the role of dact1 and dact2 in the coordination of Wnt and TGF-β signaling and the importance of this coordination in the context of craniofacial development. Of note, Sonic Hedgehog (shh) signaling is a principal regulator to the vertebrate midline (Chiang, Litingtung et al. 1996, Ribes, Balaskas et al. 2010), and important in the development of the zebrafish floorplate (Halpern, Hatta et al. 1997, Odenthal, van Eeden et al. 2000). Mutants with disrupted shh expression or signaling (cyc/ndr2, smo, oep/tdgf1) exhibit medially displaced eyes similar to the dact1/2 mutants (Brand, Heisenberg et al. 1996, Chen, Burgess et al. 2001). We did not find any genes within the sonic hedgehog pathway to be differentially expressed in dact1/2 mutants, though post-transcriptional interactions cannot be ruled out.
This study has uncovered the genetic requirement of dact1 and dact2 in embryonic CE and craniofacial morphogenesis, delineated the genetic interaction with Wnt genes and identified capn8 as a modifier of this process. Future work will delineate the molecular differences across the different dact1/2 and other Wnt mutants to further identify determinants of craniofacial morphogenesis; and to connect these findings to clinically important Wnt regulators of facial morphology and pathology.
Methods
Animals and CRISPR/Cas9 targeted mutagenesis
All animal husbandry and experiments were performed in accordance with approval from Massachusetts General Hospital Institutional Animal Care and Usage Committee. Zebrafish (Danio rerio) embryos and adults were maintained in accordance with institutional protocols. Embryos were raised at 28.5 C in E3 medium (Carroll, Macias Trevino et al. 2020) and staged visually and according to standardized developmental timepoints (Westerfield 1993). All zebrafish lines used for experiments and gene editing were generated from the Tubingen or AB strain. The wnt11f2 mutant line and gpc4−/− mutant line were obtained from Zebrafish International Resource Center (wnt11f2tx226/+ and gpc4hi1688Tg/+ respectively). The wls−/− mutant line was originally gifted to the lab and independently generated, as previously described (Rochard, Monica et al. 2016). The sox10:kaede transgenic line was previously generated and described by our lab (Dougherty, Kamel et al. 2012).
CRISPR sgRNA guides were designed using computational programs ZiFiT Targeter v4.2 (zifit.partners.org/ZiFit) (Sander, Zaback et al. 2007), crispr.mit.edu (https://zlab.bio/guide-design-resouces) (Ran, Hsu et al. 2013), and ChopChop (https://chopchop.cbu.uib.no) (Montague, Cruz et al. 2014) with traditional sequence constraints. Guides were chosen that were predicted to give high efficiency and specificity. Guides best meeting these parameters were selected in exon 2 of dact1 and exon 4 of dact2. No suitable gRNA with sufficient efficiency were identified for dact2 5’ of exon 4 and the resulting phenotype was reassuring compared to previous morpholino published results. Guides for dact1 and dact2 and Cas9 protein were prepared and microinjected into 1 cell-stage zebrafish embryos and founders were identified as previously described (Carroll, Macias Trevino et al. 2020). Primers flanking the sgRNA guide site were designed for genotyping and fragment analysis was performed on genomic DNA to detect base pair insertion/deletion. Sanger sequencing was performed to verify targeted gene mutation and confirm the inclusion of a premature stop codon. dact1 forward primer: TACAGAAGCTGCTGAAGTACCG, dact1 reverse primer: CCCTCTCTCAAAGTGTTTTGGT, dact2 forward primer: TGAAGAGCTCCACTCCCCTGT, dact2 reverse primer: GCAGTTGAGGTCCATTCAGC.
RT qPCR analysis
Pooled wildtype, dact1−/−, dact2−/−, and dact1/2−/− fish were collected and RNA extractions were performed using RNeasy Mini Kit (Qiagen). cDNA was generated using High Capacity cDNA Reverse Transcription Kit (ThermoFisher). Quantitative PCR (qPCR) was performed using dact1 (Dr03152516_m1) and dact2 (Dr03426298_s1) TaqMan Gene Expression Assays. Expression was normalized to 18S rRNA expression ( Hs03003631_g1). TaQman Fast Advanced master mix (ThermoFisher) and a StepOnePlus Real-Time PCR system (Applied Biosystems) were used to measure relative mRNA levels, which were calculated using the ddCT method.
Microinjection of mRNA
Template DNA for in vivo mRNA transcription was generated by PCR amplification of the gene of interest from a zebrafish embryo cDNA library and cloning into pCS2+8 destination plasmid. mRNA for injection was generated using an in vitro transcription kit (Invitrogen mMessage mMachine). One-cell stage zebrafish embryos were injected with 2 nL of mRNA in solution. To test genetic knockout specificity, 150 or 300 pg or dact1, dact2 or dact1 and dact2 mRNA was injected. For capn8 overexpression analysis 200 pg or GFP or capn8 mRNA was injected. Following phenotyping analysis, genotypes were determined by fragment analysis of dact1 and dact2 genotyping PCR products.
Wholemount and RNAscope in situ hybridization
Wholemount in situ hybridization was performed as previously described (Carroll, Macias Trevino et al. 2020). Zebrafish embryonic cDNA was used as a template to generate riboprobes. Primers were designed to PCR amplify the specific riboprobe sequence with a T7 promoter sequence linked to the reverse primer. In vitro transcription was performed using a T7 polymerase and DIG-labeled nucleotides (Roche). RNAscope was performed on sectioned zebrafish larvae as previously described (Carroll, Macias Trevino et al. 2020). Probes were designed by and purchased from ACD Bio. Hybridization and detection was performed according to the manufacturer’s protocol. Sections were imaged using a confocal microscope (Leica SP8) and z-stack maximum projections were generated using Fiji software.
Alcian blue staining and imaging
Alcian blue staining and imaging were performed at 4 dpf as previously described (Carroll, Macias Trevino et al. 2020). Briefly, larvae were fixed in 4% v/v formaldehyde overnight at 4°C. Larvae were dehydrated in 50% v/v ethanol and stained with Alcian blue as described (Walker and Kimmel 2007). Whole and dissected larvae were imaged in 3% w/v methylcellulose using a Nikon Eclipse 80i compound microscope with a Nikon DS Ri1 camera. Z-stacked images were taken and extended depth of field was calculated using NIS Element BR 3.2 software. Images were processed using Fiji software. After image capture embryos were genotyped by PCR and fragment analysis.
Axis measurements
Compound dact1+/−; dact2+/− zebrafish were in-crossed and progeny were collected from 2 separate clutches and fixed in 4% formaldehyde at approximately 8ss. Embryos were individually imaged using a Zeiss Axiozoom stereoscope and processed for DNA extraction and genotyping (Westerfield 1993). Images were analyzed using Fiji. A circle was drawn to overlay the yolk and the geometric center was determined using the function on Fiji. Using the Fiji angle tool, lines were drawn from the center point to the anterior-most point of the embryo and from the center to the posterior-most point of the embryo. The resulting inner angle of these lines was determined. Each angle measurement was then calculated as a ratio to the average angle of the wildtype embryos. ANOVA was performed to determine statistical significance, p<0.05.
Lineage analysis of cranial NCCs
Live embryos were mounted in 1% w/v low melt agarose and covered with E3 medium containing 0.013% w/v tricaine. Wildtype control and dact1/2−/− compound mutants on a Tg(soxI0:kaede) background were imaged on a Leica DMi8 confocal microscope and photoconverted using the UV laser (404 nm) until the green kaede fluorescence disappeared. For each embryo, one side was photoconverted and the contralateral side served as an internal control. After photoconversion, embryos were removed from the agarose and raised in E3 medium at 28.5 C until the required developmental timepoint, at which time they were similarly re-mounted and re-imaged. Z-stacked images were processed as maximum-intensity projections using Fiji software.
Single-cell RNA sequencing (scRNA-seq)
Single-cell transcriptomic analyses were performed on 10 zebrafish embryos, including 4 wildtype, 3 dact1−/−;dact2−/− compound mutant, and 3 gpc4−/− mutant embryos. Embryos were collected at 4 ss with dact1−/−,dact2−/− and gpc4−/− mutants being identified by their truncated body axis. Embryos were dechorionated with a short (approximately 10 min) incubation in 1 mg/ml Pronase and then washed 3x in embryo medium. Cell dissociation was performed with modifications as previously described (Farrell, Wang et al. 2018). Each embryo was transferred to 50 μl DMEM/F12 media on ice. To dissociate cells, media was replaced with 200 μl DPBS (without Ca2+ and Mg2+) with 0.1% w/v BSA. Embryos were disrupted by pipetting 10x with a P200 pipette tip. 500 μl of DPBS + 0.1% BSA was added and cells were centrifuged at 300xg for 1 min. Cell pellets were resuspended in 200 μl DPBS + 0.1% BSA and kept on ice. Just prior to encapsulation, cells were passed through a 40 μm cell strainer, and cell counts and viability were measured. After droplet encapsulation, barcoding, and library preparation using the 10X Genomics Chromium Single Cell 3’ kit (version 3), data were sequenced on an Illumina NovaSeq 6000 sequencer.
FASTQ files were demultiplexed and aligned to the GRCz11 build of the zebrafish genome using Cellranger (version 6.1.0) (Zheng, Terry et al. 2017). Raw Cellranger count matrices were imported into R (version 4.1.2) using Seurat (version 4.1.0) (Hao, Hao et al. 2021). First, we reviewed data for quality and excluded any droplet that did not meet all of the following criteria: (i) have at least 1,500 unique molecular identifiers (UMIs), (ii) covering at least 750 distinct genes; (iii) have <5% of genes mapping to the mitochondrial genome; and (iv) have a log10 of detected genes per UMI >80%. After quality control, the dataset was also filtered to exclude genes with a detection rate below 1 in 3,000 cells, leaving a total of 20,078 distinct genes expressed across 19,457 cells for analysis.
The quality-controlled count data were normalized using Pearson’s residuals from the regularized negative binomial regression model, as implemented in Seurat::SCTransfrom (Hafemeister and Satija 2019). When computing the SCT model, the effect of the total number of UMIs and number of detected genes per cell were regressed out. After normalization, the top 3,000 most variably expressed genes were used to calculate principal components (PCs). Data were then integrated by source sample using Harmony (version 0.1.0) (Korsunsky, Millard et al. 2019). A two-dimensional uniform manifold approximation and projection (UMAP) (Becht, McInnes et al. 2018) was then derived from the first 40 Harmony embeddings for visualization. Using the integrated Harmony embeddings, clusters were defined with the Louvain clustering method, as implemented within Seurat. A resolution of 0.3 was used for cluster definition. Cluster identities were assigned by manually reviewing the results of Seurat::FindAllMarkers, searching for genes associated to known developmental lineages. Gene expression data for key markers that guided cluster identity assignment were visualized using Seurat::DotPlot.
Following this detailed annotation, some clusters were grouped to focus downstream analyses on 3 major lineages: ventral mesoderm (grouping cells from the pronephros, vasculogenic/myeloid precursors, hematopoietic cells, heart primordium, and cephalic mesoderm clusters), dorsal mesoderm (adaxial cells, segmental plate, and paraxial mesoderm), ectoderm (CNS, mid/hindbrain boundary, spinal cord, and neural crest). For those 3 lineages, single-cell level data were aggregated per sample and cluster to perform pseudobulk differential expression analyses (DEA) contrasting genotypes. Independent pairwise comparisons of dact1−/−;dact2−/− versus wildtype and gpc4−/− vs wildtype were performed using DESeq2 (v1.34.0) (Love, Huber et al. 2014). P-values were corrected for multiple testing using the default Benjamini-Hochberg method; log2 fold change values were corrected using the apeglm shrinkage estimator (Zhu, Ibrahim et al. 2019). Significance was defined as an adjusted p-value < 0.1 and log2 fold change > 0.58 in absolute value. Heatmaps of the top most significant differentially expressed genes were generated from the regularized log transformed data using pheatmap (version 1.0.12). Overlap in significant genes across pairwise comparisons were determined and visualized in Venn diagrams. Over-representation analyses against the Gene Ontology (GO) database were ran using clusterProfiler (version 4.2.2) (Wu, Hu et al. 2021), using as input the set of genes found to be differentially expressed in the comparison of dact1−/−;dact−/− versus wildtype but not gpc4−/− versus wildtype. Sequencing data have been deposited in GEO under accession code GSE240264.
Statistical analysis
Analyses were performed using Prism Software (GraphPad) unless otherwise specified. An unpaired Student’s t test or one-way ANOVA with multiple comparisons was used as indicated and a P-value <0.05 was considered significant. Graphs represent the mean +/− the SEM and n represents biological replicates. For categorical data (normal vs. mutant phenotype) a Fisher exact test was performed between gfp and capn8 injected embryos and the odds ratio was determined. The confidence interval was determined by the Baptista-Pike method.
Acknowledgements
We thank Christoph Seiler, Adele Donohue and the Aqautics Facility team at Children’s Hospital of Philadelphia; and Jessica Bethoney at Massachusetts General Hospital (MGH) for their excellent management of our zebrafish colonies and facilities. We thank the MGH Next Generation Sequencing Core for cell encapsulation, cDNA library preparation, and sequencing. Single-cell sequencing analysis was performed by the Harvard Chan Bioinformatics Core. Work by A.J. was funded in part by the Harvard Stem Cell Institute. We appreciate and acknowledge the generous funding support from the Shriners Hospitals for Children. This work was supported by the National Institutes of Health grant R01DE027983 to E.C.L.
Supplemental Figures

Daniocell single-cell RNAseq analysis with a display of dact1, dact2, gpc4, and wnt11f2 in all cell clusters from 3-120 hpf of development (Farrell, Wang et al. 2018). Cephalic mesoderm (ceph mes), mesenchyme, neural ectoderm, and muscle clusters are noted.

Characterization of CRISPR/Cas9 generated dact1−/− and dact2−/− mutants.
A) Schematic representations of dact1 and dact2 exons, positions of guide RNA target site, introduced premature stop codon (arrow), and sequences of mutations. B) DNA fragment analysis of dact1+/− and dact2+/− animals showing wildtype (250 and 387 bp respectively and mutant (228 and 380 bp respectively) C) Expression levels of dact1 and dact2 mRNA by RT-qPCR in 12 hpf dact1−/− mutants, dact2−/− mutants, and dact1/2−/− compound mutants. 8 embryos were pooled for mRNA isolation per sample. D) Injection of dact1 mRNA, dact2 mRNA, or a combination of dact1 and dact2 mRNA rescues the rod-shaped ethmoid plate phenotype in dact1/2−/− compound mutants. Representative images of Alcian blue stained dact1/2−/− double mutant treated with 300 pg dact1 mRNA and 300 pg dact2 mRNA. Arrow highlights normal ethmoid plate (EP). Visceral cartilage (VC) also appeared normal. E) Quantification of the mutant craniofacial phenotype observed in a dact1−/−,dact2+/− breeding in-cross. Without mRNA injection, the mutant phenotype was observed at approximately (35%) the expected Mendelian ratio of 25%. Injection with dact1 mRNA, dact2 mRNA, or a combination of dact1 and dact2 mRNA decreased the frequency that the mutant craniofacial phenotype was observed.

Loss of dact1 and dact2 tends to decrease total body length.
A) Representative brightfield images of 4 dpf larvae of compound dact1 and dact2 mutant genotypes. Bar represents dact1/2+/+ body length measurement. Scale bar: 100 μm. B) Scatter plot of body length measurement of compound dact1 and dact2 mutant genotypes at 4 dpf. ANOVA p=0.06. n=3-4.

Cluster abundance across genotype groups. Scatter box plots showing the frequency of each identified cell cluster between dact1/2−/−, gpc4−/−, and wildtype samples.

Loss of gpc4 and loss of dact1/2 leads to distinct changes in gene expression profiles but with some overlapping functions. GO analysis of DEGs identified between gpc4−/− and wildtype embryos and dact1/2−/− and wildtype embryos found changes in calcium ion binding and actin interaction in both mutants.
References
- 1.Synergistic roles of Wnt modulators R-spondin2 and R-spondin3 in craniofacial morphogenesis and dental developmentSci Rep 11:5871Google Scholar
- 2.Wntless, a conserved membrane protein dedicated to the secretion of Wnt proteins from signaling cellsCell 125:509–522Google Scholar
- 3.Secretion of Wnt ligands requires Evi, a conserved transmembrane proteinCell 125:523–533Google Scholar
- 4.Dimensionality reduction for visualizing single-cell data using UMAPNat Biotechnol 37:38–44Google Scholar
- 5.Zebrafish information network, the knowledgebase for Danio rerio researchGenetics 220:4Google Scholar
- 6.Mutations affecting development of the midline and general body shape during zebrafish embryogenesisDevelopment 123:129–142Google Scholar
- 7.Frodo proteins: modulators of Wnt signaling in vertebrate developmentDifferentiation 73:323–329Google Scholar
- 8.An Irf6-Esrp1/2 regulatory axis controls midface morphogenesis in vertebratesDevelopment 147:24Google Scholar
- 9.Analysis of the zebrafish smoothened mutant reveals conserved and divergent functions of hedgehog activityDevelopment 128:2385–2396Google Scholar
- 10.Dapper, a Dishevelled-associated antagonist of beta-catenin and JNK signaling, is required for notochord formationDev Cell 2:449–461Google Scholar
- 11.Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene functionNature 383:407–413Google Scholar
- 12.Wnt/beta-catenin signaling and diseaseCell 149:1192–1205Google Scholar
- 13.Morpholino antisense oligonucleotides: tools for investigating vertebrate developmentGenome Biol 2:REVIEWS1015Google Scholar
- 14.Translocation of the cytoplasmic domain of ADAM13 to the nucleus is essential for Calpain8-a expression and cranial neural crest cell migrationDev Cell 20:256–263Google Scholar
- 15.Embryonic fate map of first pharyngeal arch structures in the sox10: kaede zebrafish transgenic modelJ Craniofac Surg 23:1333–1337Google Scholar
- 16.An evolutionarily conserved intronic region controls the spatiotemporal expression of the transcription factor Sox10BMC Dev Biol 8:105Google Scholar
- 17.A single-cell transcriptome atlas for zebrafish developmentDev Biol 459:100–108Google Scholar
- 18.Single-cell reconstruction of developmental trajectories during zebrafish embryogenesisScience 360Google Scholar
- 19.Zebrafish organizer development and germ-layer formation require nodal-related signalsNature 395:181–185Google Scholar
- 20.Dapper1 is a nucleocytoplasmic shuttling protein that negatively modulates Wnt signaling in the nucleusJ Biol Chem 283:35679–35688Google Scholar
- 21.Two Frodo/Dapper homologs are expressed in the developing brain and mesoderm of zebrafishDev Dyn 230:403–409Google Scholar
- 22.Frodo interacts with Dishevelled to transduce Wnt signalsNat Cell Biol 4:351–357Google Scholar
- 23.Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regressionGenome Biol 20:296Google Scholar
- 24.Genetic interactions in zebrafish midline developmentDev Biol 187:154–170Google Scholar
- 25.Mutations affecting morphogenesis during gastrulation and tail formation in the zebrafish, Danio rerioDevelopment 123:143–151Google Scholar
- 26.Integrated analysis of multimodal single-cell dataCell 184:3573–3587Google Scholar
- 27.Molecular and cellular mechanisms of development underlying congenital diseasesCongenit Anom (Kyoto 54:1–7Google Scholar
- 28.The cyclops mutation blocks specification of the floor plate of the zebrafish central nervous systemNature 350:339–341Google Scholar
- 29.Morpholino oligos: making sense of antisense?Dev Biol 243:209–214Google Scholar
- 30.Genes involved in forebrain development in the zebrafish, Danio rerioDevelopment 123:191–203Google Scholar
- 31.The function of silberblick in the positioning of the eye anlage in the zebrafish embryoDev Biol 184:85–94Google Scholar
- 32.Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulationNature 405:76–81Google Scholar
- 33.The involvement of Frodo in TCF-dependent signaling and neural tissue developmentDevelopment 131:4725–4734Google Scholar
- 34.Vertebrate homologues of Frodo are dynamically expressed during embryonic development in tissues undergoing extensive morphogenetic movementsDev Dyn 235:279–284Google Scholar
- 35.WNT Signaling and Bone: Lessons From Skeletal Dysplasias and DisordersFront Endocrinol (Lausanne 11:165Google Scholar
- 36.Wnt Signaling in Neural Crest Ontogenesis and OncogenesisCells 8:10Google Scholar
- 37.Skeletogenic fate of zebrafish cranial and trunk neural crestPLoS One 7:e47394Google Scholar
- 38.Requirement for frzb and fzd7a in cranial neural crest convergence and extension mechanisms during zebrafish palate and jaw morphogenesisDev Biol 381:423–433Google Scholar
- 39.Dact1-3 mRNAs exhibit distinct expression domains during tooth developmentGene Expr Patterns 10:140–143Google Scholar
- 40.Dact2 is involved in the regulation of epithelial-mesenchymal transitionBiochem Biophys Res Commun 524:190–197Google Scholar
- 41.Specification and morphogenesis of the zebrafish larval head skeletonDev Biol 233:239–257Google Scholar
- 42.All Dact (Dapper/Frodo) scaffold proteins dimerize and exhibit conserved interactions with Vangl, Dvl, and serine/threonine kinasesBMC Biochem 12:33Google Scholar
- 43.Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafishDev Cell 32:97–108Google Scholar
- 44.Cleavage of E-cadherin and beta-catenin by calpain affects Wnt signaling and spheroid formation in suspension cultures of human pluripotent stem cellsMol Cell Proteomics 13:990–1007Google Scholar
- 45.Fast, sensitive and accurate integration of single-cell data with HarmonyNat Methods 16:1289–1296Google Scholar
- 46.Head formation requires Dishevelled degradation that is mediated by March2 in concert with Dapper1Development 145:7Google Scholar
- 47.Dact2 represses PITX2 transcriptional activation and cell proliferation through Wnt/beta-catenin signaling during odontogenesisPLoS One 8:e54868Google Scholar
- 48.Distinct requirements of wls, wnt9a, wnt5b and gpc4 in regulating chondrocyte maturation and timing of endochondral ossificationDev Biol 421:219–232Google Scholar
- 49.The Wnt signaling pathway in development and diseaseAnnu Rev Cell Dev Biol 20:781–810Google Scholar
- 50.Generating Cellular Diversity and Spatial Form: Wnt Signaling and the Evolution of Multicellular AnimalsDev Cell 38:643–655Google Scholar
- 51.Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2Genome Biol 15:550Google Scholar
- 52.The Wnt Signaling Antagonist Dapper1 Accelerates Dishevelled2 Degradation via Promoting Its Ubiquitination and Aggregate-induced AutophagyJ Biol Chem 290:12346–12354Google Scholar
- 53.Characterization of the definitive classical calpain family of vertebrates using phylogenetic, evolutionary and expression analysesOpen Biol 4:130219Google Scholar
- 54.Zebrafish wnt11: pattern and regulation of the expression by the yolk cell and No tail activityMech Dev 71:165–176Google Scholar
- 55.The Emerging Mechanisms of Wnt Secretion and Signaling in DevelopmentFront Cell Dev Biol 9:714746Google Scholar
- 56.Accelerated re-epithelialization in Dpr2-deficient mice is associated with enhanced response to TGFbeta signalingJ Cell Sci 121:2904–2912Google Scholar
- 57.CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editingNucleic Acids Res 42:W401–407Google Scholar
- 58.Gene Editing Versus MorphantsZebrafish 12:319Google Scholar
- 59.Zebrafish Craniofacial Development: A Window into Early PatterningCurr Top Dev Biol 115:235–269Google Scholar
- 60.Tbx16 cooperates with Wnt11 in assembling the zebrafish organizerMech Dev 124:35–42Google Scholar
- 61.Effective targeted gene ‘knockdown’ in zebrafishNat Genet 26:216–220Google Scholar
- 62.The complex world of WNT receptor signallingNat Rev Mol Cell Biol 13:767–779Google Scholar
- 63.Two distinct cell populations in the floor plate of the zebrafish are induced by different pathwaysDev Biol 219:350–363Google Scholar
- 64.Planar cell polarity signalling regulates cell adhesion properties in progenitors of the zebrafish laterality organDevelopment 137:3459–3468Google Scholar
- 65.Wnt signaling and the polarity of the primary body axisCell 139:1056–1068Google Scholar
- 66.Jaw and branchial arch mutants in zebrafish II: anterior arches and cartilage differentiationDevelopment 123:345–356Google Scholar
- 67.Delamination of neural crest cells requires transient and reversible Wnt inhibition mediated by Dact1/2Development 143:2194–2205Google Scholar
- 68.Genome engineering using the CRISPR-Cas9 systemNat Protoc 8:2281–2308Google Scholar
- 69.Wnt signaling in orofacial clefts: crosstalk, pathogenesis and modelsDis Model Mech 12:2Google Scholar
- 70.Distinct Sonic Hedgehog signaling dynamics specify floor plate and ventral neuronal progenitors in the vertebrate neural tubeGenes Dev 24:1186–1200Google Scholar
- 71.Roles of Wnt pathway genes wls, wnt9a, wnt5b, frzb and gpc4 in regulating convergent-extension during zebrafish palate morphogenesisDevelopment 143:2541–2547Google Scholar
- 72.Genetic compensation induced by deleterious mutations but not gene knockdownsNature 524:230–233Google Scholar
- 73.Zinc Finger Targeter (ZiFiT): an engineered zinc finger/target site design toolNucleic Acids Res 35:W599–605Google Scholar
- 74.Fishing for the signals that pattern the faceJ Biol 8:101Google Scholar
- 75.Dact genes are chordate specific regulators at the intersection of Wnt and Tgf-beta signaling pathwaysBMC Evol Biol 14:157Google Scholar
- 76.Wnt/planar cell polarity signaling controls morphogenetic movements of gastrulation and neural tube closureCell Mol Life Sci 79:586Google Scholar
- 77.A role of glypican4 and wnt5b in chondrocyte stacking underlying craniofacial cartilage morphogenesisMech Dev 138:279–290Google Scholar
- 78.Mutations affecting cell fates and cellular rearrangements during gastrulation in zebrafishDevelopment 123:67–80Google Scholar
- 79.Calpain 8 as a potential biomarker regulates the progression of pancreatic cancer via EMT and AKT/ERK pathwayJ Proteomics 301:105182Google Scholar
- 80.A novel tissue-specific calpain species expressed predominantly in the stomach comprises two alternative splicing products with and without Ca(2+)-binding domainJ Biol Chem 268:19476–19482Google Scholar
- 81.Wnt signaling in development and tissue homeostasisDevelopment 145:11Google Scholar
- 82.The evolutionally conserved activity of Dapper2 in antagonizing TGF-beta signalingFASEB J 21:682–690Google Scholar
- 83.Examination of a palatogenic gene program in zebrafishDev Dyn 240:2204–2220Google Scholar
- 84.Convergent extension: using collective cell migration and cell intercalation to shape embryosDevelopment 139:3897–3904Google Scholar
- 85.Expression of the zebrafish genome during embryogenesishttp://zfin.org
- 86.The zebrafish glypican knypek controls cell polarity during gastrulation movements of convergent extensionDev Cell 1:251–264Google Scholar
- 87.Hedgehog signaling is required for cranial neural crest morphogenesis and chondrogenesis at the midline in the zebrafish skullDevelopment 132:3977–3988Google Scholar
- 88.A two-color acid-free cartilage and bone stain for zebrafish larvaeBiotech Histochem 82:23–28Google Scholar
- 89.Zebrafish Dapper1 and Dapper2 play distinct roles in Wnt-mediated developmental processesDevelopment 131:5909–5921Google Scholar
- 90.Loss of Dact1 disrupts planar cell polarity signaling by altering dishevelled activity and leads to posterior malformation in miceJ Biol Chem 285:11023–11030Google Scholar
- 91.The zebrafish book: a guide for the laboratory use of zebrafish (Brachydanio rerio)Eugene, OR: M. Westerfield Google Scholar
- 92.Wnt signalling: conquering complexityDevelopment 145:12Google Scholar
- 93.Direct binding of the PDZ domain of Dishevelled to a conserved internal sequence in the C-terminal region of FrizzledMol Cell 12:1251–1260Google Scholar
- 94.clusterProfiler 4.0: A universal enrichment tool for interpreting omics dataInnovation (Camb 2:100141Google Scholar
- 95.Calpain2 protease: A new member of the Wnt/Ca(2+) pathway modulating convergent extension movements in XenopusDev Biol 384:83–100Google Scholar
- 96.Positional cloning identifies zebrafish one-eyed pinhead as a permissive EGF-related ligand required during gastrulationCell 92:241–251Google Scholar
- 97.Dapper 1 antagonizes Wnt signaling by promoting dishevelled degradationJ Biol Chem 281:8607–8612Google Scholar
- 98.Zebrafish Dpr2 inhibits mesoderm induction by promoting degradation of nodal receptorsScience 306:114–117Google Scholar
- 99.Massively parallel digital transcriptional profiling of single cellsNat Commun 8:14049Google Scholar
- 100.CAPN8 involves with exhausted, inflamed, and desert immune microenvironment to influence the metastasis of thyroid cancerFront Immunol 13:1013049Google Scholar
- 101.Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differencesBioinformatics 35:2084–2092Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.91648. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Carroll et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,143
- downloads
- 43
- citations
- 3
Views, downloads and citations are aggregated across all versions of this paper published by eLife.