Abstract
Global amphibian declines are compounded by deadly disease outbreaks caused by the chytrid fungus, Batrachochytrium dendrobatidis (Bd). Much has been learned about the roles of amphibian skin-produced antimicrobial components and microbiomes in controlling Bd, yet almost nothing is known about the roles of skin-resident immune cells in anti-Bd defenses. Mammalian mast cells reside within and serve as key immune sentinels in barrier tissues like skin. Accordingly, we investigated the roles of Xenopus laevis frog mast cells during Bd infections. Our findings indicate that enrichment of X. laevis skin mast cells confers significant anti-Bd protection and ameliorates the inflammation-associated skin damage caused by Bd infection. This includes a significant reduction in Bd-infected skin infiltration by neutrophils. Augmenting frog skin mast cells promotes greater mucin content within cutaneous mucus glands and protects frogs from Bd-mediated changes to their skin microbiomes. Mammalian mast cells are known for their production of the pleiotropic interleukin-4 (IL4) cytokine and our findings suggest that the frog IL4 plays a key role in conferring the effects seen following frog skin mast cell enrichment. Together, this work underlines the importance of amphibian skin-resident immune cells in anti-Bd defenses and illuminates a novel avenue for investigating amphibian host-chytrid pathogen interactions.
Introduction
Catastrophic declines of hundreds of amphibian species across six continents have been causally linked to the chytrid fungi, Batrachochytrium dendrobatidis (Bd) and Batrachochytrium salamandrivorans (Bsal)1, 2. Motile Bd zoospores readily colonize keratinized skin of adult amphibians and keratinized mouthparts of tadpoles3. Bd skin infections culminate in chytridiomycosis, ultimately disrupting the function of this respiratory and barrier tissue3, 4, 5. Effectively combatting chytrid infections requires a holistic understanding of amphibian cutaneous immune defenses. Research efforts up to this point have focused on antifungal capacities of amphibian skin-produced antimicrobial peptides6, 7; commensal antifungal products7, 8, 9; antifungal properties of mucus9, alkaloids10, and lysozymes11, 12 as well as the roles of antibodies4,13. Many of these studies suggest that Bd exposure can elicit some immune protection14. However, the contribution of skin-resident immune cells to amphibian anti-Bd defenses remains almost entirely unexplored.
Mammalian mast cells serve as sentinels of mucosal and connective tissues, including in barrier tissues like skin, where they maintain homeostasis and regulate immune responses15. Other granulocyte-lineage cells such as neutrophils are generally not found in healthy tissues and only extravasate into sites of inflammation16. Consequently, mast cells are among the first immune cells to recognize and respond to skin-infiltrating pathogens. When activated, mast cells release pre-formed and de novo-generated immunomodulatory compounds that may serve to elicit, exacerbate, or ameliorate inflammatory responses15. One of these mast cell-produced mediators, the interleukin-4 (IL4) cytokine dampens inflammation and promotes tissue repair17. Cells bearing hallmark mast cell cytology have been reported across a range of non-mammalian species18, 19, including amphibians20. Notably, the principal mast cell growth factor, stem cell factor (SCF, KIT ligand) required for mast cell differentiation and survival21 is expressed by all vertebrates examined to-date.
Here, we combine comprehensive in vitro and in vivo approaches to define the roles of amphibian (Xenopus laevis) mast cells during Bd infections. Our results provide compelling evidence that skin-resident immune cells contribute to anti-Bd defenses.
Results
Frog mast cells possess archetypal mast cell cytology and transcriptional profiles
We produced X. laevis recombinant (r)SCF, and used this reagent to generate mast cell cultures from bone marrow-derived myeloid precursors22. Mast cells were compared to bone marrow-derived neutrophilic granulocytes (hereafter referred to as ‘neutrophils’), differentiated using a recombinant X. laevis colony-stimulating factor-322 (rCSF3, i.e., granulocyte colony-stimulating factor; GCSF). While the neutrophil cultures were comprised of cells with hyper-segmented nuclei and neutral-staining cytoplasms (Fig. 1A), the mast cell cultures consisted predominantly of mononuclear cells with basophilic cytoplasm (Fig. 1B). We confirmed the granulocyte-lineage of X. laevis mast cells using specific esterase (SE) staining (Fig. 1D). As expected, X. laevis neutrophils were also SE-positive (Fig. 1C). Mast cell and neutrophil morphology was further explored with electron microscopy (Fig. 1E-H). SEM imaging demonstrated that X. laevis mast cells possess extensive folding of their plasma membranes (Fig. 1F). This mast cell-characteristic membrane ruffling appeared as projections resembling pseudopods via TEM, which further revealed electron-dense heterogenous granules, few mitochondria, and round to elongated nuclei (Fig. 1H) typical of mammalian mast cells23. X. laevis neutrophils also exhibited pronounced membrane ruffling (Fig. 1E) but strikingly distinct intracellular appearance including multilobed nuclei (Fig. 1G).

X. laevis bone marrow-derived mast cells possess classical mast cell cytology and transcriptional profiles.
Neutrophils (A, C, E, G) and mast cells (B, D, F, H) were stained with Giemsa (A, B) and Leder to visualize specific esterase activity (SE) (C, D) or imaged with scanning and transmission electron microscopy (SEM: E, F and TEM: G, H). (I) Heat map of the top 30 differentially expressed genes (DEGs) identified with RNA sequencing analyses of X. laevis mast cell (N=4) and neutrophil (N=4) cultures. Log2fold change in expression represented as color scale.
Frog mast cells and neutrophils exhibited distinct transcriptional profiles of immune-related genes including those encoding lineage-specific transcription factors, immune receptors, downstream signaling components and adhesion molecules, as well as non-immune genes (Fig. 1I). Frog mast cells and neutrophils each expressed greater levels of lineage-specific transcription factors associated with mammalian mast cell (gata1, gata2, and mitf)24 and neutrophil (cebp family members)25 counterparts, respectively (Fig. 2A). Notably, mast cells expressed greater levels of enzyme and cytokine genes associated with tissue remodeling (carboxypeptidase-3; cpa326), immune suppression (indoleamine 2,3 dioxygenase-1; ido127) and amelioration of cutaneous inflammation (leukemia inhibitory factor, lif28; Fig. 2B). Conversely, neutrophils expressed predominantly proinflammatory enzymes and cytokine genes such as leukotriene 4 hydrolase (lta4h; Fig. 2B) and tumor necrosis factor alpha (tnfa, Fig. 2B). In addition, mast cells and neutrophils each had greater expression of genes encoding their respective growth factor receptors, kit and csf3r (Fig. 2B).

Frog mast cells and neutrophils possess gene profiles similar to their mammalian counterparts.
The differentially expressed genes from the RNA sequencing analyses of X. laevis mast cells and neutrophil cultures were profiled for those encoding (A) transcription factors associated with mast cell- or neutrophil-specific lineages and (B) granulocyte antimicrobial components and growth factor receptor genes. All depicted genes were significantly differentially expressed between the two populations, N=4 per group.
Enriching mast cells in frog skin offers protection against Bd
Although all granulocyte-lineage cells possess SE activity, mast cells are the predominant mononuclear granulocytes to reside in vertebrate tissues29. Therefore, we selectively enriched mast cells in X. laevis skin via subcutaneous rSCF administration (note SE-stained cells indicated by arrows in r-ctrl-injected skins, Fig. 3A, versus r-SCF-injected skins, Fig 3B). We confirmed SE-positive cells in rSCF-treated skins also possessed round-oval nuclei (Fig. 3C). Maximum mast cell enrichment was observed 12 hours post injection (hpi) of rSCF (Fig. 3D).

Enriching frog cutaneous mast cells lowers Bd loads.
Representative images of SE stained (A) control and (B) mast cell-enriched skin 12 hpi. (C) We confirmed the enriched population was composed of mono-morphonuclear cells. (D) Mast cell enrichment was optimized across several time points by quantifying SE-positive cells per field of view under 40x magnification. Results represent means ± SEM from 3 animals per time point (2 experimental repeats). (E) Mast cell-enriched and control dorsal skins were collected from X. laevis 10- and 21-dpi. Bd loads are represented as the number of zoospore genomic equivalents (GE) × 105 per μl of total input DNA. Time points were analyzed independently. Results represent means ± SEM from 7 animals per experimental group (N=7). Asterisks indicate significance: p < 0.05 by (D) one-way ANOVA with Tukey post-hoc analysis or (E) Student’s t-test.
We next examined the consequences of enriching frog skin mast cells on Batrachochytrium dendrobatidis (Bd) infection outcomes. To this end, X. laevis were subcutaneously administered with rSCF or the r-ctrl, infected with Bd, and the skin fungal loads assessed at 10- and 21-days post infection (dpi). At 10 dpi, skin mast cell-enriched X. laevis possessed significantly lower Bd loads than r-ctrl administered animals (Fig. 3E). By 21 dpi, both r-ctrl and rSCF-administered groups possessed substantially greater Bd loads, although the mast cell-enriched animals continued to show significantly lower skin fungal loads (Fig. 3E).
Mammalian mast cells may be labeled in situ by using avidin to visualize the heparin-containing mast cell granules30. Using this approach, we confirmed that frog bone marrow-derived mast cells likewise possess heparin-containing granules (Fig. 4A&B). We next used this staining approach to visualize and enumerate mast cells in the skins of control, mast cell-enriched and Bd-challenged animals (Fig. 4C-I). We observed that frog skin mast cell enrichment progressively waned with time in mock-infected animals, and by 21 days post mock infection these animals had skin mast cell numbers comparable to r-ctrl-injected, mock-infected control animals (Fig. 4C, D). Conversely, compared to mock-infected control animals, the rSCF-injected, Bd-challenged frogs maintained significantly greater mast cell numbers in their skin throughout the 21-day infection study (Fig. 4C, E-H). Interestingly, r-ctrl-injected, Bd-infected animals exhibited significantly increased skin mast cell numbers at 10- and 21-days of infection, compared to uninfected control frogs (Fig. 4C, I). Most of these mast cells were observed in the epidermal layer, spreading out between the skin epithelial cells (Fig. 4G).

Heparin content and skin localization of frog mast cells.
Frogs were administered r-ctrl or rSCF subcutaneously, mock or Bd-challenged and skin examined after 1, 3, 10 and 21 dpi. (A, B) Representative images (cultures derived from 5 individual frogs) of bone marrow-derived frog mast cells, stained with fluorescently labeled avidin to visualize the heparin-containing mast cells (avidin: red; nuclei: blue; actin: green). (C-I) Skin tissue from control (r-ctrl) or mast cell-enriched (rSCF), mock-(not shown) and Bd-infected (D-I) X. laevis were stained with fluorescently labeled avidin to visualize mast cells therein (N=6 animals per treatment group). Images were inverted in ImageJ for greater contrast and visibility. (C) Heparin-containing mast cells were enumerated and depicted as means + SEM of heparin-positive cells per field of view, N=6 animals per treatment group. Asterisks indicate statistical significance from r-ctrl: p < 0.05. Representative images of heparin-containing mast cells in the skins of (D) r-ctrl animals 1 dpi; (E) rSCF-administered frogs 1 dpi; (F, G) rSCF-administered frogs 10 dpi; (H) rSCF-administered frogs 21 dpi and (I) r-ctrl-treated animals 21 dpi with Bd.
Mast cells protect frogs from Bd-elicited inflammation-associated pathology
To explore potential mechanisms of mast cell-mediated protection against Bd, we compared the gene expression profiles of r-ctrl- and rSCF-administered, Bd-infected frog skins at 21 dpi. Among the top differentially expressed genes, we noted mast cell-enriched, Bd-infected skins possessed greater transcripts for genes associated with cutaneous strength and integrity (lamc2)31, suppression of cell migration (b3gnt3.1)32, as well as ion and nutrient flow (gjb3l)33 (Fig. 5A). Moreover, mast cell-enriched Bd-challenged skin exhibited greater expression of genes associated with protection of the mucosa and epithelial healing (ttf3.6s)34 and mucus production (duoxa1.s35, gabrp36; Fig. 5A). In striking contrast, skins from control Bd-infected frogs revealed greater expression of genes associated with leukocyte infiltration and inflammation (e.g., ccl19, cxcl16, adamts13, csf3r; Fig. 5A). These transcriptional profiles were supported by our histological observations wherein control Bd-infected skins exhibited hyperkeratosis, epidermal hyperplasia, jagged stratum corneum, and extensive leukocyte infiltration (Fig. 5B), while mast cell-enriched Bd-infected tissues appeared considerably less afflicted by these pathologies (Fig. 5C). Quantification of Bd-infected skin epidermal thickness confirmed that mast cell-enriched animals possessed significantly less thickened epidermal skin compared to control (r-ctrl), Bd-infected animals (Fig. 5D).

Consequences of cutaneous mast cell enrichment.
(A) RNAseq analysis of skin tissue from control (r-ctrl) or mast cell-enriched (rSCF) Bd-infected X. laevis at 21 dpi. Heat map of the top 30 DEGs, numbers matched to colors represent log2 fold change in expression, N = 4 r-ctrl-treated, Bd-infected and 4 rSCF-treated, Bd-infected skin samples. (B & C) Representative images of control and mast cell-enriched, Bd-infected skins, 21 dpi, demonstrating differences in epidermal thickening and mucus gland filling. Mucin content was visualized in cutaneous mucus glands with Alcian Blue/PAS stain. Mucus glands are denoted by ‘m’, and epithelia are denoted by ‘Ep’. ImageJ software was used to determine the means + SEM of (D) skin epithelial thickness and (E) percent mucus gland filling (N=6). Asterisks indicate significance: p < 0.05 by one-way ANOVA with Tukey post-hoc analysis.
Because mast cell-enriched frog skins had greater expression of genes associated with mucosal tissue integrity and mucus production (Fig. 5A), we also investigated whether the anti-Bd protection identified in mast cell-enriched skins could be due, at least in part, to differences in mucus production. Interestingly, the skin mucus glands of mast cell-enriched, mock- and Bd-infected frogs were significantly more filled than those of mock- and Bd-infected control animals (Fig. 5B,C,E).
Cutaneous neutrophil enrichment results in increased Bd fungal loads
Neutrophils are one of the first leukocytes to infiltrate infected tissues, typically amplifying inflammation37. All vertebrate neutrophils depend on CSF3 for their differentiation and function38, and our previous work has demonstrated the gene encoding the CSF3 receptor (csf3r) is a marker of X. laevis neutrophils39, 40. Because csf3r expression was markedly elevated in control over mast cell-enriched skins of infected frogs (Fig. 5A), we examined the neutrophil content in the skins of these animals over the 21-day course of Bd infection (Fig. 6A-E). To this end, we used in situ hybridization analysis of skin-myeloperoxidase, a marker of neutrophils41. While the skins of r-ctrl- and rSCF-administered, mock-infected frogs contained relatively few neutrophils (Fig. 6A, E), the skins of r-ctrl-injected, Bd-infected animals had significantly elevated neutrophil numbers (Fig. 6B,C,E). Conversely, at both examined timepoints (10, 21 dpi), mast cell-enriched frog skins possessed neutrophil levels similar to those seen in the uninfected animals (Fig. 6D,E).

Consequences of cutaneous neutrophil enrichment.
(A-E) Frogs were administered with r-ctrl or rSCF, mock- or Bd-infected and examined in situ for neutrophil content via by RNAScope analyses of myeloperoxidase (mpo) transcripts. Representative images of (A) r-ctrl-injected frog skins 10 days post mock infection; (B) r-ctrl-injected frog skins 10 days post Bd infection; (C) r-ctrl-injected frog skins 21 days post Bd infection; and (D) r-SCF-administered frog skins 21 days post Bd infection. (E) Means + SEM of mpo-positive neutrophils per field of view of r-ctrl- and rSCF-administered, mock- or Bd-challenged frog skins 10 or 21 dpi, (N=6). Asterisks indicate significance from control: p < 0.05 by one-way ANOVA with Tukey post-hoc analysis. Representative specific-esterase staining of skin tissues from frogs were administered with (F) r-ctrl or (G) rCSF3, N=4. Arrows denote specific esterase-positive cells. Ep: epithelium. (H) Bd loads in control and neutrophil-enriched skin tissues 7 dpi, N=6. Asterisks indicate significance: p < 0.05 by one-way ANOVA with Tukey post-hoc analysis.
We next assessed the consequence of enriching frog skins for neutrophils via subcutaneous rCSF3 administration. We confirmed neutrophil enrichment peaked 12 hp rCSF3 injection (Fig. S1) and resulted in a thickened epidermis in comparison with r-ctrl injected skins of otherwise healthy animals (i.e., no Bd; Fig. 6F, G). When challenged with Bd, frogs with neutrophil-enriched skin possessed significantly greater Bd loads than control frogs (Fig. 6H). This suggests that neutrophil-mediated inflammation may be exacerbating Bd infections.
Enrichment of frog skin mast cells alters skin microbial composition
Amphibian skin-produced mucus may offer antimicrobial protection and serve as a selective substratum for commensal microbes, many of which are antifungal9. We found no significant differences in direct Bd-killing capacities of mucus isolated from mock- or Bd-challenged control or mast cell-enriched frogs (Fig. S2). By contrast, we observed substantial differences in skin microbiomes, including changes in bacterial composition and richness as well as relative abundances of Bd-inhibitory bacteria (Fig. 7, Fig. S3). A total of 1645 bacterial amplicon sequence variants (ASVs) were identified from 20 bacterial phyla, seven of which were predominant (Fig. 7A). Of these, Verrucomicrobiota were only present on uninfected animals, whereas Acidobacteriota was only seen after 21 dpi on both control and mast cell-enriched, infected animals (Fig. 7A).

Cutaneous mast cells protect skin microbial communities.
Control (r-ctrl-injected) or mast cell-enriched (rSCF-injected) X. laevis were mock-infected or challenged with Bd for 21 days. (A) Microbial phyla distribution across groups. Low abundance phyla (< 5% relative abundance are not shown). At 10 dpi (B) community composition (Jaccard distances shown with 80% confidence ellipses) differed among all treatments. (C) Relative abundance of Bd-inhibitory bacteria and (D) bacterial richness were examined in control and mast cell enriched frogs, 10 days post Bd or mock challenge. Letters above bars indicate statistically different groups.
At 10 dpi, mast cell-enrichment resulted in a nominal shift in community composition compared to control frogs (Fig. 7B). Notably, while control, Bd-infected animals exhibited a drastic shift in community composition, mast cell-enriched animals possessed substantially less deviated community composition (Fig. 7B), suggesting that these cells are somehow counteracting the adverse effects of Bd on microbiome structure. These mast cell-mediated effects persisted to 21 dpi (Fig. S3A).
At 10 dpi, mast cell-enriched and mock-infected frogs possessed significantly greater abundance of Bd-inhibitory bacteria such as Chyrseobacterium sp., compared to control, mock infected animals (Fig. 7C)42. This suggests that mast cells may promote skin flora composition that is more antifungal. Control (non-enriched) Bd-infected frogs possessed significantly greater abundance of Bd-inhibitory bacteria than all other treatment groups (Fig. 7C). While mast cell-enriched, Bd-infected frogs had lower abundance of Bd-inhibitory bacteria than control infected frogs, they possessed higher abundance of inhibitory taxa than uninfected control animals (Fig. 7C). The Bd-inhibitory bacteria seen in greater abundance on mast cell-enriched, Bd-infected animals, included Roseateles sp., Flavobacterium sp., and Kaistia sp. We did not see significant differences in Bd-inhibitory bacteria across the treatment groups at 21 dpi (Fig. S3B).
Mast cell-enriched uninfected frogs exhibited increased frog skin bacterial richness at 10 dpi (Fig. 7D). While control Bd-infected animals exhibited significantly reduced skin microbial richness, mast cell-enriched Bd-infected frogs did not exhibit such a reduction in bacterial richness (Fig. 7D), supporting the idea that mast cells may be counteracting the adverse effects of Bd on skin microbiome composition.
Frog mast cells alter skin antimicrobial peptide gene expression
Amphibians rely heavily on skin-produced antimicrobial peptides (AMPs) for antifungal protection43, and mast cells produce antimicrobial AMPs44. We thus examined whether mast cells could be sources of such AMPs during Bd infections. As anticipated, Bd-challenged mast cells, but not Bd-challenged neutrophils upregulated their expression of the AMP-encoding genes, pgla and magainin (mag, Fig. 8A).

The roles of IL4 in mast cell-mediated skin anti-Bd protection.
(A) Mast cells and neutrophils derived from bone marrow of 6 individual frogs (N=6) were co-cultured with Bd (5 fungal cells per granulocyte) for 6 hrs prior to gene expression analyses of the antimicrobial peptide genes PGLa (pgla) and magainin (mag) or interleukin-4 (il4). (B) Il4 gene expression in skins of control and mast cell-enriched, mock- or Bd-infected animals, N=6. Representative images of frogs administered with (C) r-ctrl or (D) rIL4 and infected with Bd for 21 days, N=7. Ep: epidermis; m: mucus gland. Means + SEM of (E) percent mucus gland filling, (F) skin Bd loads, (G) epidermal thickness and (H) mpo-positive neutrophils, per field of view of r-ctrl- and rSCF-administered, mock- or Bd-challenged frog skins 21 dpi, (N=7). Representative images of mpo-positive neutrophils in (I) control and (J) rIL4-treated frog skins, 21 dpi. Ep: epidermis; arrows: mpo-positive neutrophils. Asterisks indicate significance: p < 0.05 by one-way ANOVA with Tukey post-hoc analysis.
To follow up these observations in vivo, we examined pgla and mag gene expression in the skins of mast cell-enriched and Bd-challenged animals. Compared to control (r-ctrl) animals, mast cell-enriched frogs did not have elevated mRNA levels of mag or pgla after 12 hrs of rSCF administration (Fig. S4A&B). After 10 days of mock-infection, mast cell-enriched animals possessed significantly greater skin expression of mag and pgla than control animals (Fig. S4A&B). We did not see significant differences in skin mag or pgla gene expression between Bd-challenged control and mast cell-enriched frogs after 10 dpi (Fig. S4). By 21 days of challenge, the rSCF-administered mock-infected frogs possessed lower gene expression levels of both AMPs (significantly so for pgla, Fig. S4A&B), possibly due to some sort of compensatory effect. At 21 dpi, mast cell-enriched frog skins had greater (albeit not significantly so) pgla expression than control frogs (Fig. S4B).
Frog mast cell-expressed interleukin-4 confers anti-Bd protection
Mammalian mast cells are recognized as potent producers of the pleotropic anti-inflammatory cytokine, interleukin-4 (il4)45. Notably, X. laevis mast cells challenged in vitro with Bd significantly upregulated their il4 gene expression, whereas almost no il4 expression was detected from either unstimulated or Bd-challenged neutrophils (Fig. 8A).
When we examined the expression of il4 in the skin of control and mast cell-enriched animals, we found that 12 hours following rSCF administration (time of Bd challenge), the mast cell enriched frog skins possessed significantly greater transcripts of il4 than control animals (Fig. 8B). By 10 and 21 dpi, both control and mast cell-enriched mock-infected animals possessed baseline skin il4 expression (Fig. 8B). At 10 days of Bd infection, control animals possessed increased (not significantly) skin il4 gene expression whereas mast cell-enriched frog skins had significantly elevated il4 transcript levels (Fig. 8B). By 21 dpi, Bd-infected control animals had baseline skin il4 expression and the mast cell enriched animals had elevated, albeit not significant expression of this cytokine gene in their skins (Fig. 8B).
To examine whether IL4 could confer the anti-Bd effects seen following frog skin mast cell enrichment, we produced this X. laevis cytokine in recombinant form (rIL4) and confirmed that subcutaneous injection of rIL4 augmented expression of genes typically activated by the mammalian IL446 (cd36, metalloproteinase inhibitor 3-timp3, and monoamine oxidase A-maoa; Fig. S5A).
We next administered frogs subcutaneously with rIL4 or r-ctrl, challenged them with Bd and examined the key parameters affected by skin mast cell-enrichment, including skin mucus gland filling, skin Bd loads, and reduction in Bd-associated skin inflammation. When we examined the mucus content of control and rIL4-administered animals, we found that frogs treated with rIL4 possessed greater skin mucus gland filling than control animals and irrespective of mock- or Bd-challenge (Fig. 8C-E). At 21 dpi (but not at 10 dpi), rIL4-administered frogs possessed significantly lower skin Bd loads (Fig. 8F) and exhibited significantly less epidermal thickening (Fig. 8C,D,G) and less neutrophil infiltration (Fig. 8H-J) than control animals. Conversely, subcutaneous administration of rIL4 to animals with active Bd-infection did not alter their fungal loads (Fig. S5B), suggesting a critical point during which IL4 may offer protection against this fungal pathogen.
Discussion
Amphibian extinction rates far outpace those of any other vertebrate class47. It is now well-established that chytrid fungi are major contributors to these declines, and strikingly, are considered the greatest infectious disease threat to biodivsersity48. The development of effective mitigation strategies though, is hindered by incomplete understanding of amphibian immune defenses and skin integrity. In this respect, while mast cells are recognized as key immune sentinels of tissues such as skin49, relatively little is known about this cell lineage outside of mammals. Our findings provide the first in-depth functional analyses of these cells in amphibians and explore their protective mechanisms during chytrid infections. This work presents a unique perspective on the evolution of mast cell functionality and will serve as a new avenue to explore ways to counteract the amphibian declines.
Mammalian mast cells are potent producers of the pleotropic anti-inflammatory interleukin-4 (IL4)45 cytokine and our findings suggest that this is also true of frog mast cells. In mammals, IL4 also plays roles in tissue repair17 and mucus production by intestinal goblet cells50, which aids in the ‘weep and sweep’ pathogen elimination and may contribute to the maintenance of commensal communities in the gut51. This is consistent with our findings, which suggest that IL4 may be a central means by which frog mast cells confer protection against Bd, by counteracting Bd-elicited inflammation, including minimizing neutrophil infiltration, maintaining skin integrity, and promoting mucus production by skin mucus glands. The outcomes of cytokine signaling are critically dependent on timing, locations, and context50. This possibly explains why administering rIL4 prior to Bd challenge results in significant anti-Bd protection whereas treating already infected animals with this cytokine did not reduce fungal loads.
We anticipate that in addition to IL4 production, frog mast cells confer the observed antifungal protection through a myriad of additional mechanisms. Indeed, we observed elevated expression of antimicrobial peptide genes in the skins of mock-infected mast cell-enriched frogs 10 days after rSCF administration. The fact that we did not see the same expression patterns following Bd challenge could potentially reflect the highly immunomodulatory capacities of this pathogen52. Undoubtedly, frog skin-resident mast cells have evolved to contribute to and modulate skin antifungal antimicrobial peptide production just as Bd has undoubtedly coevolved to target this aspect of amphibian skin defenses.
Bd infections caused major reductions in bacterial taxa richness, changes in composition and substantial increases in the relative abundance of Bd-inhibitory bacteria early in the infection. Similar changes to microbiome structure occur during experimental Bd infections, such as in red-backed salamanders and mountain yellow-legged frogs8, 53. In turn, progressing Bd infections corresponded with a return to baseline levels of Bd-inhibitory bacteria abundance and rebounding microbial richness, albeit with dissimilar communities to those seen in control animals. These temporal changes indicate that amphibian microbiomes are dynamic, as are the effects of Bd infections on them. Indeed, Bd infections may have long-lasting impacts on amphibian microbiomes8, including the possible establishment of ‘ecological memory’, resulting in greater adaptation to subsequent pathogen exposures9, 54. While Bd infections manifested in these considerable changes to frog skin microbiome structure, mast cell enrichment appeared to counteract the deleterious effects to their microbial composition. It will thus be interesting to learn from future studies how frog mast cells impact skin microbiome ecological memory. Presumably, the greater skin mucosal integrity and mucus production observed after mast cell enrichment served to stabilize the cutaneous environment during Bd infections, thereby ameliorating the Bd-mediated microbiome changes. While this work explored the changes in established antifungal flora, we anticipate the mast cell-mediated inhibition of Bd may be due to additional, yet unidentified bacterial, viral, or fungal taxa. Intriguingly, while mammalian skin mast cell functionality depends on microbiome elicited SCF production by keratinocytes55, our results indicate that frog skin mast cells in turn impact skin microbiome structure and likely their function. It will be interesting to further explore the interdependent nature of amphibian skin microbiomes and resident mast cells.
In contrast to the mast cell-mediated effects, enrichment of neutrophils seemed to result in greater Bd skin burdens. This suggests that neutrophils may result in a greater level of inflammation, which is not protective in the context of Bd infections. This is consistent with other studies that suggest that a strong immune response in the skin compartment of some species may be detrimental56, 57.
Amphibian skin is much thinner and more permeable than that of mammals7, and as such, arguably represents a more penetrable barrier to pathogens. Because mammalian skin is relatively impermeable, mast cells are absent from healthy mammalian epidermises and are instead found exclusively in their dermal layers58. However, mammalian mast cells may infiltrate the skin epidermal layer during diseases such as dermatitis59. In contrast, we showed here and have observed across several classes of amphibians16 that mast cells are found in both epidermal and dermal layers. This localization has presumably evolved to support the more intimate contact between amphibian skin and their environments. Considering the importance of amphibian cutaneous integrity to their physiology60, it is likely that skin-resident mast cells co-evolved to support skin immunity, physiology, and symbiotic microbiota. Ongoing research continues to reveal functional differences between mammalian connective tissue and mucosa-resident mast cells61, and we suspect that there is similarly much to learn about the distinct physiological and immune roles of amphibian epidermal and dermal mast cells.
Mammalian mast cells are thought to arise from two distinct lineages. Fetal-derived progenitors seed peripheral tissues during the neonatal life62 and mature into long-lived connective tissue mast cells (CTMCs)63. Conversely, inducible mucosal mast cells (MMCs) arise from bone marrow–derived mast cell progenitors (MCps) and are recruited to mucosal tissues in response to inflammation64, 65. The connective tissue mast cells are thought to possess significantly greater levels of heparin than bone marrow-derived mast cells66. Interestingly, the in vitro frog bone marrow-derived mast cells possessed substantially lower heparin content than what we observed in the skin-resident and Bd-recruited mast cells. Unlike the mammalian skin, frog skin is both a connective tissue and a mucosal barrier, begging the question of how the frog skin mast cells compare to the mammalian CTMCs and MMCs. It is interesting to consider that frog skin mast cells observed at steady state, following rSCF-enrichment, and recruited/expanded in response to Bd, all had substantial heparin levels. Possibly, the expansion of frog skin mast cell numbers in response to both rSCF and Bd is facilitated by skin-resident precursors, explaining the high heparin content observed in these populations. Of course, it is equally possible that amphibian mast cell ontogeny and heparin content are not the same as mammals. It will be invaluable to learn with future studies the origins, fates and immune consequences of distinct frog skin mast cell lineages and subsets.
It has become apparent that amphibian host-Bd interactions are highly complex and multifaceted while different amphibian species exhibit marked differences in their susceptibilities to this devastating pathogen2, 4. The findings described here emphasize the importance of skin-resident mast cells for successful anti-Bd defenses and demonstrate that these immune sentinels are intimately linked to many aspects of frog skin physiology. Our results indicate that when mast cells are enriched, the ensuing changes in the skin allow for greater resistance to infection by developing zoospores. Presumably, distinct amphibian species have evolved disparate interconnections between their skin mast cells and their cutaneous defenses, as dictated by their respective physiological and environmental pressures. In turn, these species-specific differences likely dictate whether and to what extent the skin-resident mast cells of a given amphibian species recognize and appropriately respond to Bd infections. We postulate that such differences may contribute to the differences in susceptibilities of amphibian species to pathogens like chytrid fungi. Greater understanding of these relationships across disparate amphibian species holds promise of harnessing this knowledge towards possible development of preventative and therapeutic strategies against infectious diseases like chytridiomycosis.
Methods
Animals
Outbred 1 year-old (1.5-2”), mixed sex X. laevis were purchased from Xenopus 1 (Dexter, MI). All animals were housed and handled under strict laboratory regulations as per GWU IACUC (Approval number 15-024).
Recombinant cytokines and bone marrow granulocyte cultures
The X. laevis rSCF, rCSF3 and rIL4 were generated as previously described for rCSF367 and as detailed in the supplemental materials.
Bone marrow isolation, culture conditions, and establishment of neutrophil cultures have been previously described68. Mast cell cultures were generated according to protocols adapted from Koubourli et al. (2018) and Meurer et al. (2016) 69, 70. Isolated bone marrow cells were treated with 250 ng/µl of rSCF on Day 0, Day 4, Day 7, and collected for further analysis on Day 9. Cell cultures were maintained at 27°C with 5% CO2 in amphibian medium supplemented with 10% fetal bovine serum and 0.25% X. laevis serum. Neutrophil-like granulocytes were generated as above but with 250 ng/µl of rCSF3 on Day 0, Day 3, and collected for further analysis on Day 5. Cell cultures were maintained at 27°C with 5% CO2 in amphibian serum-free medium supplemented with 10% fetal bovine serum, 0.25% X. laevis serum, 10 μg/mL gentamicin (Thermo Fisher Scientific, Waltham, Massachusetts, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco, Thermo Fisher Scientific).
Enrichment of skin granulocyte subsets
Animals were subcutaneously injected between the skin and muscle layers with 5 µg/animal of rSCF, rCSF3, or r-ctrl in 5 µL of saline using finely pulled glass needles. Optimal time course and dose for in vivo mast cell and neutrophil enrichment were determined during preliminary experiments.
Recombinant interleukin-4 treatment
The capacity of the recombinant interleukin-4 (rIL4) to induce expression of genes associated with mammalian IL4 responses were assessed by injecting frogs (N=6 per treatment group subcutaneously with rIL4 (5 µg/animal) or r-ctrl in 5 µl of saline. After 6hrs, animals were sacrificed, and skins were isolated for gene expression analyses.
To examine the effect of rIL4 on Bd loads, frogs were infected with Bd by water bath (105 zoospores/mL) as described below and 1 day later injected subcutaneously, dorsally with rIL4 (5 µg/animal) or r-ctrl in 5 µl of saline. After an additional 9 days of infection, animals were sacrificed and their dorsal skin Bd loads examined.
Bd stocks and fungal challenge
Bd isolate JEL 197 was grown in 1% tryptone broth or on 1% tryptone agar plates (Difco Laboratories, Detroit, MI) supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin (Gibco) at 19°C.
In vitro Bd killing was evaluated by incubating live Bd (maturing zoosporangia) with mast cells or neutrophils at ratios of 5:1 or 1:1 Bd cells per granulocyte. Cells were incubated at 27°C for three days before fungal loads were analyzed by absolute qPCR. Experimental groups were compared to pathogen DNA amounts derived from equal quantities of live Bd plated alone in otherwise identical conditions.
For in vivo infection studies, zoospores were harvested by flooding confluent tryptone agar plates with 2 mL sterile A-PBS for 10 minutes. Twelve hours post rSCF, rCSF3, rIL4, or r-ctrl injection, animals were infected with 107 zoospores or mock-infected in 100 mL of water (105 zoospores/mL). After 3 hrs, 400 mL of water was added to each tank. Skins were collected for histology and gene expression analyses on 1, 10, and 21 dpi with 10 and 21 dpi representing intermediate and later timepoints of infection, respectively.
Histology
Leukocyte cytology and cutaneous SE staining has been described67 and is detailed in the supplemental materials. An Alcian Blue/PAS staining kit (Newcomer Supply, Middleton, WI) was used to quantify mucin content. Histology is detailed in the supplemental materials.
Electron Microscopy
Processing and imaging of cells for transmission and scanning electron microscopy (TEM and SEM) was conducted at the GWU Nanofabrication and Imaging Center (GWNIC). For transmission electron microscopy, cells were fixed as monolayers on six-well plates with 2.5% glutaraldehyde and 1% paraformaldehyde in 0.1 M sodium cacodylate buffer for one hour. Cells were treated with 1% osmium tetroxide in 0.1 M sodium cacodylate buffer for 1 hr. Following washes, cells were en bloc stained with 1% uranyl acetate in water overnight at 4°C. Samples were dehydrated through an ethanol series and embedded in epoxy resin using LX112. Inverted Beem capsules were placed into each tissue culture well to create on face blockfaces for sectioning. Resin was cured for 48 hrs at 60°C. The 95 nm sections were post-stained with 1% aqueous uranyl acetate and Reynold’s lead citrate. All imaging was performed at 80 KV in a Talos 200X transmission electron microscope (Thermo Fisher Scientific, Hillsboro, OR).
For SEM, cells were fixed with 2.5% glutaraldehyde / 1% paraformaldehyde in Sodium cacodylate buffer, followed by 1% OsO4, then dehydrated through an ethyl alcohol series. Coverslips were critical point dried and coated with 2 nm iridium. Cells were imaged using a Teneo Scanning Electron Microscope (Thermo Fisher Scientific).
Analyses of immune gene expression and Bd skin loads
These analyses have been described67 and are detailed in supplemental materials.
RNA sequencing
For transcriptomic profiling, bone marrow-derived neutrophil and mast cell cultures were generated as described above and FACS-sorted according to preestablished size and internal complexity parameters to isolate the respective subsets for further analyses. Sorted cells were immediately processed to extract and purify RNA. Flash frozen samples were sent to Azenta Life Sciences for all library preparation, RNA sequencing, and analyses. In short, polyadenylated RNA was isolated using Oligo dT beads. Enriched mRNAs were then fragmented for first and second strand cDNA synthesis. cDNA fragments were end repaired, 5’ phosphorylated, and dA-tailed. Fragments were then ligated to universal adaptors and PCR-amplified. 150-bp paired-end sequencing was performed on an Illumina HiSeq platform.
FastQC was used to evaluate raw data quality. Adaptors sequences and poor-quality nucleotides were removed from reads using Trimmomatic v.0.36. The STAR aligner v.2.55.2b was used to map these reads to the Xenopus_laevis_9_2 reference genome from ENSEMBL. To determine differential gene expression, featureCount (Subread package v.1.5.2) was first used to count unique gene hits, which were then used with DESeq2 to calculate absolute log2-fold change.
Skin microbiome analyses
Towards microbiome studies, frogs were housed individually (N=6/treatment group). At indicated times, frogs were gently rinsed with sterile deionized water to remove transient microbes and gently swabbed 20 times, dorsally. Genomic DNA was extracted from swabs using a PowerSoil Pro kit on a Qiacube HT (QIAGEN, MD). One-step PCR library prep and dual-index paired-end Illumina sequencing was used to sequence the skin microbiome of individual frogs. A ∼380 base pair region in the V3-V5 region of the 16S rRNA gene using the universal primers 515F-Y (GTGYCAGCMGCCGCGGTAA) and 939R (CTTGTGCGGGCCCCCGTCAATTC) was used for amplification. Negative and positive controls (ZymoBIOMICS D6300 & D6305, Zymo, CA) were included in each round of extraction and PCR. Reactions were done in duplicate for each sample, pooled, cleaned with in-house Speed-beads (in a PEG/NaCl buffer), quantified with a Qubit4 (Invitrogen, MA) and pooled into a final library in equimolar proportion. The pooled library was sequenced on two Illumina MiSeq runs (v3 chemistry: 2×300 bp kit) at the Center for Conservation Genomics, Smithsonian National Zoo & Conservation Biology Institute.
Analyses were performed in the R environment version 4.0.3 (R Core Team, 2020) using methods detailed in the supplemental materials.
Statistical analyses
Differences in transcript expression were calculated with one-way or multi-way ANOVAs followed by Tukey post-hoc tests. Student’s t-tests were used to determine differences in Bd loads between treatments only. Statistical differences in mucin content and mucosome Bd-killing were assessed with the two-way ANOVA calculator available online through Statistics Kingdom. For RNA sequencing, p-values were calculated with the Wald test and were adjusted using the Benjamini-Hochberge procedure.
Acknowledgements
We thank Dr. Cynthia S. Dowd and Ben England (Chemistry Department, GWU) for their help with X. laevis mucus lyophilization. We thank Dr. Christine Brantner (GWU Nanofabrication and imaging center) for assistance with TEM and SEM imaging. KAH, MRHH, and AY were supported by Wilbur V. Harlan summer graduate research fellowships. We thank Dr. Alexander Jeremic (GWU) for access to and use of his confocal microscope. We thank Dr. Gregory Cresswell (GWU) for his help with flow cytometry and cell sorting. KAH, MRHH, NR, NK, AY, MZ, and LG thank the GWU Biology Department. We thank the three anonymous reviewers whose insightful comments and suggestions helped to improve the scope and breadth of this manuscript.
Funding
National Science Foundation grant 2131061 (LG, CRMW)
National Science Foundation grant 2147466 (LG)
National Science Foundation grant 2147467 (LAR-S)
Author contributions
Conceptualization: KAH, LG
Methodology: KAH, CNG, RSC, MRHH, DTH, NR, LKG, AY, NK, MZ, EJJ, AND, LAR-S, CRMW, LG
Investigation: KAH, CNG, RSC, MRHH, DTH, NR, LKG, AY, NK, MZ, EJJ, AND, LAR-S, CRMW, LG
Visualization: KAH, CNG, RSC, EJJ, AND, LG
Funding acquisition: LG, CRMW, LAR-S
Project administration: LG
Supervision: LG, CRMW, LAR-S
Writing – original draft: KAH, LAR-S, CRMW, LG
Writing – review & editing: KAH, LAR-S, CRMW, LG
Competing interests
The authors declare no competing interests.
Data and materials availability
All data are available in the main text or the supplementary materials.
Supplementary materials
Production of recombinant cytokines
The X. laevis SCF and CSF3 sequences representing the signal peptide-cleaved transcripts were ligated into the pMIB/V5 His A insect expression vectors (Invitrogen). SCF-ligated, CSF3-ligated, or empty vectors were transfected into Sf9 insect cells (cellfectin II, Invitrogen). Recombinant proteins contain a V5 epitope, and western blot with an anti-V5-HRP antibody (Sigma) confirmed their presence. Positive transfectants were selected using 10 μg/mL blasticidin (Gibco). Expression cultures were scaled up to 500 mL liquid cultures, grown for 5 days, pelleted by centrifugation, and the supernatants collected. Supernatants were dialyzed overnight at 4°C against 150 mM sodium phosphate, concentrated against polyethylene glycol flakes (8 kDa) at 4°C, dialyzed overnight at 4°C against 150 mM sodium phosphate, and passed through Ni-NTA agarose columns (Qiagen). Columns were washed with 2 × 10 volumes of high stringency wash buffer (0.5% Tween 20, 50 mM Sodium Phosphate, 500 mM Sodium Chloride, 100 mM Imidazole) and 5 × 10 volumes of low stringency wash buffer (as above but with 40 mM Imidazole). Recombinant proteins were eluted with 250 mM imidazole. After recombinant protein purification, a halt protease inhibitor cocktail (containing AEBSF, aprotinin, bestatin, E-64, leupeptin and pepstatin A; Thermo Scientific) was added. Intact recombinant protein presence was confirmed again by western blot and the protein concentrations quantified by Bradford protein assays (BioRad). Protein aliquots were stored at −20°C until use.
Bone marrow granulocyte cultures
Bone marrow cells were isolated as previously described 68. Briefly, adult X. laevis (approximately one year old) were euthanized in 5% tricaine mesylate followed by cervical dislocation. Femurs were removed and washed in ice-cold Amphibian-PBS (A-PBS) in sterile conditions. Each femur was flushed with 5 mL of A-PBS. Red blood cells were removed from culture via a differential gradient generated with 51% Percoll. Bone marrow cell counts were generated using trypan blue exclusion and cells were seeded at a density of 104 cells/well for gene expression experiments, 5×104 cells/well for histology analyses, and 105 cells/well for electron microscopy analyses.
Histology
Paraffin-embedded tissue sections (5 μm) were deparaffinized, rehydrated through A-PBS, and stained with Naphthol AS-D Chloroacetate (specific esterase; Sigma) or Alcian Blue/PAS (Newcomer, Middleton, WI) according to the manufacturers’ instructions and optimized for Xenopus skin tissues. Cells collected from in vitro cultures were cytocentrifuged onto glass microscope slides (VWR). Cells were stained immediately with Giemsa (Sigma) for 7 minutes or fixed with 10% neutral buffered formalin for 30 minutes and stained with specific esterase according to the manufacturers’ instructions. Slides stained with Alcian Blue/PAS (Newcomer) were used to quantify mucin content from in vivo experiments. Images were taken using identical microscope settings under 20x magnification. Images were converted to 8-bit in Fiji by ImageJ and threshold adjusted such that positive staining for mucus was captured within the mucus glands (threshold held constant across images). The percentage of each mucus gland positively stained and the average percent-positive per field of view were subsequently calculated. Positive staining of both acidic and neutral mucins was included in analyses. ImageJ was also used for epidermal thickness analyses, using scale bars in the images to calibrate and measure epidermal thickness. All slides were imaged with a Leica DMi8 Inverted Fluorescent Microscope with all mucus glands assessed for each respective frog skin section (Leica Microsystems, Davie, FL).
An RNAScope ISH Kit (ACD Bio) and a X. laevis myeloperoxidase (mpo)-specific probe (ACD Bio) were used according to manufacturer’s instructions to visualize mpo-positive neutrophils in frog skin tissues.
Towards avidin staining, skin tissues were fixed in 4% paraformaldehyde, washed with saline, cryo-protected in 15% then 30% sucrose, flash-frozen in optimal cutting temperature (OCT) compound (Fisher) and cryo-sectioned onto microscope slides (Fisher). Frozen sections were stained with Texas red-conjugated avidin (ThermoFisher) and DAPI (ThermoFisher) and glass cover slips mounted with Prolong Antifade mounting media (ThermoFisher). Tissues were imaged using a Zeiss LSCM-800 confocal microscope. For each slide, 15 fields of view were enumerated at ×20 (Plan-Apochromat 20×/0.75) objective. Images were inversed in ImageJ to improve contrast and resolution of heparin-positive skin mast cells.
Analyses of immune gene expression and Bd skin loads
Cells and tissues were homogenized in Trizol reagent, flash frozen on dry ice, and stored at −80°C until RNA and DNA isolation. RNA isolation was performed using Trizol according to the manufacturer’s directions. RNA-Seq is described in detail below. For qRT-PCR gene expression analysis, RNA (500 ng/sample) was reverse transcribed into cDNA using cDNA qscript supermix (Quantabio, Beverly, MA). Following RNA extraction, back extraction buffer (4 M guanidinethiocyanate, 50 mM sodium citrate, 1 M Tris pH 8.0) was mixed with the remaining Trizol layer and centrifuged to isolate the DNA-containing aqueous phase. DNA was precipitated overnight with isopropanol, pelleted by centrifugation, washed with 80% ethanol, and resuspended in TE buffer (10 mM Tris pH 8.0, 1 mM EDTA). DNA was purified by phenol:chloroform extraction and resuspended in molecular grade water (VWR).
Quantitative gene expression analyses for both Bd and X. laevis cells and tissues were performed using the CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, CA) and iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The Bio-Rad CFX Manager software (SDS) was employed for all expression analysis. All expression analyses were conducted using the ΔΔCt method relative to the gapdh endogenous control gene for X. laevis. Fungal load quantification was assessed by absolute qPCR. Isolated Bd DNA (JEL 197 isolate) was serially diluted and used as the standard curve. Primers were designed and validated against the Bd ribosomal RNA internal transcribed spacer 1 (ITS1). The primers used are listed in Table S1.
Analyses of mucus Bd-killing capacities
Mucosomes were collected from mast cell- or vector-enriched X. laevis that were either mock- or Bd-infected for 10 or 21 days. To this end, individual X. laevis were soaked in a 5 mL water bath for 1 hour. Each water sample was then lyophilized, reconstituted with 500 µl of molecular grade water, and passed through a sterile cell strainer to remove large debris.
Bd was seeded in opaque white 96-well plates (20,000 zoospores in 50 µl of tryptone broth / well). Next, 50 µl of mucosome solution was added to each well (100 µl total well volume) in three replicate wells per individual X. laevis mucosome. Mucosomes, tryptone broth, and water were each plated alone as controls. Plates were sealed with parafilm and incubated at 19°C for 16 hrs with gentle mixing (20 rpm).
Zoospore viability was determined with the CellTiter-Glo 2.0 Cell Viability assay kit (Promega) according to the manufacturer’s instructions and using a SpectraMax plate reader (Molecular Devices, San Jose, CA). Luminescence readings were fitted to a standard curve (descending proportions of heat-killed zoospores to viable zoospores) to calculate the number of viable zoospores in each well. Zoospores were heated-killed at 65°C for 15 mins.
Skin microbiome analyses
All analyses were performed in the R environment version 4.0.3 (R Core Team, 2020). Demultiplexed reads were imported from Basespace into R environment for sequence processing. Package “dada2”71 was used to perform quality filtering using their standard filtering parameters (i.e., maxEE = 2), which collapsed high quality reads into amplicon sequence variant (ASV) and removed chimeras. Bacterial taxonomy was assigned using Silva version 138.1. The R package “phyloseq”72 was used to import and merge the final ASV table, taxonomy table, and metadata to create a phyloseq object to perform further analyses. Sequences classified as cyanobacteria/chloroplast and those unclassified at kingdom were removed. Singletons were filtered out (i.e., ASVs with only one sequence read in one individual). The R package “decontam”73 was used to remove potential contaminants using the method “combined.” The ZymoBIOMICS microbial community standards (positive controls) were analyzed, and we found genera in similar relative abundances as described by Zymo.
To determine how Bd and mast cell treatments impacted skin microbiomes, the microbiome structure was examined. The components of microbiome structure were: ASV richness (measured as Bd-inhibitory ASV richness and total ASV richness), microbial composition (measured by Jaccard and Bray-Curtis distances), and sequence abundance of Bd-inhibitory ASVs (measured as individual Bd-inhibitory ASV sequence counts and total relative abundance of Bd-inhibitory ASVs). To characterize variation in microbiome structure, Mast Cell (mast cell normal and mast cell+), Bd (Bd- and Bd+) and their interaction as explanatory variables at two-time points Day 10 and Day 21 post Bd infection were included. For this characterization, log-transformed ASV richness in ANOVAs, microbial composition measures in PERMANOVAs and log-transformed raw sequence counts in ANOVAs (with post-hoc corrections for multiple comparisons) were used. For identification of Bd-inhibitory ASVs, methods as described in by Jimenez et al., 202274 were followed.
Days 10 and 21 post Bd infection were chose for these analyses, since they represent an intermediate and a later timepoint of infection.

List of primer sequences

Enrichment of neutrophils in frog skins.
Frogs were administered with rCSF3 subcutaneously and their skins examined for specific esterase activity at 0, 6, 12 and 24 hrs post injection. Results are means + SEM of SE-positive cells per field of view from 4 animals per time point (N=4). Asterisks indicate significance: p < 0.05 by one-way ANOVA with Tukey post-hoc analysis.

Mucosomes from mast cell-enriched frogs do not confer Bd killing.
Differences in musocome-killing capacities were determined by incubating zoospores with total mucosome contents for 16 hrs. Mucosomes were acquired from 10- or 21-day mock- or Bd-infected X. laevis that were injected with rSCF (mast cell-enriched) or r-ctrl (control). Results are mean + SEM and were analyzed via a two-way ANOVA; 10- and 21-day experimental groups were analyzed independently; alpha set at 0.05. N = 5 experimental animals per treatment group for 10 dpi analyses and N= 8 experimental animals per treatment group for 21 dpi analyses.

Mast cell enrichment protects frogs from Bd-mediated changes to skin microbiomes.
At 21 days post mock or Bd-challenge, we examined (A) community composition (Jaccard distances shown with 80% confidence ellipses), (F) relative abundance of Bd-inhibitory bacteria and (G) bacterial richness. Letters above bars indicate statistically distinct groups.

Expression of antimicrobial peptides in mast cell-enriched, Bd-infected frog skins.
(A) Magainin (mag) and (B) pgla expression was examined in control and mast cell-enriched frog skins after 12 hrs of enrichment or after 10 or 21 days of mock- or Bd-challenge, N=6. Asterisks indicate significance: p < 0.05 by one-way ANOVA with Tukey post-hoc analysis.

IL4 elicits hallmark gene expression but does not protect Bd-infected frogs.
(A) Expression of selected genes in skin following subcutaneous injection of rIL4 (N=7). (B) Frogs were exposed to Bd and 24 hrs later injected subcutaneously with rIL4 or r-ctrl. Skin Bd loads were assessed 9 days following injection (N=8, per group). Asterisks denote statistical significance, p < 0.05 via ANOVA with Tukey post-hoc analysis.
References
- 1.Wildlife disease. Recent introduction of a chytrid fungus endangers Western Palearctic salamandersScience 346:630–631Google Scholar
- 2.Amphibian fungal panzootic causes catastrophic and ongoing loss of biodiversityScience 363:1459–1463Google Scholar
- 3.Amphibian chytridiomycosis: a review with focus on fungus-host interactionsVeterinary research 46:1–22Google Scholar
- 4.Development of in vitro models for a better understanding of the early pathogenesis of Batrachochytrium dendrobatidis infections in amphibiansAltern Lab Anim 38:519–528Google Scholar
- 5.Pathogenesis of chytridiomycosis, a cause of catastrophic amphibian declinesScience 326:582–585Google Scholar
- 6.The importance of antimicrobial peptides (AMPs) in amphibian skin defenseDev Comp Immunol 142:104657Google Scholar
- 7.Frog Skin Innate Immune Defences: Sensing and Surviving PathogensFront Immunol 9:3128Google Scholar
- 8.The amphibian microbiome exhibits poor resilience following pathogen-induced disturbanceISME J 15:1628–1640Google Scholar
- 9.The adaptive microbiome hypothesis and immune interactions in amphibian mucusDev Comp Immunol 104690Google Scholar
- 10.Toxins and pharmacologically active compounds from species of the family Bufonidae (Amphibia, Anura)J Ethnopharmacol 198:235–254Google Scholar
- 11.Review of the Amphibian Immune Response to Chytridiomycosis, and Future DirectionsFront Immunol 9:2536Google Scholar
- 12.Immune defenses of Xenopus laevis against Batrachochytrium dendrobatidisFront Biosci (Schol Ed) 1:68–91Google Scholar
- 13.Immune defenses against Batrachochytrium dendrobatidis, a fungus linked to global amphibian declines, in the South African clawed frog, Xenopus laevisInfect Immun 78:3981–3992Google Scholar
- 14.Amphibians acquire resistance to live and dead fungus overcoming fungal immunosuppressionNature 511:224–227Google Scholar
- 15.The multifaceted roles of mast cells in immune homeostasis, infections and cancersInternational Journal of Molecular Sciences 23:2249Google Scholar
- 16.Biology of amphibian granulocytes - From evolutionary pressures to functional consequencesDev Comp Immunol 140:104623Google Scholar
- 17.IL-4 and IL-13: Regulators and Effectors of Wound RepairAnnu Rev Immunol 41:229–254Google Scholar
- 18.Mast cell-restricted tryptases: structure and function in inflammation and pathogen defenseJournal of Biological Chemistry 282:20785–20789Google Scholar
- 19.Mast cell-orchestrated immunity to pathogensNature reviews.Immunology 10:440–452Google Scholar
- 20.Mast cells in nonmammalian vertebrates: an overviewInternational review of cell and molecular biology 290:1–53Google Scholar
- 21.Stem cell factor programs the mast cell activation phenotypeJ Immunol 188:5428–5437Google Scholar
- 22.The unique myelopoiesis strategy of the amphibian Xenopus laevisDevelopmental & Comparative Immunology 63:136–143Google Scholar
- 23.Signal transduction pathways activated by innate immunity in mast cells: translating sensing of changes into specific responsesCells 9:2411Google Scholar
- 24.Understanding mast cell heterogeneity at single cell resolutionTrends in Immunology 42:523–535Google Scholar
- 25.Regulation of emergency granulopoiesis during infectionFront Immunol 13:961601Google Scholar
- 26.Carboxypeptidase A3-A Key Component of the Protease Phenotype of Mast CellsCells 11Google Scholar
- 27.IDO activates regulatory T cells and blocks their conversion into Th17-like T cellsJ Immunol 183:2475–2483Google Scholar
- 28.Leukemia inhibitory factor is an anti-inflammatory and analgesic cytokineJ Neurosci 18:5456–5462Google Scholar
- 29.Mast Cell-Lineage Versus Basophil Lineage Involvement in Myeloproliferative and Myelodysplastic Syndromes: Diagnostic Role of Cell-Immunopheno typingLeukemia & lymphoma 22:187–204Google Scholar
- 30.Conjugated avidin binds to mast cell granulesJ Histochem Cytochem 33:27–32Google Scholar
- 31.Laminin 332 in junctional epidermolysis bullosaCell Adh Migr 7:135–141Google Scholar
- 32.B3GNT3 expression suppresses cell migration and invasion and predicts favorable outcomes in neuroblastomaCancer Sci 104:1600–1608Google Scholar
- 33.The role of connexins in human diseaseEar Hear 24:314–323Google Scholar
- 34.Trefoil factors: initiators of mucosal healingNat Rev Mol Cell Biol 4:721–732Google Scholar
- 35.Mechanisms and function of DUOX in epithelia of the lungAntioxid Redox Signal 11:2453–2465Google Scholar
- 36.Inhibition of Gabrp reduces the differentiation of airway epithelial progenitor cells into goblet cellsExp Ther Med 22:720Google Scholar
- 37.Neutrophils in tissue injury and repairCell Tissue Res 371:531–539Google Scholar
- 38.G-CSF: a key regulator of neutrophil production, but that’s not all!Growth Factors 23:33–41Google Scholar
- 39.Immune roles of amphibian (Xenopus laevis) tadpole granulocytes during Frog Virus 3 ranavirus infectionsDev Comp Immunol 72:112–118Google Scholar
- 40.The unique myelopoiesis strategy of the amphibian Xenopus laevisDev Comp Immunol 63:136–143Google Scholar
- 41.A transgenic zebrafish line for in vivo visualisation of neutrophil myeloperoxidasePLoS One 14:e0215592Google Scholar
- 42.Antifungal isolates database to centralize data on amphibian ski associated bacteria and their function against emerging fungal pathogens including Batrachochytrium dendrobatidisEcology 96:595Google Scholar
- 43.Antimicrobial peptides: amphibian host defense peptidesCurrent medicinal chemistry 26:5924–5946Google Scholar
- 44.Mast cell cathelicidin antimicrobial peptide prevents invasive group A Streptococcus infection of the skinJ Immunol 180:7565–7573Google Scholar
- 45.IL-4 and human skin mast cells revisited: reinforcement of a pro-allergic phenotype upon prolonged exposureArchives of dermatological research 308:665–670Google Scholar
- 46.IL-4 and IL-13 employ discrete signaling pathways for target gene expression in alternatively activated monocytes/macrophagesFree Radic Biol Med 54:1–16Google Scholar
- 47.https://www.iucnredlist.org/resources/summary-statistics, I.R.L.https://www.iucnredlist.org/resources/summary-statistics
- 48.Chytrid fungi and global amphibian declinesNature Reviews Microbiology 18:332–343Google Scholar
- 49.New perspectives on the origins and heterogeneity of mast cellsNature Reviews Immunology 23:55–68Google Scholar
- 50.Spatial regulation of IL-4 signalling in vivoCytokine 75:51–56Google Scholar
- 51.Bacteria Living in Biofilms in Fluids: Could Chemical Antibiofilm Pretreatment of Culture Represent a Paradigm Shift in Diagnostics?Microorganisms 12Google Scholar
- 52.Batrachochytrium fungi: stealth invaders in amphibian skinCurr Opin Microbiol 61:124–132Google Scholar
- 53.Fungal disease and temperature alter skin microbiome structure in an experimental salamander systemMol Ecol 28:2917–2931Google Scholar
- 54.Ecological memory of prior nutrient exposure in the human gut microbiomeISME J 16:2479–2490Google Scholar
- 55.Skin microbiome promotes mast cell maturation by triggering stem cell factor production in keratinocytesJ Allergy Clin Immunol 139:1205–1216Google Scholar
- 56.More than skin deep: functional genomic basis for resistance to amphibian chytridiomycosisGenome Biol Evol 7:286–298Google Scholar
- 57.Sustained immune activation is associated with susceptibility to the amphibian chytrid fungusMol Ecol 29:2889–2903Google Scholar
- 58.Distribution of mast cells in human dermis: development of a mapping techniqueBr J Dermatol 100:635–640Google Scholar
- 59.Epidermal mast cells in atopic dermatitisLancet 346:1559Google Scholar
- 60.Dual skin functions in amphibian osmoregulationComparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 253:110869Google Scholar
- 61.Mast cell tissue heterogeneity and specificity of immune cell recruitmentFront Immunol 13:932090Google Scholar
- 62.Hemogenic Endothelial Fate Mapping Reveals Dual Developmental Origin of Mast CellsImmunity 48:1160–1171Google Scholar
- 63.Expression profiling of constitutive mast cells reveals a unique identity within the immune systemNat Immunol 17:878–887Google Scholar
- 64.Maturation of mast cell progenitors to mucosal mast cells during allergic pulmonary inflammation in miceMucosal Immunol 8:596–606Google Scholar
- 65.Adult Connective Tissue-Resident Mast Cells Originate from Late Erythro-Myeloid ProgenitorsImmunity 49:640–653Google Scholar
- 66.Heparin is required for the formation of granules in connective tissue mast cellsFront Immunol 13:1000405Google Scholar
- 67.Discovery of granulocyte-lineage cells in the skin of the amphibian Xenopus laevisFACETS 5:571Google Scholar
- 68.Isolation and culture of amphibian (Xenopus laevis) sub-capsular liver and bone marrow cellsXenopus: Methods and Protocols :275–281Google Scholar
- 69.Amphibian (Xenopus laevis) interleukin-8 (CXCL8): a perspective on the evolutionary divergence of granulocyte chemotaxisFrontiers in immunology :2058Google Scholar
- 70.Isolation of mature (peritoneum-derived) mast cells and immature (bone marrow-derived) mast cell precursors from micePLoS One 11:e0158104Google Scholar
- 71.DADA2: High-resolution sample inference from Illumina amplicon dataNat Methods 13:581–583Google Scholar
- 72.phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census dataPLoS One 8:e61217Google Scholar
- 73.Simple statistical identification and removal of contaminant sequences in marker-gene and metagenomics dataMicrobiome 6:226Google Scholar
- 74.Inhibitory Bacterial Diversity and Mucosome Function Differentiate Susceptibility of Appalachian Salamanders to Chytrid Fungal InfectionAppl Environ Microbiol 88:e0181821Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.92168. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2023, Hauser et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,710
- downloads
- 171
- citations
- 6
Views, downloads and citations are aggregated across all versions of this paper published by eLife.