Introduction

Hepatocytes originate from bipotential hepatoblast progenitor cells during embryonic development under the control of signaling molecules including Wnt, Notch, HGF, and BMP(Pepe-Mooney et al., 2019; Russell & Monga, 2018; Segal et al., 2019; Siebel & Lendahl, 2017). They undergo zonation along the porto-central axis of the liver lobules, with different zones executing distinct metabolic functions(Aizarani et al., 2019; Halpern et al., 2017). For example, zone 1 (periportal) hepatocytes carry out mainly β-oxidation and gluconeogenesis; zone 3 (pericentral) hepatocytes carry out mainly glycolysis, lipogenesis, and drug detoxification; and zone 2 (midzone) hepatocytes show mixed activities(Ben-Moshe et al., 2019).

The liver is constantly exposed to viruses, bacteria, alcohol, and toxic agents brought in by nutrient-carrying blood from the gastrointestinal tracts, which damage the liver and increase the risk of hepatitis, cirrhosis, or liver cancer(Banales et al., 2019; Ramachandran et al., 2019; Romeo, 2019). In spite of slow hepatocyte turnover, mammalian livers have enormous regeneration capacities, for example, human liver can be fully regenerated within 4 months after 3/4 of the liver is removed(Bangru & Kalsotra, 2020). While stem/progenitor cells marked by Axin, Sox9, or Tert or generated from dedifferentiation of hepatocytes or cholangiocytes were initially suggested to drive liver homeostasis and regeneration(Ang et al., 2019; Font-Burgada et al., 2015; Lin et al., 2018; Miyajima et al., 2014; Pu et al., 2016; Raven et al., 2017; Sato et al., 2019; Wang et al., 2015), later studies showed that all hepatocytes undergo hypertrophic growth and hyperplasia, generating regenerative patches that help repair the liver stochastically and locally(Chen et al., 2020; Matsumoto et al., 2020; Sun et al., 2020). If all the hepatocytes are participating, they would need to divide only 2 times to recover the full liver mass in partial (2/3) hepatectomy (PHx) mouse models(Monga, 2020).

However, recent genetic studies show that liver homeostasis and regeneration are mainly executed by midzone hepatocytes(He et al., 2021; Wei et al., 2021). Most of the liver injuries occur to zone 1 or 3 and it is likely that zone 2 hepatocytes are protected from the damage (Andersson, 2021; Forbes & Newsome, 2016). However, to accomplish the regeneration task, midzone hepatocytes need not only to undergo massive expansion but also to repopulate zones 1 and 3. This presents a challenge as hepatocytes, the differentiated epithelial cells, in general have limited proliferation and migration capacities.

The liver also contains hepatic stellate cells (HSCs) and fibroblasts (designated mesenchymal cells (MCs) here)(Lua et al., 2014; Ramachandran et al., 2019), whose main function is secretion of extracellular matrix (ECM). Here, our lineage tracing experiments using 5 Cre lines driven by mesenchymal stromal cell (MSC) markers identified a mesenchymal-hepatocyte hybrid population (13.7% of total hepatocytes) that express signature genes of both lineages. They appear to be derived from Twist2-expressing hepatomesenchyme of early embryos and are mainly located in the midzone and highly polyploidy and display great proliferative and migratory abilities at the sacrifice of metabolism. During liver regeneration, these cells display proliferation rate 2-3 times greater than conventional hepatocytes and replenish zones 1 and 3, accompanied by conversion from polyploids to diploids. Overall, this small population of cells could regenerate about 50% of the new hepatocytes. Our gene ablation and pharmacological studies also elucidated an important mechanism by which expansion of these hybrid cells is controlled. Collectively, these findings identify a midzone-located mesenchymal-hepatocyte population as a major driving force of liver regeneration.

Results

Mesenchymal marker Twist2 labels a hepatocyte subpopulation

To understand the ontology of liver mesenchymal cells (MCs)(Lua et al., 2014), we crossed several Cre mouse lines, which are used to study bone marrow mesenchymal stromal cells (BM-MSCs), to Rosa-tdTomato reporter mice to fate map these lineages in the liver. We found that Col1α2, αSMA. Gli1, and Vimentin marked MCs, while surprisingly, Twist2 marked both MCs and a small portion of hepatocytes (Figure 1A). Twist2 is a helix-loop-helix transcription factor and Twist2-Cre mice are widely used to study skeletal development(Yu et al., 2003). Immunostaining showed that liver Tomato⁺ cells in Tomato^Twist2 mice were negative for CD31 (a blood vessel marker), CD45 (a Kupffer cell marker), and K19 (a bile duct cell marker) (Figure 1B). However, Tomato⁺ cells with hepatocyte morphology expressed hepatocyte marker Hnf4α; and 99% of Tomato⁺ non-hepatocyte cells expressed mesenchymal marker Vimentin and 26% expressed PDGFRα (Figure 1B and Figure S1A). On average, 36.4% of the liver MCs were Tomato⁺ in Tomato^Twist2 mice (Figure 1C). These results suggest that Twist2 genetically marks subpopulations of hepatocytes and MCs in mouse liver.

Fig. 1.

Ablation of one Twist2 allele in Twist2-Cre mice does not affect liver development or regeneration

In Twist2-Cre mice, one allele of Twist2 is disrupted due to insertion of the Cre cassette into the coding region(Yu et al., 2003). However, Twist2-Cre mice showed a normal liver weight-to-body weight (LW/BW) ratio and liver structure (Figure S1B,C). Immunostaining revealed no alteration in the numbers of Vimentin⁺ MCs or PCNA⁺ proliferating cells or activation of pro-proliferating pathways including ERK and mTOR in the liver of Twist2-Cre mice (Figure S1D). Moreover, the mice showed normal regeneration processes upon CCl₄-induced liver injury or partial (2/3) hepatectomy (PHx) (Figure S1E). Although Twist2 has been shown to promote or inhibit cell proliferation in different contexts(Zhang et al., 2015), we show here that deletion of one allele of Twist2 does not affect liver development, growth, or regeneration, suggesting that the Twist2-Cre mouse line can be safely used to study liver development or regeneration.

Twist2-lineage hepatocytes are derived from EpCAM⁺ progenitors postnatally

Analysis of Tomato^Twist2 mice of various ages revealed that Twist2 mainly marked non-hepatocyte cells in the liver at postnatal day 1 (P1) (Figure 1D), while Tomato⁺ hepatocytes started to emerge at P7, peaked at P60, but did not significantly expand further in adult mice (Figure 1D and later results). The average of Tomato⁺ hepatocytes, based on 10 adult mice, was 13.7%.

To further understand the Twist2-lineage cells, we performed scRNA-seq analysis of Tomato⁺ cells isolated from the livers of P1 or P14 Tomato^Twist2 mice. We sequenced 10000 cells at a depth of 2500 genes per cell in each sample. t-SNE analyses revealed 3 major Tomato⁺ subgroups (Figure 2A-C): hepatocytes, MCs, and EpCAM⁺ cells. The EpCAM⁺ cells could be further classified into EpCAM^high, EpCAM^med, and EpCAM^low subpopulations, which showed similar gene expression profiles (Figure 2C). In addition, a population of Tomato⁺ cells expressing proerythroblast genes was detected in P1 but not P14 mice (Figure S2A-C), which might represent transit cells in fetal/neonatal livers and were not further analyzed. In addition, the EpCAM^med and EpCAM^low subgroups were not observed in P14 mice, which only contained the EpCAM^high subgroup (Figure 2D). Surprisingly, Twist2 is only expressed in some MCs but not in the EpCAM⁺ subgroups in P1 or P14 mice (Figure S2D), suggesting that EpCAM⁺ cells are derived from Twist2-expressing cells during early development, which have lost Twist2 expression later.

Fig. 2.

While in P1 pups, few of Tomato⁺ cells were hepatocytes, approximately 40% of the Tomato⁺ cells were hepatocytes in P14 mice (Figure S2B). Trajectory analysis revealed that cells in the EpCAM^med subgroup might first convert to EpCAM^high cells and then to hepatocytes (Figure 2E). Comparison of lineage signature gene expression revealed that EpCAM^med and EpCAM^low cells also expressed mesenchymal markers but not immune or endothelial cell markers (Figure S2E-G). Moreover, EpCAM^low cells showed a gene expression pattern close to MCs, compared to EpCAM^high or EpCAM^med cells (Figure 2C and Figure S2G). These findings suggest that EpCAM^low progenitor cells give rise to hepatocytes and MCs.

Gene ontology (GO) analysis confirmed that Twist2 lineage hepatocytes were enriched in metabolism genes whereas MCs were enriched in ECM genes (Figure S3A, B). Interestingly, EpCAM^med cells showed enriched expression of genes related to proliferation and macromolecule synthesis, EpCAM^high cells were enriched in genes related to proliferation and epithelial development, and EpCAM^low cells expressed some ECM genes (Figure S3C-E), consistent with the trajectory analysis results that the EpCAM^med subgroup might first convert to EpCAM^high cells and then to hepatocytes (Figure 2E).

Detection of Twist2-expressing progenitors in E10.5 liver

Our scRNA-seq data suggest that Twist2 is expressed in MCs but not EpCAM⁺ progenitors in P1 or P14 livers (Figure S2D). Analysis of scRNA-seq data from public datasets (GSE125688 and GSE137720)(Dobie et al., 2019; Pepe-Mooney et al., 2019) also revealed that Twist2 is expressed in a small population of MCs but not hepatocytes (clustered based on Albumin expression levels) in adult mice and that Twist2 expression is not altered during liver regeneration (Figure S4A,B). These results suggest there might exist a Twist2-expressing progenitors in early embryonic liver, which give rise to EpCAM⁺ cells in newborn mice and then Twist2 lineage hepatocytes in adult mice.

Indeed, a recent scRNA-seq study has uncovered a Twist2-expressing hybrid hepatomesenchymal cell type at E10.5(Lotto et al., 2020), whose daughter cells and function have not been investigated. We re-analyzed the scRNA-seq data and found that 8.62% of hepatocytes expressed Twist2, a portion of which also expressed EpCAM (Figure 2F). GO analyses revealed that the Twist2-expressing hepatomesenchymal cells expressed both stromal and hepatocyte signature genes (Figure 2G, H).

To confirm the above finding, we immunostained liver sections of Tomato^Twist2mice of various ages for Twist2 expression. Although Twist2 is a transcription factor, it is also detected in the cytoplasm(Liu et al., 2017). We found that Twist2 was detectable in Tomato⁺ MCs but not Tomato⁺ hepatocytes in P14 or P90 mice (Figure 2I), consistent with scRNA-seq results. However, in E10.5 embryos, some of the Hnf4α⁺ cells were positive for Twist2 in the liver anlage region (Figure 2J). Both the scRNA-seq and immunostaining data suggest that Twist2 lineage hepatocytes are derived from Twist2⁺ progenitors during early embryonic development via Twist2^-EpCAM⁺ intermediates (Figure 2K).

Midzone location and polyploidy of Twist2-lineage hepatocytes

Most Tomato⁺ hepatocytes were located in the midzone, with some at the periportal region but few at the pericentral region (Figure 3A). Similar results were obtained from tracing experiments with mTmG^Twist2 mice, in which Twist2-expressing cells and their progenies were GFP⁺, while all other cells were Tomato⁺ (Figure 3B). This was also confirmed by immunostaining for pericentral zone hepatocyte marker CYP2e1 and periportal zone hepatocyte marker CDH1 (Figure 3C)(Ben-Moshe et al., 2019). Genetic studies have identified a few zone-specific markers(Wei et al., 2021), and analysis of our scRNA-seq data revealed that Twist2-lineage hepatocytes expressed Cyp1a2, Gls2, and Ccnd1, which mark portions of midzone hepatocytes, but not zone 3-specific marker G/S (Figure S5). Twist2-lineage hepatocytes did not express Hamp2, a marker for some midzone hepatocytes(Halpern et al., 2017), suggesting that Twist2 and Hamp2 mark different subpopulations of the midzone hepatocytes.

Fig. 3.

We found that while 47.4% of Tomato^- hepatocytes were diploid cells, only 22.9% of Tomato⁺ hepatocytes were diploid in adult Tomato^Twist2 mice (Figure 3D), indicating that Twist2-lineage hepatocytes are largely polyploids. The percentage of polyploid hepatocytes was down from 77.1% to 68.9% in 20-month-old Tomato^Twist2 mice compared to 2-month old mice, although the percentage of Tomato⁺ hepatocytes in the liver did not significantly change with age (Figure S6), supporting that Twist2-lineage hepatocytes may undergo very slow turnover.

Deletion of one Twist2 allele did not affect midzone hepatocytes

To exclude the possibility that disruption of one allele of Twist2 in Twist2-Cre mice affects hepatocytes in the midzone, we analyzed midzone hepatocytes using an established marker, Cyclin D1(Wei et al., 2021). We found that compared to age-matched wildtype mice, Twist2-Cre mice showed normal numbers of Cyclin D1-positive midzone hepatocytes at the age of P14 or P60 (Figure S7A, B). In addition, in CCl₄-induced liver injury models, Twist2-Cre mice showed no alteration in Cyclin D1-positive midzone hepatocytes compared to wildtype mice (Figure S7C, D). These results suggest that the Twist2-Cre mouse line can be safely used to study midzone hepatocytes.

Twist2-lineage hepatocytes show increased proliferation and migration capacities

We then directly compared Twist2-lineage hepatocytes (Tomato⁺) and conventional hepatocytes (Tomato^-) from the same adult mouse by bulk RNA sequencing. KEGG pathway and GO term analyses revealed that Twist2-lineage hepatocytes were enriched in genes in mitogenic pathways, including Hippo, MAPK, Notch1, and TGFβ; ECM genes; and genes related to angiogenic regulation, cell migration, and cell shape and structure, but expression of metabolic genes, including Alb (encoding albumin), was greatly reduced (Figure 4A-D). Immunostaining confirmed increased activation of mTOR and Erks and increased expression of Notch downstream Hes1 in midzone hepatocytes (Figure 4E). Overall, these results suggest that Twist2-lineage hepatocytes might have greater mitogenic and migratory potentials at the sacrifice of metabolism. Indeed, we found that the percentage of proliferating Tomato⁺ hepatocytes were much higher than that in Tomato^- hepatocytes in P14 or adult mice (Figure 4F and later results).

Fig. 4.

scRNA-seq analysis uncovers hepatocytes with mesenchymal features in adult mice

We then re-analyzed the public domain scRNA-seq datasets of the whole liver cells of adult mice based on Alb expression and found that hepatocytes could be divided into 4 subpopulations with 2 subgroups expressing about 5 times lower Alb than the other two (Figure S5A). Adult livers did not have the EpCAM⁺ populations observed in P1 and P14 mice (Figure S4A), suggesting that they are transit progenitors during liver growth. Alb^low subgroup 2 also expressed mesenchymal markers Vimentin, Col3a1, and Col1a2 (Figure S4C, D). Moreover, comparative studies revealed that this Alb^low population showed enhanced expression of genes involved in liver development, cell cycle, growth, and features of Sertoli and adipocytes whereas the Alb^high groups expressed mainly ribosome, oxidation, ATP synthesis, and nucleotide metabolism (Figure S4E, F). These results suggest that the Alb^low 2 hepatocytes might overlap with the Twist2-lineage hepatocytes.

Twist2-lineage hepatocytes show great transzone regeneration ability

To determine the possible roles of Twist2-lineage hepatocytes in liver regeneration, we first induced liver injury in Tomato^Twist2 mice with CCl₄, which mainly damages zone 3 and causes fibrosis. In the acute phase, 2-3 times more Tomato⁺ hepatocytes were undergoing proliferation than Tomato^- hepatocytes (Figure 5A). When the injury had been repaired, the percentage of Tomato⁺ hepatocytes had increased to 39.1% from 12.0%, accompanied by conversion from polyploid to diploid hepatocytes (from 77.1% to 40.4%) (Figure 5B, C), consistent with previous studies showing the loss of polyploids in regenerated hepatocytes(Duncan et al., 2010). Conversion of polyploid to diploid hepatocytes may contribute to rapid expansion of Twist2-linegae hepatocytes during liver regeneration, since they do not need to duplicate the genome. Moreover, Tomato⁺ hepatocytes were detected close to the fibrotic Vimentin⁺ pericentral region (Figure 5B), indicating that they expanded to zone 3.

Fig. 5.

To validate the hyperproliferation of Twist2 lineage hepatocytes, we injected EdU to wildtype and Tomato^Twist2 mice daily for 14 days after CCl₄-induced liver injury. We found that in EdU-labelled hepatocytes, 67% are Tomato⁺ (Figure 5D). These results confirmed that the Twist2 lineage mesenchymal-hepatocytes make greater contribution to liver regeneration than conventional hepatocytes.

We also tested the contribution of Twist2-lineage hepatocytes to liver regeneration in the PHx model, which mimics split liver transplantation in humans(Bangru & Kalsotra, 2020). We observed a 3-fold increase in proliferating Tomato⁺ hepatocytes at day 2 after 2/3 PHx and a 2 fold increase in the percentage of Tomato⁺ hepatocytes after regeneration, which also replenished zone 1 and, to a lesser extent, zone 3 (Figure 5E, F). Note that in the liver after 2/3 PHx, about 4% of Tomato⁺ hepatocytes remained, which generated 30.4% of new hepatocytes in the repaired liver, while 29% of Tomato^- hepatocytes remained, which generated 36.6% of new hepatocytes. Overall, these studies suggest that the midzone-located Twist2-lineage hepatocytes have greater proliferating and migrating capacities and regenerate about half of the new liver mass, while the conventional hepatocytes and stem/progenitor cells, which account for a vast majority of hepatocytes, regenerate the other half.

Expression of Twist2 or MET genes was unaltered during liver regeneration

To exclude the possibility that Twist2 expression is increased during liver regeneration, which may contribute to the increase in the number of Twist2-marked cells, we analyzed the public scRNA-seq data and found that the number of cells expressing Twist2 was not altered during liver regeneration, and Twist2 was mainly expressed in MCs rather than hepatocytes (Figure S8A, B). Immunostaining confirmed that Twist2 was mainly expressed in MCs rather than hepatocytes (with larger nuclei than MCs) (Figure S8B), suggesting that Twist2 expression is not altered during livre regeneration. We also tested whether MET (mesenchymal-epithelial transition) occurs during liver regeneration. We analyzed the expression of MET-related genes (Snail, Twist1, and Zeb1) and found that expression of these genes was not altered in regenerating livers of CCl₄-induced injury or PHx models in wildtype or Twist2-Cre mice (Figure S8C, D). These results suggest that MET does not play a role in liver regeneration.

Notch1 signaling suppresses mesenchymal-hepatocyte expansion and liver growth

Our RNA-seq data revealed that Twist2-lineage hepatocytes in adult mice showed enriched expression of 57 genes in the Notch1 pathway including Hes1, Hey, and Heyl (Figure 6A and Figure S9A). Notch molecules are required for liver development, especially cholangiocyte fate determination, and mutations in Jag1 or Notch2 cause a paucity of bile ducts in Alagille syndrome patients and mouse models(Dill et al., 2012; Fabris et al., 2019; Greenhill, 2014; Li et al., 1997; Romeo, 2019). We then generated Notch1^Twist2 mice (Figure S9B). These mutant mice appeared normal up to 12 months but had 4 instead of 7 liver lobes staring at birth, but showed an increased liver weight-to-body weight ratio (from 5.58% to 6.77%) (Figure 6B). The abundance of Tomato⁺ hepatocytes was increased by close to 2 folds, and these cells occupied zones 1 and 3 and showed enhanced proliferation (Figure 6C). These results suggest that Notch1 suppresses the proliferation of Twist2-lineage hepatocytes. It has been reported that Twist2 also marks BM-MSCs and muscle stem cells(Liu et al., 2017; Yu et al., 2003). However, Nocth1 deletion did not affect skeletal structure, overall bone mass, or the weight or structure of skeletal muscles (Figure S9C, D), suggesting a tissue-specific effect for Notch1 ablation on the liver.

Fig. 6.

Evidence that suppression of Notch1 signaling helps liver regeneration

Moreover, we found that during liver regeneration in normal mice, Notch1 signaling was suppressed in the midzone, manifested by a decrease in Hes1 signals (Figure S9E). Inhibiting of Notch signaling would promote proliferation of Twist2-lineage hepatocytes, as observed in Notch1^Twist2 mice (Figure 6C). We tested liver regeneration in Notch1^Twist2 mice and found that the percentage of Tomato⁺ hepatocytes did not increase further in CCl₄-treated compared to non-treated mutant mice, this is in contrast to 2-3 fold increase in the percentage of Tomato⁺ hepatocyte in Notch1^+/+mice (Figure S9F). Overall, these results suggest that suppression of Notch1 signaling in hepatocytes promotes expansion of the mesenchymal-hepatocytes during liver regeneration.

Inhibiting VEGFR or mTOR diminishes Notch1 ablation-induced hepatocyte expansion

Western blot analysis showed liver overgrowth in Notch1^Twist2mice was associated with increased activation of the mitogenic signaling molecules Akt1, Erk, and mTOR in Notch1-deficient liver samples (Figure 6D). Immunostaining confirmed strong activation of ERKs and mTOR on liver sections (Figure S9G). mTOR is a sensor of nutrients and growth factors and can be activated by both Akt1 and ERK(Lu et al., 2021). We found that treatment of Notch1^Twist2 mice with rapamycin (RAP), an mTOR complex 1 inhibitor, for 1 month starting at 1 month of age restored the liver structure, the percentage of PCNA⁺ hepatocytes, and the LW/BW ratio to close-to-normal levels, yet, RAP did not significantly affect the liver structure or LW/BW ratio in normal mice (Figure 6E-G), suggesting that enhanced mTOR signaling contributes to hyperproliferation of Notch1-deficient mesenchymal-hepatocytes.

The livers of Notch1^Twist2 mice also showed increased angiogenesis (Figure S9H). Previous studies have shown that hepatocytes secrete VEGF to promote angiogenesis(Banerjee et al., 2015; Cuervo et al., 2016; Dill et al., 2012), as well as hepatocyte proliferation(LeCouter et al., 2003). We found that Notch1-deficient liver samples showed enriched expression of pro-angiogenesis factors, especially Vegfa and Vegfb (Figure 4C and 7A). Previous studies have shown that Notch1 inhibits Vegf expression and angiogenesis, likely via Hif1α (Θιανγ ετ αλ., 2012; Zηυ ετ αλ., 2017). Our immunostaining experiments uncovered an increase in Hif1α in hepatocytes of Notch1^Twist2 mice (Figure 7B), which was mainly nuclear, supporting that Notch1 signaling suppresses Vegfa expression. Functionally, treating Notch1^Twist2 mice with axitinib, an inhibitor of VEGF receptors, for 1 month starting at the age of 1 month diminished the increases in angiogenesis, the number of PCNA⁺ proliferating hepatocytes, and the LW/BW ratio, as well as mTOR activation (Figure 7C-E). We also found that axitinib could inhibit proliferation of Huh7 cells, a hepatoblastoma cell line, in vitro (Figure S10). The findings that axitinib showed insignificant effect on the liver parameters in normal mice (Figure 7C-E), suggest that VEGF promotes hepatocyte proliferation when expressed at high levels.

Fig. 7.

Discussion

The liver is the only organ that can be fully regenerated in mouse and human. Rapid recovery 2/3 of the mouse liver mass requires not only massive expansion of remaining hepatocytes but also cell migration and structure rebuilding. Although adult stem cells play critical roles in regeneration of many tissues including the gut, skin, and skeletal muscles, cumulative evidence suggests that the differentiated hepatocytes, especially midzone hepatocytes, play a dominant role in liver regeneration(Andersson, 2021; Monga, 2020). However, these cells are terminally differentiated epithelial cells and in general have limited proliferation and migratory potentials. So how liver is rapidly regenerated remains not fully resolved.

Our current study uncovered a small mesenchymal-hepatocyte hybrid population, which possess the features required for rapid liver regeneration. These cells are likely derived from Twist2-expressing cells in embryonic livers via the intermediate EpCAM⁺ cells in p7 and P14 pups(Lotto et al., 2020). scRNA-seq analysis suggest that such hepatocytes exist in adult mice. Certainly, the ontology of this lineage warrants further investigation. The Twist2 lineage hepatocytes express higher levels of mesenchymal-related genes and lower levels of metabolic genes compared to conventional hepatocytes, are mainly located in the midzone, highly polyploidy, and display increased proliferation and migration capacities. A recent study also uncover these features for midzone hepatocytes(Sun et al., 2020). During liver regeneration, these cells showed 2-3 times greater proliferation capacity than conventional hepatocytes and the percentages of these cells almost tripled after repair. Moreover, they replenished not only the midzone but also zones 1 and 3. Overall, these findings suggest that the mesenchymal-hepatocytes represent an important regenerative force and form about half of the new liver mass (Figure 7F).

The mesenchymal-hepatocytes appear to play a role in liver growth but not much in liver homeostasis. During postnatal liver growth, these cells undergo proliferation at a rate greater than that of conventional hepatocytes. Moreover, deletion of Notch1 in these cells led to expansion of the mesenchymal-hepatocytes by 3 folds, which repopulate zone 1 and 3, accompanied by an increase in the LW/BW ratio, suggesting that these cells participate in liver postnatal growth, which is under the control of Notch1 signaling. However, in adult mice, the size of the mesenchymal-hepatocyte population did not change up to 20 months of age. Despite that, we observed a modest loss of polyploid hepatocytes, suggesting that they may undergo slow turnover.

An intriguing finding is that most of the highly mitogenic and migratory mesenchymal-hepatocytes are polyploidy and moreover, they show a conversion from polyploid to diploid with age or during regeneration, which may contribute to rapid expansion of Twist2-lineage hepatocytes as polyploid cells do not need to duplicate the genome before division, consistent with previous studies showing that polyploid hepatocytes turn into diploids during regeneration and they undergo little DNA synthesis(Duncan et al., 2010; Wilkinson et al., 2019). Certainly, the function of diploid conversion warrants further investigation.

Although our findings confirm the important role played by midzone hepatocytes in liver regeneration, they also suggest that not all hepatocytes are equal in the midzone. Hamp2 is specifically expressed in some midzone hepatocyte. Twist2-lineage hepatocytes do not express Hamp2 and differ from Hamp2⁺ hepatocytes, as the latter undergoes constant turnover in adult mice and expands much less during regeneration (from 10% to 13% in the CCl₄ injury model and from 10 to 17.5% in the diethoxycarbonyl-1,4-dihydrocollidine-induced model)(Wei et al., 2021). Moreover, our study of the PHx model suggests that conventional hepatocytes also participate in liver regeneration, although at a slow pace, consistent with previous findings(Monga, 2020). Cooperation of mesenchymal-hepatocytes and conventional hepatocytes are thus needed for rapid liver regeneration.

We also show that Notch1 activation is increased in Twist2-lineage hepatocytes compared to conventional hepatocytes and that this activation is suppressed during liver regeneration. Deletion of Nocth1 led to the expansion of these hepatocytes into zones 1 and 3 and an increase in the liver weight-to-body weight ratio. This is in contrast to mice in which Nocth1 was ablated from Alb⁺ hepatocytes, which did not develop obvious liver phenotypes(Geisler et al., 2008). This can be explained by late and weak Alb expression in Twist2-lineage hepatocytes, restriction of the function of Notch1 to progenitor cells, and/or weak Notch1 activation in conventional hepatocytes (Figure 6A). Our pharmacological studies suggest that Nocth1 may negatively regulates the expression of Vegfa and Vegfb in Twist2-lineage cells, which promote cell proliferation via VEGFR-mTOR signaling in autocrine and/or paracrine manners.

One complication in using knock-in Cre or CreERT mice is that ablation one allele of the marker gene may affect the behavior of the labelled cells. Here we show that ablation one Twist2 allele did not affect liver development, growth, or regeneration, nor does it affect the midzone hepatocytes. Moreover, we show that expression of Twist2 or MET related genes is not affected during liver regeneration, and that deletion of one Twist2 allele does not affect the expression of MET genes. These results indicate that it is safe to use the Twist2-Cre to study liver development and regeneration.

In summary, the findings of this study suggest that in response to injury-induced cues, midzone-located mesenchymal-hepatocytes undergo great expansion and migration and regenerate zones 1 and 3, which form half of the new liver mass. Moreover, the highly regenerative and mesenchymal nature of this hepatocyte subpopulation implies that they may constitute a cell basis for liver cancer, fat liver, and liver cirrhosis, thus opening up a new direction in the study of liver diseases.

Materials and Methods

Mice

The Twist2-Cre (008712), Notch1^f/f (006951), R26-tdTomato (007914), Col1α2-CreERT (029567), and R26-mTmG (007576) mouse lines were obtained from the Jackson Laboratory. The Acta2-Cre line was generated in Xiao Yang’s laboratory. The knock-in Twist2^f/fand Vim-CreERT line were generated by Shanghai Biomodel Organism Science & Technology Development Co., Ltd. The CreERT cassettes was inserted in front of the ATG codon. DNA sequencing confirmed proper recombination at the locus. All mice were housed in the animal facility at Shanghai Jiao Tong University, and mouse work was performed following the recommendations of the National Research Council Guide for the Care and Use of Laboratory Animals with a protocol approved by the Institutional Animal Care and Use Committee of Shanghai, China [SYXK (SH) 2011-0112]. For tracing and gene deletion experiments, two-month-old male mice were used.

Histology, immunohistochemistry, and immunofluorescence

Mice were perfused with 4% paraformaldehyde (PFA), and the organs were harvested immediately after sacrifice, washed, embedded in paraffin, sectioned at 5 μm, and stained with hematoxylin and eosin (H/E). For immunostaining, antigen retrieval was performed by boiling the slides in citrate buffer (pH 6) for 10 min, followed by cooling to room temperature. Tissues were submerged in methanol containing 3% H₂O₂ for 20 min to inactivate endogenous peroxidases, followed by treatment with 0.1% Triton X-100 for 20 min to permeabilize the cells. The sections were blocked in 10% goat serum for 45 min and incubated with primary antibodies at 4°C overnight and secondary antibodies (Invitrogen) for 1 h at 37°C.

To prepare frozen sections, tissues were collected in cold PBS and then fixed in 4% PFA at 4°C for 4 hours. After washing in PBS three times, the tissues were placed in 30% sucrose/PBS overnight at 4°C, embedded in OCT compound, and stored at -80°C until sectioning. Cryosections (10 µm in thickness) were collected on positively charged slides and stored at -20°C until use. The following antibodies were used: p-S6 (1:100, CST, 2211), PCNA (1:100, CST, 2586), p-ERK (1:100, CST, 9106), Ki67 (1:100, Thermo Scientific, PA5-19462), p-4EBP1 (1:100, CST, 2855), Hif1α (1:100, Invitrogen, PA1-16601), Hes1 (1:100, Abcam, 71559). PDGFRα (1:100, R&D, AF1062), CD31 (1:50, Abcam, 7388), CD45 (1:100, Abcam, 154885), Hnf4α (1:100, Abcam, 181604), K19 (1:100, DSHB, Troma-III), αSMA (1:100, Abcam,119952), Vimentin (1:100, Abcam, 193555), Cdh1 (1:100, R&D, AF748), Cyp2e1 (1:100, Sigma, HPA009128), Col1 (1:100, Abcam, 260043). Twist2 (1:50, Sigma, WH0117581M1), Cyclin D1 (1:100, Abcam, 16663).

Liver injury model

For the CCl₄-induced liver injury model, mice were intraperitoneally injected with CCl₄ (diluted 1:4 in corn oil) at a final volume of 5 ml/kg body weight. For the PHx liver injury model, 2/3 PHx injury was performed according to established protocols. Briefly, mice were anesthetized by an intraperitoneal injection of 40 mg/kg sodium pentobarbital and transferred onto an electric blanket. Following removal of the abdominal fur and skin disinfection with iodine, a midline abdominal skin and muscle incision was made to expose the liver. The base of the left lateral lobe and the median lobe were ligated with a 4-0 silk thread, and the lobes were resected just above the knots. The peritoneum and skin were then closed with 6-0 sutures, and the mice were supplied with pure oxygen for 4-5 minutes until they achieved normal breathing. Then, the mice were placed in individual cages under a warming lamp for recovery. The right and caudate lobes were used for analysis.

X-ray imaging of the skeleton

Bone radiographs were taken with a cabinet X-ray system (LX-60, Faxitron Bioptics) using standardized settings (45 kV for 8 s).

Determination of long term hepatocyte proliferation

EdU (5-Ethynyl-2-deoxyuridine) (5 mg/kg) was injected intraperitoneally into Tomato^Twist2mice daily for 14 days after CCl₄-induced liver injury. Cell-LightTM Apollo488 Stain Kit(100T) (Code No. C10371-3) (RIBOBIO, China) was used to detect EdU incorporation into the cellular DNA. Briefly, after embedding, the frozen sections were washed in phosphate-buffered saline for 15 minutes at room temperature and incubated with 2 mg/ml glycine buffer for 10 minutes at room temperature. After washing with 0.5% triton x-100 buffer for 10 minutes, a mixed reaction buffer was added to samples (30 min at room temperature). Staining of the nuclei was performed with DAPI.

RNA isolation and quantitative PCR analysis

Total RNA was isolated using TRIzol (Invitrogen), and 1 μg of total RNA was used to synthesize complementary DNA using random primers (SuperScript II RT; Invitrogen). For quantitative PCR, SYBR Green PCR Master Mix (Applied Biosystems) was used in a CFX96 real-time thermocycler system (Bio-Rad); the RNA levels of target genes were normalized to those of GAPDH. For each qPCR experiment, all samples were run in triplicate. The following primers have been used in other studies:

GAPDH-F: 5’-TGACCTCAACTACATGGTCTACA-3’

GAPDH-R: 5’-CTTCCCATTCTCGGCCTTG-3’

Vegfb-F: 5’- GCCAGACAGGGTTGCCATAC -3’

Vegfb-R: 5’- GGAGTGGGATGGATGATGTCAG -3’

Vegfc-F: 5’- GAGGTCAAGGCTTTTGAAGGC -3’

Vegfc-R: 5’- CTGTCCTGGTATTGAGGGTGG -3’

Vegfa-F: 5’- GCACATAGAGAGAATGAGCTTCC -3’

Vegfa-R: 5’- CTCCGCTCTGAACAAGGCT -3’

Vegfd-F: 5’- TTGAGCGATCATCCCGGTC -3’

Vegfd-R: 5’- GCGTGAGTCCATACTGGCAAG -3’

Hes1-F: 5’- CATTCCAAGCTAGAGAAGGCAG-3’

Hes1-R: 5’- TATTTCCCCAACACGCTCG-3’

Notch1-F: 5’- TGCCAGGACCGTGACAACTC-3’

Notch1-R: 5’- CACAGGCACATTCGTAGCCATC-3’

Snai1-F: 5’- CACACGCTGCCTTGTGTCT-3’

Snai1-R: 5’-GGTCAGCAAAAGCACGGTT-3’

Zeb1-F: 5’-GCTGGCAAGACAACGTGAAAG-3’

Zeb1-R: 5’-GCCTCAGGATAAATGACGGC-3’

Twist1-F: 5’-GGACAAGCTGAGCAAGATTCA-3’

Twist1-R: 5’-CGGAGAAGGCGTAGCTGAG-3’

Western blot analysis

All mouse liver tissues were ground and lysed in protein lysis buffer for use in Western blotting. The following antibodies were used: p-S6 (1:1000, CST#2211), S6 (1:1000, CST, 9211), Akt (1:1000, CST, 9272), p-Akt (1:1000, CST, 4060), PCNA (1:1000, CST, 2586), p-ERK (1:1000, CST, 9106), ERK (1:1000, CST, 9102), β-Catenin (1:1000, Santa Cruz Biotechnology, 7199), Hes1 (1:1000, Abcam, 71559), Actin (1:5000, Santa Cruz Biotechnology, 81178).

Drug treatments

RAP (Selleck) was formulated in 0.25% PEG400, 0.25% Tween 80 and 99.75% water; this formulation was intraperitoneally injected at a dosage of 10 ml/kg daily for 30 days. Axitinib (Selleck) was dissolved in DMSO and formulated in 44.44% PEG300, 5.56% Tween 80 and 44.44% water; this formulation was administered by intraperitoneal injection at 7.5 ml/kg daily for 30 days.

Liver cell isolation

Primary mouse cells (including parenchymal and mesenchymal cells) were isolated by the two-step liver perfusion method with modifications. Briefly, mice were anesthetized by an intraperitoneal injection of 40 mg/kg sodium pentobarbital. The abdomen was then cut open to expose the liver, inferior vena cava and portal vein. The portal vein was cut, and the liver was first perfused with 1x PBS (containing 0.5 mM EDTA) for 5 minutes and then perfused with digestion buffer containing collagenase type IV (Sigma) and DNase I for 7-10 minutes. The livers were then clipped, removed and transferred to a Petri dish filled with 1x PBS at 4°C. The liver tissues were gently torn to help the hepatocytes dissociate, and the cell suspension was filtered through a 70-μm cell filter (BD Falcon), followed by centrifugation at 4°C and 50 x g and 500 x g for hepatocytes and nonparenchymal cells, respectively. We then resuspended the cells in 50% and 25% Percoll mixtures and centrifuged them at 300 x g for 20 min at 4°C. Purified hepatocytes and nonparenchymal cells were collected for ploidy analysis or washed with PBS and resuspended in DMEM containing 10% FBS for cell culture.

CCK-8 assays

Axitinib was added to the cells and cultured for different periods of time. Each well was then added with 10 μl CCK-8 reagent (Keygen Biotech, CN) and cultured for 3 more hrs. The viable cells were determined by measuring the optical density (OD) absorbance at the wavelength of 450 nm.

Bulk RNA sequencing analysis

DNase I was used to digest double-stranded and single-stranded DNA in total RNA, and magnetic beads were then used to recover the reaction products. RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA. Purified mRNA from previous steps was fragmented into small pieces with fragment buffer at the appropriate temperature. Then, first-strand cDNA was generated in the First Strand Reaction System by PCR, and second-strand cDNA was generated as well. The reaction product was purified by magnetic beads, after which A-tailing mix and RNA index adapters were added to carry out end repair. The cDNA fragments with adapters were amplified by PCR, and the products were purified with Ampure XP beads. The library was validated on an Agilent Technologies 2100 bioanalyzer for quality control. The double-stranded PCR products were then heat-denatured and circularized by the splint oligo sequence. Single stranded circular DNA (ssCir DNA) was formatted as the final library. The final library was amplified with phi29 (Thermo Fisher Scientific, MA, USA) to prepare DNA nanoballs (DNBs) containing more than 300 copies of one molecule. The DNBs were loaded into the patterned nanoarray, and single-end 50-base reads were generated on the BGISEQ-500 platform (BGI-Shenzhen, China).

Differentially expressed genes (DEGs) determined from the RNA expression data were mapped to the GO database or KEGG database, and significant GO and KEGG pathway enrichment analyses were performed using the R package clusterProfiler.

Flow cytometry and fluorescence-activated cell sorting (FACS)

For analysis of Tomato⁺ cells, Wild-type mouse cells were used to set compensation. DNA content was quantified with DAPI (Thermo Scientific)(Matsumoto et al., 2020). All flow cytometry analyses were performed on a Beckman CytoFLEX S. All flow cytometry sorting was performed on a Bio-Rad S3e. The FACS data were analyzed with FlowJo.

10X Illumina single-cell RNA sequencing

Digested tdTomato⁺ total liver cells from P1 and P14 tdTomato^Twist2 mice were sorted and used for sequencing. The cell suspension was loaded into Chromium microfluidic chips with 3’v3 chemistry and barcoded with a 10X chromium controller (10X Genomics). RNA from the barcoded cells was subsequently reverse-transcribed, and sequencing libraries were constructed with reagents from a Chromium Single-Cell 3’v3 Reagent Kit (10X Genomics) following the manufacturer’s instructions. Sequencing was performed with an Illumina NovaSeq 6000 (Illumina).

Single-cell RNA analysis

Raw reads were demultiplexed and mapped to the mouse reference genome with the Cell Ranger version 3.0.1 (10X Genomics) pipeline using the default parameters. The generated gene-cell expression matrix was used for subsequent analysis in R version 3.6.1 using Seurat version 3.1.5(Butler et al., 2018). “Cells” with any of the following criteria were excluded: <500 expressed genes; >25% unique molecular identifiers (UMIs) mapped to mitochondria; or nUMI >99% events, with the number of UMIs (nUMI) used to exclude doublet cells. Clusters with very few cells were filtered before downstream analysis. Filtered cells from P1 and P14 samples were merged using the “merge” function in Seurat, and the merged data were used for downstream graph-based clustering and t-SNE visualization. DEGs in each cluster were identified with the function “FindAllMarkers” in Seurat. The “DoHeatmap” function in Seurat was used to obtain heatmap figures. The “FeaturePlot” and “VlnPlot” functions in Seurat were used to visualize specific gene expression.

For correlation analysis, average gene expression data for each cluster were generated from merged data. Correlation indexes between each cluster were calculated based on the average gene expression data using “cor” in R and drawn by the ggplot2 R package.

Using the marker genes listed in fig. S4, we calculated ‘scores’—a single numeric value representative of the expression of multiple marker genes—as the sum of log2(counts+1) across all markers in a category.

scRNA-seq data of MCs (GSE137720) and hepatocytes (GSE125688) in the liver were obtained from the GEO database. The analytical strategy was similar to that mentioned above. For DEGs between Alb^low 2 and Alb^high 1 & 2 cells from healthy hepatocyte samples, “FindMarkers” in Seurat was used.

GO and KEGG pathway enrichment analyses

DEGs were mapped to the GO and KEGG databases, and enrichment analyses of GO terms and KEGG pathways were performed using the clusterProfiler R package(Yu et al., 2012).

Pseudotime analysis

Merged Seurat data without “proerythroblasts” were used for pseudotemporal analysis using the Monocle2 R package(Qiu et al., 2017). The “differentialGeneTest” function was used to identify DEGs between the cells belonging to P1 samples and P14 samples. Ordering genes were selected from among DEGs with a q value cutoff of <1 × 10−100, which produced a list of 2562 genes. The “reduceDimension” function was used with the parameter “max_components = 2, method = ’DDRTree’”. “orderCells” was then run, and the result was graphed with the function “plot_cell_trajectory”. The branch containing the most P1 cells was set as the original root.

RNA-seq data in public databases

The following RNA-seq datasets (available in public databases) were used in this study. Hepatocytes (GEO database accession: GSE125688) and mesenchymal cells (GEO database accession: GSE137720).

Data available

scRNA-seq data have been deposited in the SRA database under accession code PRJNA721304. Bulk RNA-seq data of Twist2-linegae hepatocytes and conventional hepatocytes have been deposited in the SRA database under accession code PRJNA721538.

Statistics

Data are represented as means ± S.D. The number of mice used for each experiment (without randomization) is indicated in the corresponding figure legend. Analyses of significant differences between groups were performed using two-tailed Student’s t-tests or Two-way ANOVA.

Acknowledgements

The work was supported by the National Key Research and Development Program of China (2018YFA0800803 to BL and 2018YFA0800803 to JL) and the National Natural Science Foundation of China (81520108012 and 91749201) to BL.

Competing interests

The authors declare no competing interests.

Author contributions

B. L. and J. L. designed research; G. Y., S. Z., A. R., and S. B. performed research; H. L and H. W. analyzed data; J. L. and B. L. wrote the paper.

Supplementary Materials for

Supplementary Figures

Fig. S1.

Fig. S2.

Fig. S3.

Fig. S4.

Fig. S5.

Fig. S6.

Fig. S7.

Fig. S8.

Fig. S9.

Fig. S10.