Abstract
T-cell receptor stimulation by antigen bound to the major histocompatibility complex (MHC) on an antigen-presenting cell (APC) induces protein kinase C (PKC) activation and the formation of the immune synapse (IS), followed by depletion of filamentous actin (F-actin) at the central region of the IS (cIS) and the polarization of multivesicular bodies (MVB) and the microtubule-organizing center (MTOC) to the IS. These events lead to polarized exosome secretion at the IS. These exosomes are involved in several crucial immune responses such as autocrine activation-induced cell death (AICD) of T lymphocytes and cytotoxicity. We analysed here how formin-like 1 β (FMNL1β), an actin cytoskeleton-regulatory protein, regulates MTOC/MVB polarization and exosome secretion at the IS in a phosphorylation-dependent manner. IS formation was associated with transient recruitment of FMNL1β to the IS, which was independent of protein kinase C δ (PKCδ). Simultaneous RNA interference of all FMNL1 isoforms prevented MTOC/MVB polarization and exosome secretion, which were restored by FMNL1βWT expression. However, expression of the non-phosphorylatable mutant FMNL1βS1086A did not restore neither MTOC/MVB polarization nor exosome secretion to control levels, supporting the crucial role of S1086 phosphorylation in MTOC/MVB polarization and exosome secretion. In contrast, the phosphomimetic mutant, FMNL1βS1086D, restored MTOC/MVB polarization and exosome secretion. Conversely, FMNL1βS1086D mutant did not recover the deficient MTOC/MVB polarization occurring in a PKCδ-interfered clone, indicating that S1086 FMNL1β phosphorylation alone is not sufficient for MTOC/MVB polarization and exosome secretion. FMNL1 interference inhibited the depletion of F-actin at the cIS, which is necessary for MTOC/MVB polarization. FMNL1βWT and FMNL1βS1086D, but not FMNL1βS1086A expression, restored Factin depletion at the cIS. Thus, actin cytoskeleton reorganization at the IS underlies the effects of all these FMNL1β variants on polarized secretory traffic. Taken together, these results point out a crucial role of S1086 phosphorylation in FMNL1β activation, leading to cortical actin reorganization and subsequent control of MTOC/MVB polarization and exosome secretion.
Introduction
T cell receptor (TCR) stimulation by antigen bound to major histocompatibility complex (MHC) molecules on the surface of an antigen-presenting cell (APC) induces the formation of the immune synapse (IS). The IS is a specialized cell-cell interface contact area that provides a signalling platform for integration of signals leading to intercellular information exchange, in order to ensure efficient TCR signal transduction, T cell activation and the proper execution of diverse T lymphocyte effector functions (1). Comprised among these functions, IS formation triggers the convergence of T lymphocyte secretory vesicles, including multivesicular bodies (MVB) (2) (3), towards the microtubule-organizing center (MTOC) and the polarization of MTOC together with secretory vesicles to the IS (4, 5). The canonical bullseye structure of a mature IS comprises three concentric areas referred to as supramolecular activation clusters (SMACs) that can be discerned based on the specific segregation of TCR, integrins and costimulatory molecules (6). The central supramolecular activation cluster (cSMAC) is enriched in ligand-bound TCR and associated signalling molecules, the peripheral SMAC (pSMAC) in adhesion molecules such as LFA-1, and the outer distal SMAC (dSMAC) in filamentous actin (F-actin) and CD45 (7) (8). IS assembly and subsequent secretory responses are coordinated by both actin and microtubule cytoskeletons, whose interplay regulates the polarized secretory response towards the IS (9) (7). IS formation is associated with an initial increase in cortical actin at the IS (10), followed by a decrease in cortical actin density at the central region of the immune synapse (cIS) including the cSMAC, that contains the secretory domain (11) (12). The partial depletion of F-actin at the cIS has been proposed, apart from allowing the focusing and docking of secretory vesicles for secretion (10), to initiate key subsequent events leading to MTOC polarization and delivery of secretory vesicles, such as lytic granules in cytotoxic T lymphocytes (CTL) (12) and cytokine-containing secretory vesicles in T-helper (Th) lymphocytes (13), to the secretory domain of the IS. The CTL degranulation of diverse secretory lytic granules with MVB structure results in the secretion to the synaptic cleft of Fas ligand (FasL)-containing exosomes (14) (15) (16) (17) (2) (18). These exosomes, along with perforin and granzymes, which are secreted in both soluble and nanoparticulate form in so-called supramolecular attack particles (SMAPs) (19) (20), lead to the induction of target cell apoptosis. In addition, FasL-containing exosomes have been involved in autocrine FasL/Fas dependent, activation-induced cell death (AICD) produced upon TCR triggering (16) (21) (17) (22), an important immunoregulatory event involved in the downregulation of T cell immune responses (23) (24).
We have previously described that cortical actin reorganization at the IS plays an important role in MVB polarized traffic leading to exosome secretion in Th lymphocytes (25) (26) (3). With respect to the molecular cues controlling this process, we have shown that TCR-stimulated protein kinase C δ (PKCδ) regulates cortical actin reorganization at the IS, thereby controlling MTOC/MVB polarization and ultimately leading to exosome secretion at the IS and AICD in Th lymphocytes (25). Moreover, PKCδ is necessary for the polarization of lytic granules and the induction of cytotoxicity by mouse CTL (27, 28), which supports a general role of PKCδ in secretory traffic leading to apoptosis in T lymphocytes. Besides PKCδ, several actin cytoskeleton regulators, including the formin FMNL1 and Diaphanous-1 (Dia1), also regulate MTOC polarization (29) (30) (31). In this context, we have shown both PKCδ-dependent phosphorylation of FMNL1 at the IS and PKCδ-dependent F-actin clearing at the cIS, which participate in MTOC/MVB polarization leading to exosome secretion in CD4+ Jurkat T lymphocytes forming IS (25) (26) (3). However, a formal connection between FMNL1 phosphorylation, F-actin regulation and MVB polarization/exosome secretion at the IS has not been established yet.
Regarding potential formin regulatory pathways, we have shown that FMNL1, but not Dial, is strongly phosphorylated in T lymphocytes by PKCδ activators such as phorbol myristate acetate (PMA), but also upon TCR stimulation via an anti-TCR agonist as well as IS formation (26). FMNL1 phosphorylation was inhibited in PKCδ-interfered T lymphocytes (26), which is associated with a deficient MTOC polarization towards the IS (25), supporting a PKCδ role in both FMNL1 phosphorylation and MTOC polarization (25) (26). Interestingly FMNL2, a related formin which exhibits a high homology with FMNL1, is phosphorylated by PKCα and, to a lower extent, by PKCδ, at S1072 (32). This phosphorylation reverses FMNL2 autoinhibition mediated by interaction of N-terminal Diaphanous inhibitory domain (DID) with the C-terminal Diaphanous autoinhibitory domain (DAD), resulting in increased F-actin assembly, β1-integrin endocytosis, invasive motility (32) and filopodia elongation (33). In this regard, recent evidence suggests that the mutation of a particular residue in FMNL2 impacting the DID-DAD interaction may result in functional implications for the characteristic actin-regulating activity of FMNL2, specifically in the context of podosome formation in macrophages (34). Out of the three FMNL1 isoforms (α, β and γ) present in T lymphocytes and Jurkat cells (35), S1086 in FMNL1β is surrounded by a sequence displaying high homology to the one surrounding S1072 in FMNL2 (32) (26) (Fig.1). Moreover, we have shown that FMNL1β is the only FMNL1 isoform phosphorylated upon IS formation and capable of recovering MTOC polarization when it was reexpressed in cells simultaneously interfered for the three FMNLl isoforms (26). Thus, we hypothesize that IS-induced, PKCδ-dependent phosphorylation at S1086, a residue located within FMNL1β DAD, may release the autoinhibition mediated by DID/DAD-interaction, thereby leading to the activation of FMNL1β. Consequently, this activation would mediate the F-actin reorganization at the IS and the MTOC/MVB polarization, thereby enabling the subsequent exosome secretion. Here, we report that FMNL1β phosphorylation at S1086 regulates F-actin reorganization leading to MTOC/MVB polarization and exosome secretion.
Results
FMNL1 interference and YFP-FMNL1β variants expression
According to our previous data (26), FMNL1β plays a crucial role in MTOC polarization towards the IS. Moreover, we have also shown that FMNL1β is strongly phosphorylated in T lymphocytes by PKCδ activators such as PMA, as well as by TCR stimulation and upon IS formation, which could potentially be related to FMNL1β activation (26). As previously stated, FMNL2 becomes active upon PKCα phosphorylation at S1072, enhancing F-actin assembly (32) (33). In FMNL1β, Si086 in arginine-rich DAD (labelled in Fig. 1) is surrounded by a sequence displaying high similarity to that around S1072 in FMNL2 (36) (32) (26) (Fig. 1A). Thus, we hypothesized that phosphorylation of FMNL1β at Si086 may release DID-DAD auto-inhibition, thereby activating FMNL1β and regulating MTOC polarization. To address this point, we introduced Si086A and Si086D mutations in the shFMNL1-HA-YFP-FMNL1β construct (35) (26), which act as non-phosphorylatable and phosphomimetic residues, respectively (Fig. 1B). These resulting bi-cistronic vectors produce both FMNL1 interference and the corresponding YFP-FMNL1β variant expression (35), acting as useful tools to analyse the role of FMNL1β in IS formation during transient expression experiments (26). To confirm the previously described efficacy of these vectors (33) (26), we first analysed endogenous FMNL1 interference and YFP-FMNL1β variants expression in C3 Jurkat clone transfected with the different vectors at the single cell level by immunofluorescence, using an anti-FMNL1 antibody that recognizes all its isoforms. This analysis was performed in transfected Jurkat cells forming synapses, to rule out any potential effect of IS formation and subsequent T lymphocyte activation on both endogenous FMNL1 interference and YFP-FMNL1β variants expression. As seen in Fig. 2A, C3 cells transfected with the FMNL1 interfering plasmid shFMNL1-YFP (YFP+ cells) (second row), showed very low anti-FMNL1 signal when compared with non-transfected cells in the same preparation or control YFP− cells (first row). In contrast, cells transfected with YFP-FMNL1βWT, YFP-FMNL1βS1086A or YFP-FMNL1βS1086D (rows three to five, respectively), showed higher anti-FMNL1 fluorescence signals when compared to nontransfected cells in the same microscopy field (Fig. 2A). The Suppl. Fig. S1B shows, by single cell image analysis, that the mean fluorescence intensity (MFI) of the anti-FMNL1 in shFMNL1-YFP-expressing cells is extremely low when compared to the control YFP− group, whereas it is much higher in YFP-FMNL1βWT, YFP-FMNL1βS1086A or YFP-FMNL1βS1086D-expressing cells. As shown in Suppl. Fig. S1A, anti-FMNL1 MFI correlated with YFP-FMNL1p MFI in YFP-FMNL1βWT, YFP-FMNL1pS1086A or YFP-FMNL1βS1086D-expressing cells. To further verify this data, lysates from bulk populations of transfected cells were analysed by western blot (WB) using the same anti-FMNL1 antibody. The apparent molecular weights (MW) of the bands observed in the WB analysis were compatible with the predicted MW of endogenous FMNL1 (150 kDa) and the chimeric YFP-FMNL1β variants (150 + 30 kDa) (Fig. 2B). The endogenous FMNL1 (150 kDa band) levels in lysates from cells transfected with YFP-FMNL1βWT, YFP-FMNL1pS1086A or YFP-FMNL1βS1086D were lower than in control untransfected cells (Fig. 2B). The reduction of endogenous FMNL1 expression, as assessed by WB (between 40–80% reduction relative to control YFP− cells), was apparently lower than that observed by single cell imaging analysis (compare panels A and B in Fig. 2 with Suppl. Fig. S1B). This is not surprising, since the transfection efficiency was relatively low (20–50%) and thus cell populations analysed by WB contained transfected as well as untransfected cells.
YFP-FMNL1βWT is phosphorylated upon PKC activation but neither YFP-FMNL1βS1086A nor YFP-S1086D are
Once the different YFP-FMNL1β variants were expressed, we analysed the ability of a PKCδ activator to induce their phosphorylation. To this end, we stimulated C3 clone transfected with the different constructs with the PKCδ activator PMA, which has been shown to induce strong FMNL1 phosphorylation (26). Subsequently, we immunoprecipitated FMNL1 with an anti-FMNL1 that recognises all FMNL1 isoforms (26) and analysed these immunoprecipitates (IPs) by WB with anti-phospho-Ser PKC substrate (32) (Fig. 3). In all the IPs from PMA-stimulated cells, anti-phospho-Ser PKC substrate detected a band corresponding to endogenous FMNL1 (150 kDa), which was 8- to 30-fold more intense than in IPs from unstimulated cells (Fig. 3, lower graph). In IPs from PMA-stimulated cells expressing YFP-FMNL1βWT, anti-phospho-Ser PKC substrate detected an additional band of the predicted MW (150 + 30 kDa), which was also recognized by anti-FMNL1 (Fig. 3). However, in IPs from PMA-stimulated cells expressing YFP-FMNL1βS1086A or S1086D no apparent phosphorylation of these FMNL1β chimeras could be detected (Fig. 3). Thus, substitution of S1086 by a non-phosphorylatable or a phosphomimetic residue fully abolished PKCδ activator-induced phosphorylation of FMNL1β, as detected by anti-phospho-Ser PKC substrate, confirming our hypothesis that S1086 is indeed the residue that is phosphorylated in FMNL1β upon PKC activation.
S1086 phosphorylation of FMNL1β is crucial for MTOC/MVB polarization towards the IS
Next, we wanted to assess whether S1086 phosphorylation was related to FMNL1β regulation of MTOC/MVB polarization towards the IS. To this end, untransfected (control YFP−) C3 cells, or transfected with the plasmids interfering all FMNL1 isoforms and expressing YFP (shFMNL1-YFP), YFP-FMNL1βWT, YFP-FMNL1βS1086A, or YFP-FMNL1βS1086D (35) were challenged with SEE-pulsed Raji cells (blue). Next, we quantified MTOC/MVB polarization index (PI) in fixed synapses formed by the mentioned cell groups by epifluorescence microscopy and deconvolution, as previously described (37) (25) (26) (Suppl. Fig. S2A, Fig. 4). In the first series of experiments, average MTOC PI of untransfected (Control YFP−) C3 cells forming synapses with unpulsed Raji cells was significantly lower than with SEE-pulsed Raji cells, and similar to MTOC PI of FMNL1-interfered cells (shFMNL1-YFP) forming synapses with SEE-pulsed Raji cells (Suppl. Fig. S2B). This confirms that antigenic stimulation at the IS indeed triggers MTOC polarization and validates our synapse model measurements. In addition, confirming our previous data (26), MTOC/MVB polarization was disrupted upon FMNL1 interference to the levels obtained with unpulsed Raji cells (Fig. 4A, compare the first two rows, Fig. 4B, Suppl. Fig. S2B), and was restored by YFP-FMNL1βWT expression (Fig 4A, third row and 4B). Interestingly, non-phosphorylatable YFP-FMNL1βS1086A expression was unable to restore MVB/MTOC polarization to control levels (Fig. 4A, fourth row and 4B), whereas phosphomimetic YFP-FMNL1βS1086D expression restored MVB/MTOC polarization to the levels achieved by YFP-FMNL1βWT expression (Fig. 4A, fifth row and 4B). Comparable results were obtained by confocal microscopy (Suppl. Fig. S3). From confocal images, en face views of the IS interface were generated (Suppl. Fig. S4, S5 and Suppl. Videos 1 and 2). These images show the polarized MTOC or the accumulation of MVB, respectively, in the cIS region of untransfected (control YFP−) C3 cells or cells expressing YFP-FMNL1WT or YFP-FMNL1S1086D, but not in cells transfected with shFMNL1-YFP or expressing YFP-FMNL1βS1086A. Thus, phosphorylation of S1086 in FMNL1β appears to be essential for secretory polarized traffic towards the IS in T lymphocytes. Moreover, throughout the experiment, we observed that MTOC and MVB were polarizing together towards the IS. This fact, together with the previous work regarding segregation between MTOC movement and secretory granules traffic (13) (28, 38, 39), prompted us to simultaneously analyse both MTOC and MVB positioning with respect to the IS at the single cell level. Remarkably, we observed a robust linear correlations between MVB and MTOC PIs both in untransfected (control YFP−) C3 cells and cells transfected with shFMNL1-YFP (Pearson’s linear correlation coefficients 0.96 and 0.95, respectively, Suppl. Fig. S6). Furthermore, it is noteworthy that MVB and MTOC centers of mass (MVBC and MTOCC, respectively) are very closely located in all the studied cell groups, regardless of polarization state (Fig. 4, Suppl. Fig. S3). Although the MTOC and MVB did not efficiently polarize in cells transfected with shFMNL1-YFP, their MVBC were still located next to MTOCC (Fig. 4A, second row), and equivalent results were obtained in all the analysed cell groups (Fig. 4). Thus, phosphorylation of S1086 in FMNL1β appears to be essential for both MTOC and MVB polarization towards the IS in T lymphocytes.
YFP-FMNL1βS1086D phosphomimetic mutant expression does not rescue MTOC polarization in PKCδ-interfered T lymphocytes
The former results supported the contribution of FMNL1β and its phosphorylation at S1086 to MVB/MTOC polarization, but did not address the sufficiency in this process of PKCδ-controlled, S1086 FMNL1β phosphorylation. In this context, we have previously shown that FMNL1β lies downstream of PKCδ in the same pathway controlling MTOC/MVB polarization (26) (3). Thus, in order to analyse this important issue we transfected the PKCδ-interfered P5 clone with the different plasmids and compared the MTOC PI among the different cell groups, as previously done in C3 clone. We have previously shown that neither PKCδ nor FMNL1 interference affects IS conjugate formation, since P5 clone and FMNL1-interfered C3 clone formed IS with SEE-pulsed Raji cells (25) (26). In addition, IS formed by P5 clone with SEE-pulsed Raji cells (fifth group in Suppl. Fig. S2B) had a MTOC PI comparable to those of IS formed by C3 clone with unpulsed Raji cells or P5 clone with unpulsed Raji cells (first and fourth group, respectively, in Suppl. Fig S2B), supporting that both FMNL1 or PKCδ interference fully inhibited MTOC polarization.
In contrast to what was found in the C3 clone (Fig. 4 and Suppl. Fig. S3), YFP-FMNL1βWT expression in PKCδ and FMNLl-interfered P5 cells did not restore MTOC PI to the values observed in control YFP− C3 cells (Fig. 5), which is compatible with the idea that FMNL1β lies downstream of PKCδ and its phosphorylation is indispensable for MTOC polarization. Consistently, expression of YFP-FMNL1βS1086A, non-phosphorylatable by PKC, was also unable to enhance MTOC PI to the values observed in control YFP− C3 cells (Fig. 5B). Moreover, phosphomimetic YFP-FMNL1βS1O86D expression, which restored MVB/MTOC PI to the values achieved by YFP-FMNL1βWT expression in the C3 clone (Fig. 4 and Suppl. Fig. S3), did not restore MTOC PI in PKCδ and FMNL1-interfered P5 cells to the levels observed in control YFP− C3 cells (Fig. 5B). Taken together, these results show that although FMNL1β phosphorylation at S1086 is necessary, it does not seem to be sufficient for MTOC polarization, at least in cells lacking PKCδ.
FMNL1β translocation to the immune synapse is independent of S1086 phosphorylation and PKCδ
Previous results have shown that FMNL1, apart from being mainly located at the cytosol and centrosomal areas, was also found located at the IS in a small percentage of synaptic conjugates, in end-point IS experiments (29) (26). If confirmed, the possibility of an IS-induced FMNL1 translocation to the IS may provide the molecular basis underlying a potential regulatory effect of FMNL1 on cortical actin cytoskeleton reorganization at the IS as well as on MTOC/MVB and secretion granule polarization, occurring both in CTL and Th cells, as suggested by several authors (9, 12) (13) (40) (3). However, although it could be inferred (29) (41) that the active translocation of any FMNL1 isoform from cytosol towards the IS is induced upon IS formation, it has not been formally demonstrated yet (29) (41). This is probably due to the fact that most early studies have used an end-point approach that does not allow to analyse the incipient IS (29) (42) (43) (44). Since FMNL1β is responsible for MTOC/MVB polarization to the IS (44), we analysed FMNL1β subcellular location in developing synapses by time-lapse, epifluorescence microscopy (43) (44). For this analysis, FMNL1-interfered, YFP-FMNL1βWT-expressing C3 clone was challenged with SEE-pulsed Raji cells. As evidenced in the example shown in Suppl. Video 3 (upper panel) and Fig. 6A (upper row), a transient relocation of initially cytosolic YFP-FMNL1βWT to the IS (white arrow) was observed in these cells. The average (±SD) duration of YFP-FMNL1βWT accumulation at the IS in C3 clone was around 6 min (6 min 18 s ± 1 min 34 s, n=6 synapses).
Considering the major role of PKCα in FMNL2 relocation from the plasma membrane to the endosomal membrane (32), the high similarity between FMNL2 and FMNL1β C-terminal regions (Fig. 1) and the reported PKCδ-mediated FMNL1β phosphorylation (26), we next aimed to analyse the role of PKCδ in YFP-FMNL1βWT translocation to the IS. To this end we analysed YFP-FMNL1βWT translocation upon IS formation in the PKCδ-interfered P5 clone (25) (Suppl. Video 3 and Fig. 6A). The results in P5 clone showed a clear translocation of YFP-FMNL1WT to the IS (white arrow), with an accumulation of around 8 minutes at the IS (8 min 55 s ± 3 min 2 s, n=6 synapses, not significant differences with the C3 clone), so YFP-FMNL1βWT translocation to the IS in P5 and C3 clones showed comparable kinetics.
Moreover, to directly analyse the specific involvement of S1086 phosphorylation in this process, we challenged FMNLl-interfered, YFP-FMNL1βS1086A and YFP-FMNL1βS1086D-expressing C3 cells with SEE-pulsed Raji cells. As shown in Suppl. Video 4 and Suppl. Fig. S7, both YFP-FMNL1βS1086A and YFP-FMNL1βS1086D transiently relocated to the IS. The average time of YFP-FMNL1βS1086A accumulation at the IS was around 7 min (7 min 30 s ± 1 min 58 s, n=6 synapses), whereas YFP-FMNL1βS1086D showed an average accumulation time of around 6 min (6 min 52 s ± 2 min 9 s, n=7 synapses; not significant differences between YFP-FMNL1βS1086A and YFP-FMNL1βS1086D, nor between any of the mutants and YFP-FMNL1βWT). Therefore, these results confirm that the translocation and accumulation of FMNL1β in the IS region of Jurkat cells is a process that occurs independently of both PKCδ and S1086 FMNL1β phosphorylation.
A more detailed study of subsynaptic location of endogenous FMNL1 in C3 control clone using fixed synapses demonstrated that FMNL1 accumulated at the cIS (Fig. 6B, first row) but also at the edges of the synapse, around the dSMAC, both in C3 control clone (Fig. 6B, first and second rows) and in P5 PKCδ-interfered clone (Fig. 6B, third and fourth rows). At these subsynaptic locations, FMNL1 colocalized with F-actin (white pixels), which is compatible with the idea that FMNL1 regulates F-actin at the IS.
Subsequently, we studied the subsynaptic locations of YFP-FMNL1βWT, YFP-FMNL1βS1086A, and YFP-FMNL1βS1086D in C3 control clone, to identify whether S1086 phosphorylation affected these locations. The results from fixed synapses, obtained through both epifluorescence (Suppl. Fig. S7 and S8) and confocal microscopy (Suppl. Fig. S9), revealed the presence of accumulations of the three YFP-FMNL1β variants in the IS. Additionally, in Suppl. Fig. S9, it can be observed that the three YFP-FMNL1β variants colocalized with F-actin at the IS.
Taken together, these observations show that, upon IS formation, FMNL1β translocates to the IS, with both PKCδ and S1086 phosphorylation being dispensable for the translocation to the IS of both endogenous FMNL1 and YFP-FMNL1β variants.
S1086 phosphorylation of FMNL1β is necessary for cortical F-actin reorganization during MTOC/MVB polarization
The observations that YFP-FMNL1β translocated to the IS, that cortical F-actin remodelling was considered to be sufficient for centrosome polarization in CTL (12), and that cortical F-actin remodelling was associated with MTOC and secretory granule polarization in CD4+ cells (13) (45), prompted us to study a potential role of FMNL1β and its phosphorylation at S1086 in synaptic F-actin architecture. To address this point, fixed synapses formed by the C3 clone transfected with the previously described plasmids were stained with phalloidin AF647 to label F-actin and imaged by confocal fluorescence microscopy. The relative area of the F-actin-low region at the cIS (Fact-low cIS area / IS area) in the IS interface, which mirrors cortical F-actin reorganization at the IS, was measured as indicated in Materials and Methods and represented for all cell groups. As seen in a representative example in Fig. 7A, the dot plot in Fig. 7B and Suppl. Video 5, the F-actin-low region at the cIS was smaller in FMNL1-interfered cells than in untransfected control YFP− cells (Fig. 7A, second and first columns, respectively), as it was also in PKCδ-interfered cells (25) (26). Of note, YFP-FMNL1βWT expression restored F-actin depletion at the cIS to control levels (Fig. 7B). In contrast, YFP-FMNL1βS1086A expression did not rescue F-actin depletion to control levels (Fig. 7B), whereas YFP-FMNL1βS1086D did rescue F-actin depletion to control levels (Fig. 7B). Thus, FMNL1β phosphorylation at S1086 appears to be necessary for F-actin reorganization at the IS, as it was for MTOC/MVB polarization (Fig. 4).
Three-dimensional FMNL1β distribution at the synapse
We observed a positive effect of FMNL1β phosphorylation at S1086 on cortical F-actin rearrangement at the IS (former paragraph and Fig. 7) and YFP-FMNL1β translocated to the central IS, but also to the dSMAC (Suppl. Video 3 and 4, Fig. 6 and Suppl. Fig. S7 S8 and S9). To investigate this further, we analysed in more detail the subsynaptic distribution of the endogenous FMNL1, YFP-FMNL1βWT, and the YFP-FMNL1βS1086A and S1086D mutants with respect to the actin cytoskeleton. To this end, fixed synapses formed by the C3 clone transfected with the different plasmids were stained with phalloidin, anti-FMNL1 and anti-phospho-Ser PKC substrate antibody and imaged by confocal fluorescence microscopy (Suppl. Videos 6 and 7, Fig. 8 and Suppl. Fig. S10). Figs. 8A and 8B show representative examples of synaptic conjugates yx views (first row) and cropped synapse areas (white rectangles in first row) used to generate zx IS interfaces (second row), as shown in Suppl. Video 6 and 7. Subsequently, the colocalization pixels (white) along all the Z-stack at the IS interface (interface colocalization) were determined as indicated in Materials and Methods. This involved merging the indicated fluorescence channels (Fig. 8A, second row, F-actin in blue and anti-FMNL1 in red; Fig. 8B, second row, F-actin in blue and YFP fluorescence in green) on the IS interfaces of the synaptic areas generated as shown in Suppl. Video 6. MFI profile of each channel (F-actin in blue, anti-FMNL1 in red, YFP in green and colocalization in grey) along the indicated white arrows are shown below each IS interfaces. As shown in Fig. 8, and consistently with results from Fig. 7, both control YFP− (first column) and YFP-FMNL1βWT-expressing cells (third and fourth columns) exhibited a wide F-actin depletion area at the cIS and an F-actin accumulation at the dSMAC. Interestingly, in some synapses from control YFP− (first column) and YFP-FMNL1βWT-expressing cells (fourth column), F-actin and FMNL1 colocalized (white pixels) at certain small areas at the wide F-actin-low region at the cIS, although the MFI profiles show relatively less F-actin and FMNL1 at the cIS than at the dSMAC. In other synapses from both control YFP-(not shown) and YFP-FMNL1βWT-expressing cells (third column), F-actin and FMNL1 colocalization occurred at the F-actin rich-area corresponding to the dSMAC (Fig. 8A), which was consistent with the data from Fig. 6B. In contrast, and consistently with Fig. 7, FMNL1-interfered cells (Fig. 8, second column) displayed small F-actin low areas at the cIS. Moreover, synapses from YFP-FMNL1βS1086A-expressing cells (fifth column) did not exhibit the F-actin depletion at the cIS, whereas synapses from the YFP-FMNL1βS1O86D-expressing cells (sixth column) exhibited wide F-actin depletion at the cIS, comparable to those observed in the control YFP- and in the YFP-FMNL1βWT-expressing cells (Fig. 8). In cells expressing the YFP-FMNL1β variants, colocalization of all the YFP-FMNL1β variants with F-actin was mainly in the F-actin low area at the cIS or at the dSMAC. When colocalization in all Z optical sections was assessed using directly the YFP fluorescence construction instead of anti-FMNL1 signal (Fig. 8B, second row, F-actin in blue and YFP fluorescence in green), comparable results were obtained. In addition, we analysed the subsynaptic location of FMNL1 with respect to Ser-phosphorylated PKC substrates by using an anti-FMNL1 and an anti-phospho-Ser PKC substrate. Both endogenous FMNL1 in control YFP-cells (Suppl. Video 7 and Suppl. Fig. S10A, first column) and YFP-FMNL1βWT in YFP-FMNL1βWT+ cells, (Suppl. Fig. S10A, third column) strongly and specifically colocalized with anti-phospho-Ser PKC substrate at the cIS. This is evidenced by the accumulation of white, colocalization pixels at low FMNL1 density areas located at the cIS, which is also an F-actin-low area (Fig. 8, see MFI profiles for control YFP− and YFP-FMNL1βWT+ cells). When colocalization at the synapse interface was assessed using directly the YFP fluorescence construction instead of anti-FMNL1 signal (Suppl. Fig. S10B second row, anti-phospho-Ser PKC substrate in blue and YFP construction in green and Suppl. Video 7) comparable results were obtained. In addition, as expected and as a negative control, no colocalization of FMNL1 and anti-phospho-Ser PKC substrate was observed in FMNL1-interfered cells (Suppl. Fig. S10 and Suppl. Video 7, second column), which is compatible with the idea that both endogenous FMNL1 and YFP-FMNL1βWT are specifically phosphorylated at the cIS.
S1086 phosphorylation of FMNL1β regulates exosome secretion
The aforementioned results support that FMNL1β and its phosphorylation at S1086 are involved in MTOC/MVB polarized traffic to the IS, most probably via control of F-actin rearrangement at the IS. MVB transport and fusion to the plasma membrane are necessary for exosome secretion (46) (22) and PKCδ controls F-actin depletion at the cIS (25), thus, it is conceivable that FMNL1β may control subsequent exosome secretion at the IS. To directly analyse FMNL1β contribution to exosome secretion, we used an exosome secretion reporter assay. We transiently cotransfected C3 clone with the exosome reporter GFP-CD63 expression plasmid (2) (47) and the different shFMNL1-YFP constructs. Subsequently, IS were formed between the cotransfected C3 clone and SEE-pulsed Raji cells, exosomes were purified from cell culture supernatants (2), lysed, and exosome lysates were analysed by anti-CD63 WB. This secretion assay excludes the detection of exosomes released by Raji cells in the coculture, that otherwise may mask the exosomes released by Jurkat cells (2) (22). In parallel, we determined nanovesicle concentrations in coculture supernatants by using Nanoparticle Tracking Analyses (NTA) (Fig. 9A). Anti-CD63 WB analysis of exosome secretion is shown in Fig. 9B. We normalized exosomal GFP-CD63 signal to the transfection efficiency of the exosome reporter (measured by GFP-CD63 signal from cell lysates) and the number of viable exosome-secreting cells (Fig. 9B). As shown in Fig. 9, interference with all FMNL1 isoforms not only reduced exosomal GFP-CD63 levels, but also reduced SEE-stimulated nanovesicle concentration increase. These results mirrored those obtained in cells in PKCδ-interfered cells (25). Moreover, interference with all FMNL1 isoforms and YFP-FMNL1βWT expression recovered exosome secretion to the levels produced by control YFP− cells. However, YFP-FMNL1βS1086A expression did not recovered exosome secretion, whereas YFP-FMNL1βS1086D expression rescued exosome secretion to the values observed in control YFP− or YFP-FMNL1βWT-expressing cells (Fig. 9B). Taken together, these results on exosome secretion endorse the outcomes regarding FMNL1 interference and FMNL1β- mediated control of cortical F-actin reorganization at the IS and their role on MVB polarized secretory traffic.
Discussion
Our previously published results suggest that PKCδ-dependent phosphorylation of FMNL1β may regulate its function in F-actin reorganization at the IS and hence affect MTOC polarization (25) (26). Here, we have identified for the first time a positive regulatory role of FMNL1β phosphorylation at S1086 in cortical F-actin regulation that governs MTOC/MVB polarization and exosome secretion at the IS in Th lymphocytes. Moreover, the fact that the phosphomimetic YFP-FMNL1βS1086D expression in PKCδ and FMNL1-interfered cells, did not recover the MTOC PI observed in C3 control cells (Fig. 5) supports the idea that FMNL1β phosphorylation at S1086 is necessary but not sufficient for MTOC polarization, at least in cells lacking PKCδ. Thus, these results support that another signal, apart from PKCδ activation, or another PKCδ-controlled pathway not involving FMNL1β phosphorylation, evoked upon TCR triggering at the IS, is also implicated in MTOC/MVB polarization to the IS.
Regarding actin cytoskeleton regulation and the molecular mechanisms involved in MTOC polarization, it is remarkable that, while cortical F-actin remodelling has been considered to be sufficient for centrosome polarization, at least in CTL (12), several lines of evidence indicate that, in certain conditions (such as absence of Arp2/3), MTOC polarization may occur normally in the absence of any cortical F-actin reorganization (29). In addition, several studies indicated that the MTOC is an F-actin organizing center (48), and F-actin depletion around the MTOC crucially facilitates MTOC polarization to the IS in B-cell receptor (BCR)-stimulated B lymphocytes (49) (50). More recently, these studies have been extended to MTOC polarization in T lymphocytes, since F-actin clearance from the centrosomal area has been recently shown to occur during IS formation with APC (26) (51). Taking all these observations together, it is clear that MTOC and MVB polarization induced by IS formation are regulated by HS1/WASp/Arp2/3-dependent cortical and non-cortical centrosomal actin networks, and that PKCδ appears to coordinately regulate the reorganization of both actin networks via paxillin phosphorylation at T538 and FMNL1β phosphorylation at S1086 (3) (26) (51) (52). Thus, TCR-controlled, PKCδ-induced paxillin phosphorylation at T538 could be the abovementioned additional PKCδ-controlled pathway not involving FMNL1β phosphorylation that may collaborate with phosphorylated FMNL1β in MTOC polarization. In this context, the existence of an F-actin network around the centrosome (48) involved in MTOC polarization to the IS (49) (26) has added a new level of complexity to the regulation of this process (52). The observation of the impact of PKCδ- mediated phosphorylation of S1086 in YFP-FMNL1βWT on the recovery of the F-actin low area at the cIS (Fig. 7), associated with the restoration of MTOC polarization (Fig. 4), does not exclude the possibility that S1086 phosphorylation in FMNL1β may also play a role in the clearance of F-actin around the MTOC, collaborating with the depletion of cortical F-actin at the cIS in MTOC polarization. Thus, more experiments are needed to address the possibility that S1086 phosphorylation in FMNL1β may affect centrosomal area F-actin, together with cortical F-actin, since reorganization of these two distinct, Factin networks collaborate in MTOC polarization (26) (49) (52) (53).
In addition, a further level of complexity regarding FMNL1 activities and their regulation in the context of T cell activation relies on the existence of three different FMNL1 isoforms in T lymphocytes (α, β and γ) (35), showing full sequence identity from N-terminus up to T1070, but diverging C-terminal domains (Fig. 1) (36). These differences most probably underpin the diverse subcellular distribution of the three isoforms, which appear to distribute differentially within the cytosol, MTOC, cortical actin at the IS and Golgi, exerting distinct roles in the functions and subcellular distribution of these subcellular organelles (29) (35) (26) (this article). In this context, it is important to clarify that, out of the three FMNL1 isoforms, FMNL1β is the only one capable of restoring MTOC polarization when reexpressed, and the only one that undergoes PKCδ-mediated phosphorylation upon PKC activation and IS formation (26). This illustrates the finely tuned and specific involvement of FMNL1β in secretory polarized traffic in T lymphocytes.
Our results on FMNL1β phosphorylation are certainly related to what was found in formin homology domain protein 1 (FHOD1) regulation. FHOD1 is grouped into Dia-related formins (54). FHOD1 requires active Rac to be recruited to the plasma membrane, but its recruitment appears insufficient for FHOD1 activation, which is achieved only after being phosphorylated by Rho-dependent protein kinase (ROCK) at three serine and threonine sites included in a polybasic arginine-rich region inside the C-terminal DAD (55), leading to disruption of FHOD1 autoinhibitory state and F-actin stress fiber formation (55). This activation process is similar to what we have described in this article for FMNL1β. Moreover, the PKC-dependent mode of FMNL2 activation during integrin activation (32) and filopodia formation (33) is comparable to what we have found in FMNL1β during polarized traffic to the IS. Furthermore, FHOD3 formin is also autoinhibited by an intramolecular interaction between its C- and N-terminal domains. Phosphorylation of the three highly conserved residues (Si406, Si4i2, and Ti4i6) within the polybasic, C-terminus of FHOD3 by ROCK1/2 is sufficient for its activation and is crucial in regulating myofibrillogenesis in cardiomyocytes (56). Thus, with the results provided here for FMNL1 p, it has been reported that at least four different formins are activated through phosphorylation by three different kinases at the C-terminal polybasic regions, which are included in a common DAD. This underscores the evolutionary importance of this regulatory mechanism in formin activation, ultimately leading to very diverse cellular responses. However, although we do not have conclusive evidence supporting that PKC directly phosphorylates FMNL1β, the presence of a conserved S1086 within a RRSV/AR motif that contains a potential target for classical PKCs (32, 33, 57), along with the recognition of the phosphorylated residue by a validated anti-Phospho-Ser PKC substrate antibody (32), certainly support this possibility.
With regards to potential regulatory pathways involved in formin activation and subcellular localization, it is remarkable that the most abundant formins in T lymphocytes, Dia1 and FMNL1 (29), are constitutively inactive in the cytoplasm due to intramolecular DAD-DID binding, which blocks formin ability to nucleate and elongate actin filaments (7). Regarding a possible control of formin subcellular location by PKC, it has been shown that both relocation of FMNL2 from the plasma membrane to the endosomal compartment and activation are dependent on C-terminal S1072 phosphorylation by PKCα (32). However, FMNL2 location in filopodia seems to be independent of the phosphorylation state (33). We have previously described PKCδ- dependent phosphorylation of FMNL1β (26), and here we have here demonstrated that this phosphorylation occurs at S1086, leading to F-actin reorganization at the IS, and resulting in MTOC polarization. However, in contrast to FMNL2 relocation, which is dependent on PKCα, we have shown that transient YFP-FMNL1βWT relocation from cytosol to the IS occurred in the absence of PKCδ (Fig. 6), in conditions where neither Factin reorganization (25) nor MTOC polarization (Fig. 5) occurred. Moreover, both YFP-FMNL1βS1086A and YFP-FMNL1βS1086D translocated to the IS (Suppl. Video 4 and Suppl. Fig. S7), demonstrating that S1086 phosphorylation is not required for IS location. However, as it happens during S1072 phosphorylation in FMNL2 (32), it is possible that blocking phosphorylation at S1086 through the introduction of single point mutations (YFP-FMNL1βS1086A or YFP-FMNL1βS1086D) may not block FMNL1p translocation to the IS per se, but may alter the kinetics of the process. For this reason, in future approaches, a thorough study on the kinetic considerations on S1086 PKCδ- mediated phosphorylation contribution to FMNL1p translocation to the IS will need to be addressed. Regarding FMNL1p translocation, the early reports (29) did not demonstrate IS-induced FMNL1p relocation, most probably because the establishment of a mature, fully productive IS, is intrinsically a stochastic, rapid and asynchronous process difficult to image at its initial stages (43). Moreover, most early reports used an end-point approach that forces cell conjugate formation by centrifugation (42), and this approach does not allow to analyse incipient IS (42) (43) (44). We have circumvented this caveat by using living cell imaging of spontaneously formed, emerging IS at high temporal resolution (43). In this manner, we have observed that the average duration of YFP-FMNL1βWT accumulation at the IS is short, around 6 min. The low fraction of synaptic conjugates displaying endogenous FMNL1 at the synapse in endpoint experiments (approximately 10%, not shown) is consistent with such a short duration for transient YFP-FMNL1βWT translocation to the IS. We have performed some preliminary experiments analyzing the subcellular localization of FMNL1 in chimeric antigen receptor-bearing T lymphocytes (CAR T) with dual targeting of CD19/CD22, forming synapses with CD19+/CD22+ Raji cells used as CTL targets. We observed, in fixed-cell images, the presence of endogenous FMNL1 in the IS region of CAR T cells, which also exhibited MTOC polarization towards the synapse (not shown). This observation extends our results on FMNL1 localization at the IS in a synapse model, supporting that it may also occur in synapses developed by primary human T lymphocytes.
Although the mechanism(s) involved in FMNL1β recruitment to the IS remains unclear, it is probably that it involves Rac1 and Cdc42 small G proteins (30) (29) (58), which are activated at the IS upon TCR triggering (59). However, we cannot exclude the participation of another PKC isoform or a different protein kinase that may induce FMNL1β phosphorylation in different residues upon previous FMNL1β relocation to the IS primed by small G protein, as was shown for FMNL2 relocation (32). Further experiments are needed to establish this important point.
Taken together, our results support that IS-induced, PKCδ-dependent phosphorylation of S1086 in FMNL1β DAD, most probably executed by PKCδ itself, activates FMNL1β, which in turn regulates cortical actin at the IS and hence controls MTOC/MVB polarization and exosome secretion. The behaviour of non-phosphorylatable YFP-FMNL1βS1086A (equivalent to FMNL2-S1072A described in (32)) confirms this hypothesis, since its expression inhibits F-actin reorganization at the IS, MTOC polarization and exosome secretion. In this respect, it has been reported that the phosphorylation of FMNL2 by PKCα in S1072 is necessary for the secretion of the pro-metastatic factor Angiopoietin-like 4 (ANGPTL4) in breast cancer cells (60), which constitutes the first description for an activated formin involvement in secretion during cell invasion. In addition, ANGPTL4 can be secreted into exosomes by lung cancer cells (61) (62) and FMNL2 controls exosome secretion (63). Thus, although it is not clear whether ANGPTL4 is released in exosomes or in soluble form (60), both FMNL2 and FMNL1β appear to control PKC-regulated exosome secretion. However, the extracellular signals evoking exosome secretion are strikingly different in the various cell types, since in tumor cells hypoxia and radiation can amplify the otherwise constitutive and multidirectional exosome secretion, whereas T lymphocytes constitutively secrete very low levels of exosomes and none in a polarized manner unless activated trough TCR or synaptic contact (22). Taken together, these considerations support a more general role of the formin-actin cytoskeleton axis in exosome secretion. Given all these considerations, it will be interesting to analyse the role of FMNL2 in inducible exosome secretion at the IS in T lymphocytes, but also the role of FMNL1β in exosome secretion by cancer cells during cell invasion. This is particularly relevant as exosome secretion is required for directionally persistent and efficient in vivo movement of cancer cells (64), and it is known that FMNL1 stimulates both leukemia cell proliferation and migration (58) (65).
The fact that FMNL1- and PKCδ-interfered cells have a similar phenotype to that of FMNL1- or PKCδ-interfered cells (26) (25) (this paper), supports the notion that PKCδ and FMNL1β participate in the same F-actin regulatory pathway controlling MTOC/MVB polarization. Additional experiments involving in vitro measurements of F-actin reorganizing/severing activities of the diverse FMNL1β variants, phosphorylated or not in vitro by PKCδ, will be necessary to address whether PKCδ directly phosphorylates FMNL1β at S1086.
Our findings show that FMNL1 colocalizes with F-actin at the IS edges which are part of the dSMAC (Figs. 6, 8). This data are aligned with the previous observation that Dia1 and FMNL1 are intrinsically inactive because they undergo intramolecular folding and remain in the cytoplasm (7) and that after IS formation, they are enriched at the tips of F-actomyosin spikes at the outer edge of the dSMAC, giving rise to the actomyosin arcs at the pSMAC in the IS formed by Jurkat cells (41) (7). Dia1 is not a target of PKC, whereas FMNL1 is phosphorylated by PKC activation (26). Thus, in this paper we have focused on FMNL1. High resolution, spatio-temporal analysis of FMNL1β localization at the different subsynapic locations, together with superresolution techniques (41) (43) may provide new clues regarding the subsynaptic F-actin network targeted by phosphorylated FMNL1β. Even although the nature of the downstream effectors and consequences of FMNL1β phosphorylation on synaptic F-actin architecture can only be speculated at this point, concentric actomyosin arcs generated by FMNL1 propel TCR microclusters towards the IS and reinforce cytotoxicity (41) (7). Thus, high-resolution spatiotemporal analysis of actomyosin arcs structure and function during TCR microcluster movement in FMNL1-interfered cells, and/or cells expressing the FMNL1β mutants described here, will provide important clues on this important matter. It is noteworthy that a majority of the image analysis of IS organization and F-actin dynamics is based on planar synapses obtained using artificial APC substitutes, by either coating stimulatory and co-stimulatory molecules on glass or plastic surfaces or by embedding these molecules into lipid bilayers (66) (7) (53). These artificial synapses can indeed be imaged and analysed with the highest possible resolution (67) (41) (43). However, the cell-cell synapse model analysed here mimics the complex interactions and irregular, 3D stimulatory surface of a physiological synapse better than artificial synapses do (66) (7). In this important sense, the data presented here are indeed closer to a physiological situation. In addition, since actomyosin arcs arise from active, formin-dependent nucleation sites at the outer edge of the dSMAC (41), it will be interesting to analyse, using superresolution techniques, whether phosphorylated FMNL1β is located at these sites. Indeed, actomyosin arc network spanning from dSMAC along the pSMAC is the most likely source of T cellbased force that augments cytotoxicity by straining the target cell plasma membrane (7). Thus, it will be interesting to study the effect of FMNL1β mutants on actomyosin arcs formation and analyse functional deficiencies (i.e., decreased T cell-APC adhesion frequency, IS size and IS formation efficiency) in IS formed by cells interfered in FMNL1β and/or expressing the FMNL1β variants described here. Visualization of actin and actomyosin networks, TCR microclusters and secretion granules dynamics in “real” live T cell-APC conjugates at the superresolution level (7) is clearly needed to advance in this area.
Rermarkably, although it has already been shown that FMNL1 is important for MTOC polarization in Jurkat cells and for target cell lysis in CTL (29), our data provide the first molecular basis underpinning this essential FMNL1 function. Here, we demonstrate that FMNL1β and its phosphorylation at S1086 participate in F-actin-controlled, polarized MVB traffic secreting effector exosomes (2, 17), which deliver proapoptotic signals to target cells (19) (68) (20). In addition, FMNL1 promotes proliferation and migration of leukemia cells (58) and mediates posterior perinuclear actin polymerization to promote T lymphocyte effector cell migration to inflammatory sites to enable T cell-mediated autoimmunity (65). PKCδ is crucial for directional T cell migration (69) (70) and this process requires MVB polarized traffic and exosome secretion in the direction of migration (64). For that reason, it will be interesting to analyse the effects of the FMNL1 p mutants we have described here during T lymphocyte migration and tumorigenesis, as well as to study the role of FMNL1β phosphorylation in several autoimmune disorders.
In addition, improving our understanding of the molecular bases underlying the traffic events involved in polarized secretion of pro-apoptotic exosomes as we have performed here will provide clues to modify crucial immune functions involving apoptosis, such as cytotoxicity by CTLs and immunoregulatory AICD and their associated pathologies (17) (71) (2) (18) (25) (72) (73).
Materials and methods
Cells
Raji B cell line was obtained from the ATCC. Cell lines were cultured in RPMI 1640 medium containing L-glutamine (Invitrogen) with 10% heat-inactivated FCS (Gibco) and penicillin/streptomycin (Gibco). Jurkat control (C3 clone) and PKCδ-interfered (P5 clone) stable clones have already been described and were cultured with puromycin (25).
Plasmids and transient transfection
pEGFP-C1CD63 (expressing GFP-CD63) was provided by G. Griffiths. CD63 is an enriched marker in intraluminal vesicles (ILVs) contained into MVB and exosomes and has been widely used to study MVB secretory traffic in both living and fixed cells (2, 17). The FMNL1 interfering vector (shFMNL1-HA-YFP) and FMNL1-interfering, YFP-FMNL1βWT expressing vector (shFMNL1-HA-YFP-FMNL1βWT) were previously described (35) and generously provided by Dr. Billadeau. shFMNL1-HA-YFP-FMNL1βS1086A and shFMNL1-HA-YFP-FMNL1βS1086D mutants were generated by site-directed mutagenesis, as previously reported (74). Briefly, overlap extension PCR was used to introduce the desired mutations into a 900 bp SalI-NotI fragment, which was then used to replace the corresponding wild type sequence in shFMNL1-HA-YFP-FMNL1β—WT. All amplifications were carried out with Platinum SuperFi DNA polymerase (ThermoFisher). Primers used were: SalI-FMNL1β_F (CCAGAGCCTGGATGCGCTGTTGG), FMNL1 p-S 1086A_F (CAGACACAGGCCGCCGCGCTGCCCGTCGGCGTCCC), FMNL1p-S1086A_R (GGGACGCCGACGGGCAGCGCGGCGGCCTGTGTCTGC), FMNL1p-S1086D_F (CAGACACAGGCCGCCGCGATGCCCGTCGGCGTCCC), FMNL1p-S1086D_R (GGGACGCCGACGGGCATCGCGGCGGCCTGTGTCTGC), and NotI-FMNL1p_R (GCGAGCTCTAGGGCCGCTTGCG). Presence of the desired mutations, and absence of undesired ones, was confirmed by Sanger DNA sequencing (Eurofins Genomics, LightRun). Both interference and expression of the different chimeric molecules were assessed in single cells level by immunofluorescence and/or bulk cell populations by WB with an anti-FMNL1 antibody, which recognizes all FMNL1 isoforms (see below). Jurkat clones were transiently transfected with 20–30 μg of the plasmids as described (17). To analyse the effects of shFMNL1 constructs on exosome secretion by Jurkat cells expressing exosome reporter GFP-CD63, Jurkat cells were transiently co-transfected with a three-fold molar excess of the different shFMNL1-YFP plasmids with respect to the GFP-CD63 exosome-reporter plasmid, to favor that the exosomes analysed were mainly those secreted by Jurkat cells containing both the GFP-CD63 plasmid and the shFMNL1 construct (2) (18).
Antibodies and reagents
Rabbit monoclonal anti-human PKCδ EP1486Y for WB that does not recognize mouse PKCδ (Abcam). Rabbit monoclonal anti-PKCδ EPR17075 for WB that recognizes both human and mouse PKCδ (Abcam). Mouse monoclonal anti-human CD3 (clone UCHT1) for cell stimulation and immunofluorescence (BD Biosciences and Santa Cruz Biotechnology). Mouse monoclonal anti-FMNL1 clone C-5 for WB and immunofluorescence and mouse monoclonal anti-FMNL1 clone A-4 for immunoprecipitation (Santa Cruz Biotechnology), recognizing all FMNL1 isoforms. Mouse monoclonal anti-y-tubulin for immunofluorescence (SIGMA, clone GTU-88).
Rabbit polyclonal anti-pericentrin ab4448 for immunofluorescence (Abcam). Mouse monoclonal anti-human CD63 (clone TEA3/18) for immunofluorescence (Immunostep). Mouse monoclonal anti-CD63 clone NKI-C-3 for WB (Oncogene). Rabbit polyclonal Phospho-Ser PKC substrate antibody for WB and immunofluorescence (Cell Signalling Technology, #2261). Fluorochrome-coupled secondary antibodies (goat-anti-mouse IgG AF488 A-11029, goat-anti-rabbit IgG AF488 A-11034, goat-anti-mouse IgG AF546 A-11030, goat-anti-mouse IgG AF647 A-21236) for immunofluorescence (ThermoFisher). Horseradish peroxidase (HRP)-coupled secondary antibodies (goat anti-mouse IgG-HRP, sc-2005 and goat anti-rabbit IgG-HRP, sc-2004) for WB (Santa Cruz Biotechnology). CellTracker™ Blue (CMAC) and phalloidin (ThermoFisher). Staphylococcal enterotoxin E (SEE) (Toxin Technology, Inc).
Immunoprecipitation
Immunoprecipitation from cell lysates was performed by using Protein A/G Magnetic Beads (Pierce, ThermoScientific) following the instructions provided by the company. Briefly, 0.5 ml lysates corresponding to 2–4x106 transfected Jurkat cells, stimulated or not with PMA (100 ng/ml, 30 min at 37 °C), were incubated with anti-FMNLl (clone A4, 5 μg) for 2 h at 4° C. Subsequently, 15 μl of magnetic beads suspension was added and incubated for 3 h at 4° C. Beads were washed 5x with lysis buffer and the antigens were eluted with 2 M glycine pH =2 and then neutralized. Eluates were run on 6,5 % SDS-PAGE gels and proteins transferred to PVDF membranes.
Isolation and quantification of exosomes
To analyse the exosomes produced by cells transfected with the exosome reporter GFP-CD63, a similar protocol to the originally described for exosome isolation (75) was performed. We have included a 48 h post-transfection Ficoll gradient purification step to remove dead cells and cell debris, which otherwise could contaminate exosome preparations with micro and nanoparticles (2, 18). Using these standard protocols, culture supernatants from Jurkat cells transfected with GFP-CD63 or cotransfected with GFP-CD63 and with a 3-fold molar excess of the different shFMNL1-YFP plasmids, cocultured with SEE-pulsed Raji cells, were centrifuged in sequential steps to eliminate cells and cell debris/apoptotic bodies (75). Subsequently, the exosomes were recovered by ultracentrifugation (100,000xg for 12 h at 4° C) as described (16), lysed and then analysed by WB. CD63 is characteristically present in MVB, ILVs and hence in exosomes, but also in secretory lysosomes and the plasma membrane (Suppl. Video 8). Plasma membrane CD63 localization is produced by degranulation of MVB and diffusion of CD63 from the limiting membrane of MVB to the plasma membrane upon MVB fusion (2, 18) (Suppl. Video 8). Approximately 1–2x106 transfected Jurkat cells were challenged with SEE-pulsed Raji cells and WB signals in exosome lysates were normalized by the cell expression levels of GFP-CD63 among different transfections, cell groups and stimuli, in the WB corresponding to the cell lysates (2, 47) (18). It has been established that the exosomal CD63 WB signal in this synapse model correlates with exosome number obtained by flow cytometry (76), by electron microscopy (77) and by nanoparticle concentration analysis (nanoparticles/ml), using NTA (18). WB analysis of CD63 protein and GFP-tagged CD63 in isolated exosomes has been used as a bona fide method to specifically determine changes in exosome production (17, 47, 78) in transiently-transfected Jurkat cells forming synapses with SEE-pulsed Raji cells without the detection of contaminating exosomes produced by MHC-II-stimulated Raji cells or constitutively secreted by Raji cells (79) (2, 17, 75) (18) (25) (22). No significant differences in the GFP-CD63 levels (i.e. Fig. 9B) were observed in the lysates of transfected C3 Jurkat cells, stimulated or not with SEE-pulsed Raji cells, at the end of the cell coculture period for exosome secretion, showing that the GFP-CD63+ exosomes were produced by an equal number of viable, GFP-CD63-expressing cells. Moreover, to quantify exosome concentration and to analyse their size distribution, the cell culture supernatant collected just before the ultracentrifugation step was diluted (1/5) in Hank’s balanced salt solution (HBSS) and analysed by NTA using a NANOSIGHT equipment (LM10, Malvern) that was calibrated with 50 nm, 100 nm and 400 nm fluorescent calibration beads (Malvern). The hydrodynamic diameter measured by NTA, although apparently higher to that originally described for exosomes using electron microscopy (50–100 nm) (Fig. 9A), certainly corresponds to the real size of canonical, unfixed exosomes in solution, as described (80). The NTA measurements of exosome concentration (particles/ml) were normalized by the transfection efficiency and exosome-producing Jurkat cell number, by referring exosome concentration to GFP-CD63 signals in the WB of the cell lysates (Fig. 9B).
Western blot analysis
Cells were lysed in TritonTM X100-containing lysis buffer supplemented with both protease and phosphatase inhibitors. Approximately 50 μg of cellular proteins were recovered in the 10,000xg pellet from 106 cells. Cell lysates and neutralized, acid-eluted IPs were separated by SDS-PAGE under reducing conditions and transferred to HybondTM ECLTM membranes (GE Healthcare). Membranes were incubated sequentially with the different primary antibodies and developed with the appropriate HRP-conjugated secondary antibody using enhanced chemiluminescence (ECL). When required, blots were stripped following standard protocols prior to reprobing them with primary and HRP-conjugated secondary antibodies. For exosome secretion studies, cells and isolated exosomes were lysed in RIPA lysis buffer containing protease inhibitors. Approximately 5 μg of exosomal proteins were recovered in the 100,000xg pellet from 1–2x106 cells. Exosomes were resuspended in 60 μl of RIPA lysis buffer and 20 μl of exosomal or cell lysate proteins were separated by SDS-PAGE and transferred to HybondTM ECLTM membranes (GE Healthcare). For CD63 detection, proteins were separated under nonreducing conditions as described (17). For WB analysis of exosomes, each lane contained the total exosomal protein that was recovered from the culture medium coming from the same number of cells, untreated or treated with stimuli. Blots were incubated with mouse anti-CD63 (clone NKI-C-3, Oncogene) and developed with the appropriate HRP-conjugated secondary antibody using ECL. Autoradiography films were scanned and the bands were quantified using Quantity One 4.4.0 (Bio-Rad) and ImageJ (Rasband, W.S., ImageJ, National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/, 1997–2004) software.
Time-lapse microscopy, immunofluorescence and image analysis
In the experiments requiring IS formation, we challenged the transfected Jurkat clones with SEE-pulsed Raji cells, a well-established synapse model (81). Raji cells were attached either to ibiTreat microwell culture dishes (ibidi) pretreated with fibronectin (0.1 mg/ml, for paraformaldehyde -PFA- fixation) or glass bottom microwell culture dishes (ibidi) pretreated with poly-L-lysine (0.02 mg/ml, for PFA and acetone fixation). Next, they were labelled with CMAC (10 μM) and pulsed with 1 μg/ml SEE and mixed with Jurkat clones transfected with the different expression plasmids, at 24–48 h posttransfection. The resulting IS were analysed as described (81) (2) (44) (26). PFA followed by acetone fixation was required for a clean FMNL1 staining and was compatible with phalloidin labelling (82). Immunofluorescence of fixed synapses was performed as previously described (83), and additional blocking and fixations steps were performed between each primary antibody and subsequent fluorochrome-coupled secondary antibody or phalloidin staining, to exclude any potential cross-reaction of secondary antibodies (i.e., Fig. 5).
For FMNL1β relocalization experiments in living cells, control (C3) and PKCδ-interfered (P5), YFP-FMNL1β-expressing Jurkat clones were challenged with CMAC-labelled, SEE-pulsed Raji cells as described above. Wide-field, time-lapse microscopy was performed using an OKO-lab stage incubator (OKO) for sample ambient on a Nikon Eclipse TiE microscope equipped with a Prime BSI (Photometrics) digital camera, a PlanApo VC 60x/1.4NA OIL objective (Nikon) and with Perfect Focus System, allowing distinct, appropriate offsets per each XY field. Wide-field fluorescence of fixed synapses was performed by capturing 30–40 Z sections (0.3–0.4 μm thickness) using the same microscope and NIS-AR software (Nikon), and maximum intensity projection (MIP) images of all channels were generated using NIS-AR software.
Time-lapse acquisition during the indicated times and analysis were performed using NIS-AR software (Nikon). Subsequently, in some experiments epifluorescence images were improved by Huygens Deconvolution Software from Scientific Volume Image, using the “widefield” optical option as previously described (43) (44). For quantification, digital images were analysed using NIS-AR (Nikon) or ImageJ software. The quantification and analysis of YFP MFI at the synapse area (YFP-FMNL1β MFI IS) and at the whole cell (YFP-FMNL1β MFI Cell) in time-lapse experiments, were performed within floating regions of interest (ROI) (i.e., ROI changing XY position over time) by using NIS-AR software (Fig. 6A and Suppl. Fig. S7).
Confocal microscopy imaging in fixed synapses was performed by using an SP8 Leica confocal microscope, with sequential acquisition, bidirectional scanning and the following laser lines: UV (405 nm, intensity: 33.4%), supercontinuum visible (633 nm, intensity: 15.2%), supercontinuum visible (550 nm, intensity: 20.8%), supercontinuum visible (488 nm, intensity: 31.2%). Deconvolution of confocal images was performed by using Huygens Deconvolution Software from Scientific Volume Image with the “confocal” optical option. 2D colocalization analyses were accomplished by using JACoP plugin from ImageJ, whereas interface colocalization and the corresponding videos to generate the IS interface were performed using the “colocalization” tool, followed by the “volume view” and then “movie maker” tools from NIS-AR. For interface colocalization analyses, the original emission colors of the different fluorochromes were changed to Red, Green or Blue, since NIS-AR requires and RGB color code for this analyses (84). In particular, F-actin and Phospho-Ser PKC substrate acquired in magenta were changed to blue, and YFP acquired in yellow was changed to green (i.e. Fig. 8, Suppl. Fig. S4, Suppl. Fig. S5 and Suppl. Fig. S10). Profile analyses of MFI corresponding to each separate channel and the colocalization pixels at the IS interface (ZX axes) were performed by using “Intensity Profile” tool in NIS-AR and then Excel, as reported (84). To measure the relative size of the F-actin low area at the cIS, which quantifies the decrease in F-actin density at the cIS, we used the last frame from the former IS interface videos (Suppl. Video 5 and Fig. 7), generated as described (84). The areas of the F-actin-low region at cIS (Fact-low cIS area) (yellow line) and the synapse (IS area) (white line) (i.e., Fig. 7) were defined in ImageJ using the ROI manager and applying an appropriate, manually-defined threshold to the F-actin channel. The definition of the ROI to measure the Fact-low cIS area and the IS area was performed manually or by using automated algorithm “auto-detect ROI/segmentation” from NIS-AR (25) (26). As for the Fact-low cIS area (yellow line) and the IS area (white line) (i.e., Fig. 7), they were defined in ImageJ using the ROI manager and applying a default threshold or, in cases where precise detection was not achieved, an appropriate, manually-defined threshold to the F-actin channel. In both cases, we have found that both manual and automated values were quite similar. The areas included in these ROIs were measured and limited to the defined thresholds, and the relative area of the F-actin-low region at the cIS (Fact-low cIS area / IS area), which is independent of both cell and synapse size, was calculated and represented (Fig. 7). Regarding the possibility that actin cytoskeleton of Raji cells can also contribute to the measurements of synaptic F-actin, it is important to remark that MHC-II-antigen triggering on the B cell side of the Th synapse does not induce noticeable F-actin changes along the synapse (i.e. F-actin clearing at the central IS), in contrast to TCR stimulation on T cell side (85) (86) (3). In addition, we have observed that majority of F-actin at the IS belongs to the Jurkat cell (84). Thus, the contribution to the analyses of the residual, invariant F-actin from the B cell is negligible using our protocol (84).
To compare MTOC and MVB polarization in synapses, MTOC and MVB PI were calculated, as previously described (37) (25) (26) (87) (Suppl. Fig. S2A), using MIP, both for deconvoluted, wide-field, and confocal-acquired images. In the MIP, the positions of the cell geometric center (CellC) and MTOC and MVB center of mass (MTOCC and MVBC, respectively) were used to project MTOCC (or MVBC) on the vector defined by the CellC-synapse axis. Then the MTOC (or MVB) PI was calculated by dividing the distance between the MTOCC (or MVBC) projection and the CellC (“B” or “A” distance, respectively) by the distance between the CellC and the synapse (“C” distance) (Suppl. Fig. S2A, Fig. 4 and Fig. 5). CellC position was taken as the origin to measure distances, thus those “A” and “B” values in the opposite direction to the synapse were taken as negative. Thus, PI (PI = A/C or B/C) ranked from +1 (fully polarized) to −1 (fully antipolarized). Therefore, PI values were normalized by cell size and shape (Fig. 4) (25) (87) and measured the relative ability of MTOC and MVB to polarize towards the IS. Remarkably, one important feature of the IS consists of both the onset of the initial cellcell contacts and the establishment of a mature, fully productive IS, are intrinsically stochastic, rapid and asynchronous processes (88, 89) (43). Thus, the score of the PI corresponding to the distance of MTOC/MVB with respect the IS (42) may be contaminated by background MTOC/MVB polarization, in great part due to the stochastic nature of IS formation (88). In order to circumvent this caveat, a substantial number of IS of each cell group/condition were analysed to obtain statistically significant results, as reported by numerous authors (90) (37) (49) (88) (25) (26). Image analysis data correspond to at least three different experiments, analysing a minimum of 30 synapses from 15 different, randomly selected, microscopy fields per experiment. ANOVA was performed for statistical significance of the results using Excel and IBM’s SPSS Statistics software.
Abbreviations:
AICD: activation-induced cell death
ANGPTL4: Angiopoietin-like 4
APC: antigen-presenting cell
BCR: B-cell receptor for antigen
C: center of mass
CAR T: chimeric antigen receptor-bearing T lymphocytes
cIS: central region of the immune synapse
CMAC: CellTracker™ Blue (7-amino-4-chloromethylcoumarin)
cSMAC: central supramolecular activation cluster
CTL: cytotoxic T lymphocytes
DAD: diaphanous autoinhibitory domain
Dia1: Diaphanous-1
DID: diaphanous inhibitory domain
dSMAC: distal supramolecular activation cluster
ECL: enhanced chemiluminescence
F-actin: filamentous actin
Fact-low cIS: F-actin-low region at the center of the immune synapse
FasL: Fas ligand
FHOD1: formin homology domain protein 1
F-actin: filamentous actin
FMNL1: formin-like 1
fps: frames per second
HBSS: Hank’s balanced salt solution
HRP: horseradish peroxidase
ILVs: intraluminal vesicles
IS: immune synapse
IPs: immunoprecipitates
MFI: mean fluorescence intensity
MHC: major histocompatibility complex
MIP: maximum intensity projection
MVB: multivesicular bodies
MTOC: microtubule-organizing center
MW: molecular weight
NTA: Nanoparticle Tracking Analyses
NS: not significant
PFA: paraformaldehyde
PKC: protein kinase C
PKCδ: protein kinase C δ
PMA: phorbol myristate acetate
PI: polarization index
pSMAC: peripheral supramolecular activation cluster
ROI: region of interest
ROCK: Rho-dependent protein kinase
SD: standard deviation
SEE: Staphylococcal enterotoxin E
SMAC: supramolecular activation cluster
SMAPs: supramolecular attack particles
TCR: T-cell receptor for antigen
Th: T-helper
TRANS: transmittance
WB: western blot
YFP: yellow fluorescent protein.
Acknowledgements
We are indebted and acknowledge Dr. D.D. Billadeau (Mayo Clinic, USA) for generous sharing of shFMNL1 and FMNL1 isoform rescue constructions. We acknowledge the excellent technical support from A. Sánchez. We acknowledge Dr. M.A. Alonso (CBM, CSIC) for reagents and scientific advice. We acknowledge the generous contribution of pre-graduate students Alejandro Martín, Irene Gascuña, Gregorio Pantoja, María Ruiz, Sofía Blázquez, Carlos del Hoyo, Pablo del Barrio and Elena Fernández to this work. Thanks to D. Morales (SIDI-UAM), S. Gutiérrez and A. Oña (CNB, CSIC) for their superb expertise with confocal microscopy. Work in the F.R.G-G lab was funded by grant PID2019-104941RB-I00 from the Spanish Ministry of Science and Innovation (MCIN/AEI/ 10.13039/501100011033). This work was supported by grants from the Programa Estatal de Investigación, Desarrollo e Innovación Orientada a los Retos de la Sociedad (Grant PID2020-114148RB-I00 from the Spanish Ministry of Science and Innovation MCIN/AEI/ 10.13039/501100011033) to MI.
Funding Statement
This work was supported by a grant from the Programa Estatal de Investigación, Desarrollo e Innovación, Modalidad Retos Investigación (Grant PID2020-114148RB-I00 funded by Spanish Ministry of Science and Innovation MCIN/AEI/ 10.13039/501100011033), and grant P2022/BMD-7225, funded by Consortia in Biomedicine of Comunidad de Madrid to MI.
Supplementary information
Supplementary information is available at eLife website
Conflict of Interest
The authors report no conflict of interest.
Data Availability Statement
The materials described in the manuscript, including all relevant raw data, will be freely available to any researcher wishing to use them for non-commercial purposes, without breaching participant confidentiality.
Additional Declarations:
The authors declare no competing interests.
Supplementary Files
This is a list of supplementary files associated with this preprint. Click to download.
Video1FactinMTOCenfaces.avi
Video2FactinCD63enfaces.avi
Video3.avi
Video4CombinedS1086AS1086Dlabels1.avi
Video51.avi
Video6labelsWT.avi
Video7labelsWT.avi
Video8.avi
BinderSupplFigeLife.pdf
References
- 1.Polarized Communication Across the T Cell Immunological SynapseAnnu Rev Cell Dev Biol 32:303–25
- 2.Diacylglycerol kinase alpha regulates the formation and polarisation of mature multivesicular bodies involved in the secretion of Fas ligand-containing exosomes in T lymphocytesCell death and differentiation 18:1161–73
- 3.Role of Actin Cytoskeleton Reorganization in Polarized Secretory Traffic at the Immunological SynapseFrontiers in cell and developmental biology 9
- 4.Origins of the cytolytic synapseNature reviews Immunology 16:421–32
- 5.Microtubule-organizing center polarity and the immunological synapse: protein kinase C and beyondFrontiers in immunology 3
- 6.Three-dimensional segregation of supramolecular activation clusters in T cellsNature 395:82–6
- 7.Origin, Organization, Dynamics, and Function of Actin and Actomyosin Networks at the T Cell Immunological SynapseAnnu Rev Immunol 37:201–24
- 8.Multiple actin networks coordinate mechanotransduction at the immunological synapseThe Journal of cell biology 219
- 9.The role of the cytoskeleton at the immunological synapseImmunological reviews 256:107–17
- 10.Regulation of T-cell activation by the cytoskeletonNature reviews Immunology 7:131–43
- 11.The immunological synapse: a focal point for endocytosis and exocytosisThe Journal of cell biology 189:399–406
- 12.Actin depletion initiates events leading to granule secretion at the immunological synapseImmunity 42:864–76
- 13.Cytokine secretion by CD4+ T cells at the immunological synapse requires Cdc42- dependent local actin remodeling but not microtubule organizing center polarityJournal of immunology 189:2159–68
- 14.Molecules relevant for T cell-target cell interaction are present in cytolytic granules of human T lymphocytesEuropean journal of immunology 19:1469–75
- 15.Cytotoxic T lymphocyte granules are secretory lysosomes, containing both perforin and granzymesJ Exp Med 173:1099–109
- 16.Activated human T cells release bioactive Fas ligand and APO2 ligand in microvesiclesJournal of immunology 163:1274–81
- 17.Diacylglycerol kinase alpha regulates the secretion of lethal exosomes bearing Fas ligand during activation-induced cell death of T lymphocytesThe Journal of biological chemistry 280:28439–50
- 18.Protein kinase D1/2 is involved in the maturation of multivesicular bodies and secretion of exosomes in T and B lymphocytesCell death and differentiation 23:99–109
- 19.Supramolecular attack particles are autonomous killing entities released from cytotoxic T cellsScience (New York, NY) 368:897–901
- 20.The Expanding Arsenal of Cytotoxic T CellsFrontiers in immunology 13
- 21.Differential secretion of Fas ligand- or APO2 ligand/TNF-related apoptosisinducing ligand-carrying microvesicles during activation-induced death of human T cellsJournal of immunology 167:6736–44
- 22.Inducible Polarized Secretion of Exosomes in T and B LymphocytesInternational Journal of Molecular Sciences 21
- 23.Life and death in peripheral T cellsNature reviews Immunology 7:532–42
- 24.Fas and Fas ligand: lpr and gld mutationsImmunology today 16:39–43
- 25.Protein Kinase C delta Regulates the Depletion of Actin at the Immunological Synapse Required for Polarized Exosome Secretion by T CellsFrontiers in immunology 10
- 26.Actin reorganization at the centrosomal area and the immune synapse regulates polarized secretory traffic of multivesicular bodies in T lymphocytesJ Extracell Vesicles 9
- 27.Protein kinase C delta localizes to secretory lysosomes in CD8+ CTL and directly mediates TCR signals leading to granule exocytosis-mediated cytotoxicityJournal of immunology 181:4716–22
- 28.Protein kinase Cdelta regulates antigen receptor-induced lytic granule polarization in mouse CD8+ CTLJournal of immunology 178:7814–21
- 29.Formins Regulate the Actin-Related Protein 2/3 Complex-Independent Polarization of the Centrosome to the Immunological SynapseImmunity 26:177–90
- 30.Formins as effector proteins of Rho GTPasesSmall GTPases 5
- 31.T cell antigen receptor activation and actin cytoskeleton remodelingBiochimica et biophysica acta 1838https://doi.org/10.1016/j.bbamem.2013.05.004
- 32.Formin-like 2 Promotes pi-Integrin Trafficking and Invasive Motility Downstream of PKCaDevelopmental Cell 34:475–83
- 33.Spatiotemporal Regulation of FMNL2 by N-Terminal Myristoylation and C-Terminal Phosphorylation Drives Rapid Filopodia FormationBiomolecules 13
- 34.Characterization of a L136P mutation in Formin-like 2 (FMNL2) from a patient with chronic inflammatory bowel diseasePLOS ONE 16
- 35.Dynamic remodeling of the actin cytoskeleton by FMNL1gamma is required for structural maintenance of the Golgi complexJ Cell Sci 124:3118–26
- 36.Formin-like 1 (FMNL1) is regulated by N-terminal myristoylation and induces polarized membrane blebbingThe Journal of biological chemistry 284:33409–17
- 37.Vamp-7- dependent secretion at the immune synapse regulates antigen extraction and presentation in B-lymphocytesMol Biol Cell 28:890–7
- 38.An initial and rapid step of lytic granule secretion precedes microtubule organizing center polarization at the cytotoxic T lymphocyte/target cell synapseProc Natl Acad Sci U S A 110:6073–8
- 39.Dynein Separately Partners with NDE1 and Dynactin To Orchestrate T Cell Focused SecretionThe Journal of Immunology 197:2090–101
- 40.Distinct Roles of Cytoskeletal Components in Immunological Synapse Formation and Directed SecretionJournal of immunology 195:4117–25
- 41.Formin-generated actomyosin arcs propel T cell receptor microcluster movement at the immune synapseThe Journal of cell biology 215:383–99
- 42.Cell biology of cytotoxic and helper T cell functions: immunofluorescence microscopic studies of single cells and cell couplesAnnu Rev Immunol 7:309–37
- 43.Imaging Polarized Secretory Traffic at the Immune Synapse in Living T LymphocytesFrontiers in immunology 9
- 44.Imaging the Human Immunological SynapseJournal of visualized experiments : JoVE
- 45.Molecular mechanisms and functional implications of polarized actin remodeling at the T cell immunological synapseCell Mol Life Sci 72:537–56
- 46.Membrane vesicles as conveyors of immune responsesNature reviews Immunology 9:581–93
- 47.Ceramide triggers budding of exosome vesicles into multivesicular endosomesScience (New York, NY) 319:1244–7
- 48.The centrosome is an actin-organizing centreNature cell biology 18:65–75
- 49.Actin nucleation at the centrosome controls lymphocyte polarityNature communications 7
- 50.Proteasome Dependent Actin Remodeling Facilitates Antigen Extraction at the Immune Synapse of B CellsFrontiers in immunology 10
- 51.The Bardet-Biedl syndrome complex component BBS1 controls T cell polarity during immune synapse assemblyJ Cell Sci 134
- 52.Lymphocyte Polarization During Immune Synapse Assembly: Centrosomal Actin Joins the GameFrontiers in immunology 13
- 53.Actin Dynamics at the T Cell Synapse as Revealed by Immune-Related ActinopathiesFrontiers in cell and developmental biology 9
- 54.Fifteen formins for an actin filament: a molecular view on the regulation of human forminsBiochim Biophys Acta 1803:152–63
- 55.The mammalian formin FHOD1 is activated through phosphorylation by ROCK and mediates thrombin-induced stress fibre formation in endothelial cellsEMBO J 27:618–28
- 56.Crucial Role of ROCK2- Mediated Phosphorylation and Upregulation of FHOD3 in the Pathogenesis of Angiotensin II-Induced Cardiac HypertrophyHypertension (Dallas, Tex : 1979) 69:1070–83
- 57.Determination of the specific substrate sequence motifs of protein kinase C isozymesThe Journal of biological chemistry 272:952–60
- 58.FMNL1 promotes proliferation and migration of leukemia cellsJournal of leukocyte biology 94:503–12
- 59.The Immunological Synapse and Rho GTPasesBacterial Virulence Factors and Rho GTPases Berlin, Heidelberg: Springer Berlin Heidelberg :61–90
- 60.Vesicle-Associated Actin Assembly by Formins Promotes TGFβ-Induced ANGPTL4 Trafficking, Secretion and Cell InvasionAdvanced Science 10
- 61.Effects of Hypoxia and Radiation-Induced Exosomes on Migration of Lung Cancer Cells and Angiogenesis of Umbilical Vein Endothelial CellsRadiation Research 194:71–80
- 62.Exosomal protein angiopoietin-like 4 mediated radioresistance of lung cancer by inhibiting ferroptosis under hypoxic microenvironmentBritish Journal of Cancer 127:1760–72
- 63.Formin-like 2 promotes angiogenesis and metastasis of colorectal cancer by regulating the EGFL6/CKAP4/ERK axisCancer Science 114:2014–28
- 64.Directional cell movement through tissues is controlled by exosome secretionNature communications 6
- 65.Formin-like 1 mediates effector T cell trafficking to inflammatory sites to enable T cell-mediated autoimmunityeLife 9
- 66.Supported bilayers at the vanguard of immune cell activation studiesJ Struct Biol 168:152–60
- 67.Nanoscale Dynamism of Actin Enables Secretory Function in Cytolytic CellsCurr Biol 28:489–502
- 68.Identification of distinct cytotoxic granules as the origin of supramolecular attack particles in T lymphocytesNature communications 13
- 69.CD44 cross-linking induces protein kinase C-regulated migration of human T lymphocytesInternational immunology 17:449–58
- 70.Inside the crawling T cell: leukocyte function-associated antigen-1 cross-linking is associated with microtubule-directed translocation of protein kinase C isoenzymes beta(I) and deltaJournal of immunology 161:6487–95
- 71.A new role of diacylglycerol kinase alpha on the secretion of lethal exosomes bearing Fas ligand during activation-induced cell death of T lymphocytesBiochimie 89:213–21
- 72.Linking albinism and immunity: the secrets of secretory lysosomesScience (New York, NY) 305:55–9
- 73.Molecular mechanisms of biogenesis and exocytosis of cytotoxic granulesNature reviews Immunology 10:568–79
- 74.HTR6 and SSTR3 ciliary targeting relies on both IC3 loops and C-terminal tailsLife Science Alliance 4
- 75.Isolation and characterization of exosomes from cell culture supernatants and biological fluidsCurrent protocols in cell biology / editorial board, Juan S Bonifacino [et al]
- 76.Rab27a and Rab27b control different steps of the exosome secretion pathwayNature cell biology 12:19–30
- 77.Cutting Edge: Regulation of Exosome Secretion by the Integral MAL Protein in T CellsJournal of immunology 195:810–4
- 78.Protein sorting into multivesicular endosomesCurrent opinion in cell biology 15:446–55
- 79.T cell-induced secretion of MHC class II-peptide complexes on B cell exosomesEMBO J 26:4263–72
- 80.Membrane proteins significantly restrict exosome mobilityBiochem Biophys Res Commun 501:1055–9
- 81.Role of ICAM-3 in the initial interaction of T lymphocytes and APCsNat Immunol 3:159–68
- 82.Polarity of CD4+ T cells towards the antigen presenting cell is regulated by the Lck adapter TSAdSci Rep 8
- 83.Calcium influx through receptor-operated channel induces mitochondria-triggered paraptotic cell deathThe Journal of biological chemistry 278:14134–45
- 84.Imaging the immune synapse: three-dimensional analysis of the immune synapseMethods in cell biology
- 85.Transgelin-2 in B-Cells Controls T-Cell Activation by Stabilizing T Cell - B Cell ConjugatesPLoS One 11
- 86.How B cells capture, process and present antigens: a crucial role for cell polarityNature reviews Immunology 13:475–86
- 87.Analysis of centrosomal area actin reorganization and centrosome polarization upon lymphocyte activation at the immunological synapseMethods in cell biology 173:15–32
- 88.Centrosome repositioning in T cells is biphasic and driven by microtubule end-on capture-shrinkageThe Journal of cell biology 202:779–92
- 89.Tuning immune responses: diversity and adaptation of the immunological synapseNature reviews Immunology 5:532–45
- 90.Reciprocal polarization of T and B cells at the immunological synapseJournal of immunology 187:4571–80
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Copyright
© 2024, Ruiz-Navarro et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 638
- downloads
- 51
- citations
- 0
Views, downloads and citations are aggregated across all versions of this paper published by eLife.