Tissue absence initiates regeneration through Follistatin-mediated inhibition of Activin signaling
- Howard Hughes Medical Institute, Whitehead Institute, Massachusetts Institute of Technology, United States
Figures
Figure 1 with 5 supplements
fst is wound induced and required for regeneration.
(A) fst(RNAi) animals did not form blastemas after amputation (left, arrowheads, n > 100) and did not regenerate a brain as assayed with an RNA probe for choline-acetyltransferase (chat, middle, arrowhead, n = 9/9). (B) fst(RNAi) animals did not form blastemas 8 days following excision of a wedge of lateral tissue (arrowhead, n = 14/14). (C) fst(RNAi) animals displayed no phenotype in the absence of amputation (right, n = 30/30, 123 days RNAi). (D) fst(RNAi) animals still produced new neurons 20 days after failing to regenerate (n = 8/8; cells that are SMEDWI protein+ and chat+ are newly differentiating neurons [Wagner et al., 2011]), demonstrating ongoing tissue turnover in old tissues. Scale bar 10 µm. (E) fst was expressed sparsely throughout the intact animal and at the anterior pole. Following head and tail amputation, robust fst expression occurred at both anterior and posterior wound sites, with peak expression 12 hr post-amputation. Scale bars = 100 µm for left of (A), (B), and (C); 200 µm for right of (A) and (E). Anterior up.
Figure 1—figure supplement 1
Specificity of the fst RNAi phenotype.
Animals injected with dsRNA corresponding to non-overlapping sequences from either the 5′ half or the 3′ half of the fst gene failed to regenerate (n = 6/14 and 4/16 normal, respectively, compared to 16/16 normal for control), day 8. Anterior up, scale bars = 100 µm.
Figure 1—figure supplement 2
Anterior pattern defects in fst(RNAi) animals.
fst(RNAi) animals displayed normal anterior sfrp-1 expression 24 hr after amputation (n = 11/11, top), but by 8 days displayed none (n = 11/12, middle). fst(RNAi) animals also failed to regenerate anterior ndk expression (bottom, n = 7/8). Anterior up, scale bars = 100 µm.
Figure 1—figure supplement 3
Efficacy of fst RNAi.
fst expression was reduced both prior to and following amputation in animals treated with fst dsRNA as assayed by quantitative PCR (qPCR). For qPCR, total RNA was isolated from asexual Schmidtea mediterranea animals, and cDNA was prepared using SuperScript III (Invitrogen) with oligo-dT primers. qPCR was performed using SYBR Green (Applied Biosystems), and data were normalized to the expression of clathrin as previously described (Eisenhoffer et al., 2008). fst (left: CCAGGCGAAAGAAATCCAG and right: GAGGTGGGGCATTTGATACA) primers were used to evaluate expression.
Figure 1—figure supplement 4
Wound-induced fst expression persists for several days after amputation.
fst is expressed at wound sites throughout regeneration, with additional expression in the brain at later timepoints (arrows, 6 days and 8 days). Anterior up, scale bars = 100 µm.
Figure 1—figure supplement 5
fst is required after amputation for normal regeneration.
Animals were amputated and injected four times with 30 nl fst dsRNA immediately after amputation and a second time 6 hr after amputation. Animals injected with fst dsRNA developed aberrant brains as labeled by chat expression, and in some cases produced no blastemas (n = 7/10 aberrant, 1/10 no blastema), while animals injected with control dsRNA regenerated normally (10/10 normal). Anterior up, scale bars = 100 µm.
Figure 2 with 1 supplement
fst is required for the neoblast response to missing tissue.
(A) fst RNAi did not affect neoblast number or distribution as assayed with an RNA probe for smedwi-1 (n = 5/5) and flow cytometry (percentage of live cells that were X1 cells). (B) fst(RNAi) tail fragments displayed reduced mitoses 48 hr and 72 hr after amputation (right, p<0.01 and p<0.001, two-tailed t-test). (C) Neoblasts migrated to wounds in fst(RNAi) animals as assayed for the presence of smedwi-1+ cells at wounds (NB.21.11E+ cells mark pre-existing tissue). (D) fst(RNAi) animals lacked eye progenitors following head amputation as assayed with RNA probes for ovo+/smedwi-1+ cells (p<0.001, two-tailed t-test). Scale bars = 100 µm. Anterior up.
Figure 2—figure supplement 1
Neoblasts migrate to wounds normally in fst(RNAi) animals.
Mitoses were enriched toward wound sites 48 hr after amputation in fst(RNAi) animals but were fewer in number (bottom right, p<0.001 at 200 µm, two-tailed t-test).
Figure 3 with 1 supplement
fst is required broadly for missing-tissue responses and morphallaxis.
(A) fst(RNAi) animals displayed no increase in pharyngeal TUNEL+ cells 3 days post-amputation (p<0.001, two-tailed t-test). Dotted white line = pharynx outline. (B) fst(RNAi) tail fragments displayed normal TUNEL+ cell numbers 4 hr post-amputation (n = 6/6). (C) fst(RNAi) animals displayed normal wound-induced gene expression 3 hr and 6 hr after amputation (jun-1: n = 20/20, nlg1: n = 5/5) but reduced expression compared to controls 24–48 hr after amputation (arrows; jun-1: 17/19 correctly scored blindly, p<0.01 Fisher’s exact test, nlg1: 22/27 correctly scored blindly, p<0.01, Fisher’s exact test). (D) fst(RNAi) animals had increased wound-induced expression of delta-1 24 hr after amputation (n = 12/12). (E) fst(RNAi) animals did not rescale expression of wntP-2 48 hr after amputation (n = 18/21). (F) fst(RNAi) animals did not reduce the number of cintillo+ cells in head fragments following amputation (p<0.001, two-tailed t-test). Scale bars = 100 µm. Anterior up in (A–C), (E), (F). Anterior left in (D).
Figure 3—figure supplement 1
The fst(RNAi) phenotype is not a non-specific result of regeneration failure.
Left: Following lethal irradiation and amputation, animals displayed higher expression of nlg1, lower expression of jun-1, and higher expression of delta-1 (n > 5 for each). smad1(RNAi) animals did not form blastemas but displayed normal delta-1 expression. Right: control tail fragments produced a pharynx de novo by 8 days after amputation, while fst(RNAi) tail fragments did not (arrowhead, n = 6/7). smad1(RNAi) animals failed to produce blastemas following amputation (arrowhead) but produced a pharynx normally (n = 5/5). The marker madt labels intestine and outlines pharynx (white area). Anterior up. Scale bars = 100 µm.
Figure 4 with 5 supplements
act-1 and act-2 are required for the fst RNAi phenotype.
(A) fst(RNAi) animals treated with control dsRNA did not produce blastemas or a brain after amputation (n = 17/22), whereas fst(RNAi) animals treated with act-1 or act-2 dsRNA produced normal blastemas and brain (act-1: n = 19/23, p<0.0001; act-2: n = 16/26, p<0.001; Fisher’s exact test for both). Inhibition of other candidate genes did not suppress the fst RNAi phenotype (n > 9 for all other conditions). Aberrant animals were scored as having greatly decreased or absent brain. (B) fst(RNAi) animals treated with control dsRNA displayed a reduced apoptotic response 3 days after amputation, whereas fst(RNAi) animals treated with act-1 dsRNA displayed a normal apoptotic response (p<0.001 between control RNAi and fst;ctrl RNAi; p<0.01 between fst;ctrl RNAi and fst;act-1 RNAi, two-tailed t-test for both). (C) act-1(RNAi) animals displayed a greater induction of ovo+ eye progenitors compared to controls 2 days after head amputation (n = 24, p<0.0001, two-tailed t-test). Scale bars = 100 µm. Anterior up.
Figure 4—figure supplement 1
Phylogeny of planarian activin homologs.
The Smed-act-1 sequence was aligned with other TGF-β sequences using CLUSTALW (Higgins, 1994; Thompson et al., 1994). The alignments were trimmed using GBlocks (Castresana, 2000), allowing for smaller final blocks, gap positions within the final blocks, and less strict flanking positions. Bayesian analysis was performed using MrBayes (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003). The Bayesian inference tree is shown with support values above 0.5 for each branch. Smed-Act-1 and Smed-Act-2 are shown in red. The phylogenetic positions of Smed-Act-1 and Smed-Act-2 support orthology with Activin proteins. Xl = Xenopus laevis, Mm = Mus musculus, Hs = Homo sapiens, Gg = Gallus gallus, Bf = Branchiostoma floridae, Dm = Drosophila melanogaster, Dr = Danio rerio, Sm = Schmidtea mediterranea.
Figure 4—figure supplement 2
RNAi controls for fst suppression experiments.
Left: Animals treated with both fst dsRNA and act-1 dsRNA display no fst RNAi phenotype even though expression of fst is greatly reduced (top). Animals treated with both fst dsRNA and act-2 dsRNA displayed a similar reduction of the fst RNAi phenotype even though expression of fst is greatly reduced (bottom). Animals treated with fst dsRNA and another candidate dsRNA display the fst RNAi phenotype even though expression of candidate genes are greatly reduced (n > 6 for all). Anterior left, scale bars = 100 µm. Right: fst expression was reduced in fst(RNAi) animals concomitantly treated with control dsRNA or with act-1 dsRNA as assayed by quantitative PCR (performed as described in Figure 1—figure supplement 1) with two independent sets of fst primers (primer set 2 = left: TGGTGTGCAATTTAGCGAGT; right: ATTCACTGCAGCCTCTTGTG).
Figure 4—figure supplement 3
Efficacy of act-1 RNAi.
act-1 expression was reduced in act-1(RNAi) animals both prior to and 24 hr after amputation as assayed by quantitative PCR. qPCR was performed as described in Figure 1—figure supplement 4. act-1 (left: GCGAGCTACCTTTCAATGCT, right: ACGGGAGTGCAACAGTTTTT) primers were used to evaluate expression.
Figure 4—figure supplement 4
act-1(RNAi) animals appear normal following regeneration.
act-1(RNAi) animals formed blastemas and regenerated following head and tail amputation (n > 200). Scale bars = 100 µm, anterior up.
Figure 4—figure supplement 5
act-1(RNAi) animals display normal neoblast numbers.
Intact act-1(RNAi) animals displayed normal numbers of X1 cells as counted by flow cytometry.
Figure 5 with 3 supplements
fst induction is regulated by tissue absence following injury.
(A) act-1 was expressed broadly throughout the intestine and was not induced by amputation. (B) act-2 was expressed in the intestine and pharynx in intact animals and induced following amputation at wound sites (6 hr and 24 hr, arrows), eventually spreading throughout the body (48 hr, arrows). (C) Animals displayed wound-induced expression of fst 6 hr after either incision or tissue wedge removal, but expression persisted only in cases of tissue wedge removal (n > 5, p<0.01, white arrowheads = injury site). (D) A proposed genetic model for fst and act-1/2 in regeneration. Wounds induce fst expression. If there is missing tissue following injury, fst induction is high, Act-1/2 signaling is inhibited, and regeneration-specific responses are initiated. If there is no missing tissue following injury, fst expression is low, Act-1/2 signaling is not inhibited, and regeneration-specific responses are repressed. Scale bars = 100 µm. Anterior up.
Figure 5—figure supplement 1
Wound-induced act-2 expression persists for several days after amputation.
act-2 expression persisted at high levels throughout the animal during regeneration until at least 8 days after amputation. Anterior up, scale bars = 100 µm.
Figure 5—figure supplement 2
fst and act-2 expression is negligible at wound sites prior to injury.
Lateral, post-pharyngeal expression of fst and act-2 is minimal prior to injury (act-2 signal present is intestinal). Anterior up, scale bars = 100 µm.
Figure 5—figure supplement 3
The amount of missing tissue regulates wound-induced fst expression.
fst expression was higher in level 48 hr after an amputation resulting in a large amount of missing tissue than after an amputation resulting in little missing tissue, as measured by quantifying fluorescent in situ hybridization signal intensity (p<0.01, two-tailed t-test). Anterior up, scale bars = 100 µm.
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Tissue absence initiates regeneration through Follistatin-mediated inhibition of Activin signaling
eLife 2:e00247.
https://doi.org/10.7554/eLife.00247
