Deregulated FGF and homeotic gene expression underlies cerebellar vermis hypoplasia in CHARGE syndrome

  1. Tian Yu
  2. Linda C Meiners
  3. Katrin Danielsen
  4. Monica TY Wong
  5. Timothy Bowler
  6. Danny Reinberg
  7. Peter J Scambler
  8. Conny MA van Ravenswaaij-Arts
  9. M Albert Basson  Is a corresponding author
  1. King’s College London, United Kingdom
  2. University of Groningen, Netherlands
  3. Montefiore Medical Center, United States
  4. Howard Hughes Medical Institute, New York University School of Medicine, United States
  5. University College London Institute of Child Health, United Kingdom
5 figures and 3 tables

Figures

Reduced Fgf8 expression and FGF signalling during early cerebellar development in Chd7-deficient embryos.

(AC) In situ hybridisation for Fgf8 at E9.5 shows a Chd7 gene dosage-dependent reduction in Fgf8 expression in the mid-hindbrain isthmus organiser (IsO, arrows). Scale bar = 0.5 mm. (D) …

https://doi.org/10.7554/eLife.01305.003
Chd7 and Fgf8 loss-of-function alleles interact to cause cerebellar vermis aplasia in the mouse.

(AD) Wholemount views of the mouse cerebellum at P21. The cerebellar vermis is indicated by a double-headed arrow. Chd7+/− animals have normal cerebella, indistinguishable from wildtype and Fgf8+/−

https://doi.org/10.7554/eLife.01305.004
Chd7 loss results in Otx2 de-repression, loss of rhombomere 1 identity and reduced Fgf8 expression.

(A and B) In situ hybridisation for Otx2 in 4 somite stage (ss) embryos. Note the posterior expansion of Otx2 expression in the mutant embryo (arrow in B). (C and D) In situ hybridisation for Otx2

https://doi.org/10.7554/eLife.01305.005
Association of CHD7 with Otx2 and Gbx2 regulatory regions in the mes/r1 region.

(A) Genomic map of the mouse Otx2 locus. The transcriptional start sites of Otx2.1 and Otx2.2 transcripts are indicated by arrows and exons by tan-coloured boxes. Positions on chromosome 14 …

https://doi.org/10.7554/eLife.01305.006
Representative sagittal MRI scans of CHARGE syndrome patients.

(A) Sagittal T1 scan of patient #18 showing a normal vermis with a normal position, foramen of Magendi (asterisk) and subcerebellar cistern (SC). The orientation of the cerebellum relative to the …

https://doi.org/10.7554/eLife.01305.007

Tables

Table 1

Cerebellar findings on MRI scans

https://doi.org/10.7554/eLife.01305.008
PatientSex; age at MRI (y;m)CerebellumSuggestive neurological features* (age at last examination, y;m)CHD7 mutation
1M (1;1)Pronounced vermis hypoplasia with anticlockwise rotated axis, large foramen of Magendi and large subcerebellar cistern, fissure vermisNone (1;1)nonsense934C>T
2M (0;1)Slight caudal vermis hypoplasia with slightly anticlockwise rotated axis, abnormal foliation, large foramen of Magendi, normal subcerebellar cisternAtaxic gait (4;4)nonsense7160C>A
3M (1;0)Slight caudal vermis hypoplasia with anticlockwise rotated axis, large foramen of Magendi, large subcerebellar cistern (Figure 5C,C’)None (12;4)deletion3202-?8994?del
4F (0;3)Slight caudal vermis hypoplasia, with anticlockwise rotated axis, large foramen of Magendi, normal subcerebellar cisternNone (2;2)frameshift7106delT
5M (5;7)Pronounced vermis hypoplasia, with anticlockwise rotated axis, large foramen of Magendi and large subcerebellar cistern (Figure 5B)None (7;10)frameshift4779delT
6M (0;1)Slight caudal vermis hypoplasia, with anticlockwise rotated axis, large foramen of Magendi and large subcerebellar cisternNone (5;2)frameshift5680_5681delAG
7F (2;9)Slight caudal vermis hypoplasia, with slightly anticlockwise rotated axis, large foramen of Magendi and large subcerebellar cisternBroad gait (11;6)missense3973T>G
8M (1;8)Large foramen of Magendi, large fourth ventricle (only on sagittal scans), normal subcerebellar cisternNone (12;2)splice site5535-7G>A
9M (2;2)Large foramen of Magendi, large fourth ventricle (only on sagittal scans), normal subcerebellar cistern. Abnormal foliation in anterior vermisNone (6;2)nonsense3173T>A
10F (1;1)Abnormal foliation caudal cerebellar hemispheres and tonsils, large foramen of Magendi (Figure 5D)None (13;0)splice site UV3340A>T
11F (15;10)Abnormal foliation in anterior vermis (Figure 5D’)None (18;0)splice site3990-1G>C
12M (10;3)Abnormal foliation in anterior vermisMotor dyspraxia (16;10)frameshift5564dupC
13M (0;1)Normal (indented cranial pons)None (0;11)frameshift1820_1821insTTGT
14F (15;10)Normal (large fourth ventricle)None (20;6)nonsense4015C>T
15F (0;1)Normal, (split caudal vermis)None (5;9)nonsense7879C>T
16M (0;6)NormalBroad gait (10;6)splice site2238+1 G>A
17M (1;10)NormalNone (6;4)nonsense1480C>T
18F (2;10)Normal (Figure 5A)None (17;3)frameshift7769delA
19M (1;0)NormalNone (16;9)nonsense1714C>T
20M (6;3)NormalNone (12;10)splice site2443+5 G>C
  1. *

    all children show motor delay due to vestibular defects.

Table 2

Otx2 qPCR primers

https://doi.org/10.7554/eLife.01305.009
RegionForwardReverse
#1AAACTCACCATAATCCTCCTGCCTCCTCCCCTTCTCCTCTAAACAGC
#2CTGCTCTCCTCAACCTTCAGACTCTTGCGTGCCTTACCTTACCG
#3CAACCACTCAAGTCAAGCCTATCTGTCTTCCTCTGCCTCCCAAGTTC
#4CTGGCTGGTGGCTTCTGATTTTAGGTATCGCCAGGTTGCC
#5ACACCAACTTGCTGAACAACATCCAGACTACTAATTAGGTGAAAATGA
#6GAAAACCAAAACCCAAACCACGGAATGGAATCCTTAGCAAGCGG
#7AACAGGCTTGTGTCCGTCTACGCGCTTTCTCAGCAAATCTCCC
#8CATTTTCTTGCCGTCCTGCCAAAGTGTGCCTCCTGTGGTTCC
#9AAAAACACTGGGGAAGAAAGGGAAATAAGAGTCAGAAGAGCGGTGC
#10GCTGAATCAAACATGAATGAGCCCTGGGAGTAGACAACTGAGACA
Table 3

Gbx2 qPCR primers

https://doi.org/10.7554/eLife.01305.010
RegionForward (5’–3’)Reverse (5’–3’)
#1CCCTTGGCTGGCTTTGAAATTCTGCCTTTTGTCCTGGAGA
#2TGAATCCATAGCTTACCCGCAGGAACAAAGGGGGAAAGAA
#3CCAGGCTTTCATCTCTCGCAATAGGCCAAGCTAAGCACCC
#4GGGAATGGTGGAATGAATGGCTGAGGAGTGTGCTGAAGGGACAAC
#5GTTGGCTGCCCTTTTCTTCAACCTCCATCTCCTCAGGCTA
#6TGTAAACACTCCCTTCCCCGTATCCCACCCTAAACCGAAATGCG

Download links