In vivo reprogramming of pancreatic acinar cells to three islet endocrine subtypes

  1. Weida Li
  2. Mio Nakanishi
  3. Adrian Zumsteg
  4. Matthew Shear
  5. Christopher Wright
  6. Douglas A Melton
  7. Qiao Zhou  Is a corresponding author
  1. Harvard University, United States
  2. McMaster University, Canada
  3. Vanderbilt University School of Medicine, United States
10 figures and 1 table

Figures

Figure 1 with 3 supplements
Induction of somatostatin+, glucagon+, and insulin+ cells with defined factors in adult mouse pancreas in vivo.

(A) Schematic diagram of experimental strategy. Adenoviruses co-expressing reprogramming factor (R.F.) and mCherry (cherry) were used to directly induce conversion of acinar cells in adult pancreas. …

https://doi.org/10.7554/eLife.01846.003
Figure 1—figure supplement 1
Adenoviral constructs used in the experiments and polycistronic factor expression.

(A). Diagrams of the constructs used. CMV: cytomegaloviral promoter. Dark gray bar: 2A peptide that mediates polycistronic protein expression. Cherry: monomeric cherry fluorescent protein. (B). …

https://doi.org/10.7554/eLife.01846.004
Figure 1—figure supplement 2
Mafa alone, Pdx1 alone, and combinations of Pdx1.Mafa and Ngn3.Pdx1 do not induce endocrine cells in pancreas.

(AL) Mafa alone, Pdx1 alone, Pdx1.Mafa (polycistronic coexpression), Ngn3.Pdx1 (polycistronic coexpression) do not induce the three principle hormones of pancreatic islets. Sst, somatostatin; Gcg, …

https://doi.org/10.7554/eLife.01846.005
Figure 1—figure supplement 3
Transgene expression mediated by adenoviral infection in adult pancreas is transient.

We performed qPCR analyses at four different time points after viral infection (day 2, 10, 30, and 60) in Ngn3cherry mediated delta cell induction (A) or Ngn3cherry+Mafacherry mediated alpha cell …

https://doi.org/10.7554/eLife.01846.006
Figure 2 with 6 supplements
δ-like cell induction by Ngn3.

(AC) Induced δ-cells co-express somatostatin (SST) and cholecystokinin receptor B (Cckbr) (A and A′). They also co-express the endocrine markers Pax6 (B and B′) and Synaptophysin (Syn, C and C′). …

https://doi.org/10.7554/eLife.01846.007
Figure 2—figure supplement 1
Induced δ-cells persist in adult pancreas.

The induced δ-cells are detectable in adult pancreas 2 month after induction and they continue to express Pax6. Ecad: E-cadherin.

https://doi.org/10.7554/eLife.01846.008
Figure 2—figure supplement 2
Ultrastructure comparison of induced and endogenous endocrine subtypes.

Representative images of endogenous α-, δ-, and β-cells are presented in A, C, E, whereas that of induced α- and δ-cells are presented in B, D. Images in A′E′ are magnified views of the boxed areas …

https://doi.org/10.7554/eLife.01846.009
Figure 2—figure supplement 3
Genomic maps of CpG sites in the promoter region of mouse insulin2 (ins2) and amylase2a2 (Amy2a2) genes.

The genomic region around the transcriptional start site (TSS) is shown (1 kb upstream and 1 kb downstream). CpG are represented as triangles. CpG analyzed in this study are shown as solid …

https://doi.org/10.7554/eLife.01846.010
Figure 2—figure supplement 4
Purification of endogenous δ- and α-cells, and induced δ-cells by intracellular FACS for DNA methylation studies.

Endogenous δ- and α-cells were purified by staining wide-type islet cells and intracellular FACS (A), yield 10.1% glucagon+ cells and 5.5% somatostatin+ cells from islets. Induced δ-cells were …

https://doi.org/10.7554/eLife.01846.011
Figure 2—figure supplement 5
Somatostatin promoter DNA methylation analysis.

(A) The genomic region around the transcriptional start site (TSS) of somatostatin gene is shown (1 kb upstream and 1 kb downstream). CpG are represented as triangles. CpG analyzed in this study are …

https://doi.org/10.7554/eLife.01846.012
Figure 2—figure supplement 6
COBRA analysis of Amylase promoter.

Combined bisulfite restriction analysis (COBRA) confirmed that the Amylase 2 promoter is lightly methylated in acinar cells (middle lane), but heavily methylated in both islet δ-cells and induced …

https://doi.org/10.7554/eLife.01846.013
Figure 3 with 4 supplements
α-like cell induction by Ngn3 and Mafa.

(A) Co-infection of two separate viruses carrying Ngn3 and Mafa led to the induction of Glucagon (Gcg+) cells. Somatostatin (Sst+) cells were also induced as a separate population (A′). (B–D) …

https://doi.org/10.7554/eLife.01846.014
Figure 3—figure supplement 1
Induced α-cells persist in adult pancreas.

The induced α-cells are detectable in adult pancreas 2 month after induction. They are Pax6+ and Ecadherin+.

https://doi.org/10.7554/eLife.01846.015
Figure 3—figure supplement 2
Purification of induced α-cells by intracellular FACS for DNA methylation studies.

Induced α-cells were isolated by harvesting the acinar fraction of infected pancreatic samples 20 days after infection (co-infection with Ngn3cherry and Mafacherry), following by intracellular FACS. …

https://doi.org/10.7554/eLife.01846.016
Figure 3—figure supplement 3
Genomic map of CpG sites in the promoter region of mouse glucagon gene.

The genomic region around the transcriptional start site (TSS) is shown (1 kb upstream and 1 kb downstream). CpG are represented as triangles. CpG analyzed in this study are shown as solid …

https://doi.org/10.7554/eLife.01846.017
Figure 3—figure supplement 4
A small number of Gcg+ cells are partially reprogrammed.

A small number of induced Gcg+ α-cells express the acinar factor Amylase 30 days after induction. White arrows indicate properly converted Gcg+Amylase cells. Yellow arrows indicate partially …

https://doi.org/10.7554/eLife.01846.018
Induced δ- and α-like cells are converted from acinar cells in the absence of cell proliferation.

(AB) Genetic lineage tracing of induced δ- and α-like cells. Tamoxifen induction of bigenic Ptf1aCreER::RosaYFP animals led to specific and indelible labeling of approximately 20% of adult …

https://doi.org/10.7554/eLife.01846.019
Ngn3 can simultaneously suppress acinar fate-regulators and activate pan-endocrine genes to establish an endocrine state.

Immunohistochemistry showed that 4 days after expression of the three reprogramming factors individually in the pancreas, Ngn3 and Mafa, but not Pdx1, strongly suppressed the expression of the …

https://doi.org/10.7554/eLife.01846.020
Acinar factors are molecular barriers of endocrine reprogramming.

Compared with the robust induction of Pax6 and Sst by Ngn3 alone (A, D, G), co-expression of Nr5a2 and Ngn3 (by co-infection of two separate viruses) strongly inhibited the activation of both …

https://doi.org/10.7554/eLife.01846.021
Acinar suppression and pan-endocrine activation precedes subtype-specific gene activation in acinar to δ-cell conversion.

In acinar to δ-cell conversion induced by Ngn3, strong suppression of the acinar factor Mist1 was observed in the Cherry+-infected cells at day 2 (A). The pan-endocrine factor Pax6 was also induced …

https://doi.org/10.7554/eLife.01846.022
Acinar suppression and pan-endocrine activation precedes subtype-specific gene activation in acinar to β-cell conversion.

In acinar to β-cell conversion induced by M3 (Ngn3+Mafa+Pdx1), near complete suppression of the acinar factor Mist1 was observed in the Cherry+-infected cells at day 2 (A). The pan-endocrine factor …

https://doi.org/10.7554/eLife.01846.023
Pdx1 and Mafa can suppress δ-subtype specification.

Compared with robust induction of Sst+ cells by Ngn3 alone (A), polycistronic co-expression of Mafa and Ngn3 led to strong reduction of Sst+ cells (B). Polycistronic co-expression of Pdx1 and Ngn3 …

https://doi.org/10.7554/eLife.01846.024
Direct in vivo conversion of pancreatic acinar cells to three islet endocrine subtypes by combinatorial actions of three factors.

(A) Summary of acinar to islet endocrine conversion with defined factors. (B) Our studies suggest that there are two main processes in pancreatic acinar to endocrine reprogramming. Ngn3 plays a …

https://doi.org/10.7554/eLife.01846.025

Tables

Table 1

PCR primers for DNA methylation assays

https://doi.org/10.7554/eLife.01846.026
GenesRound #Primer sequences (5’ to 3’) (forward; reverse)
Amylase 2aTouch-down PCRTTTTATTTTTATTTGGAATGGTG; TCATATTAAACCCAACAAAACC
Insulin2Touch-down PCRTTTAAGTGGGATATGGAAAGAGAGATA; ACTACAATTTCCAAACACTTCCCTAATA
GlucagonNested 1TTATATAATGTGGATGAGTGGG; TCTACCCTTCTACACCAAAATAC
GlucagonNested 2TTTGTTTGTTTAGATGAATGATT; TCTACCCTTCTACACCAAAATA
GlucagonNested 3AAGGGATAAGATTTTTAAATGAGA; TCTACCCTTCTACACCAAAATAC
GlucagonNested 4AAGGGATAAGATTTTTAAATGAGA; ACTCTCCAAACTATTTAACCTTACA
SomatostatinNested 1ATTGTTTGGTTTTTGTGGTATG; TCTTCCTTACCTCAAACAACC
SomatostatinNested 2TGGGTGTAGGTTTTTTTTTTTT; TCTTCCTTACCTCAAACAACC

Download links