The neuropeptide tachykinin is essential for pheromone detection in a gustatory neural circuit
- Temasek Life Sciences Laboratory, Singapore
- National University of Singapore, Singapore
- Institute of Molecular and Cell Biology, Singapore
- Toyo Gosei Co., Ltd, Japan
- University of Hawaii at Mānoa, United States
Figures
Figure 1
Functional properties of the male sex pheromone CH503.
(A) The typical courtship sequence of D. melanogaster is comprised of wing vibration performed by the male towards the female, tapping and tasting of the female abdomen with the forelegs, and …
Figure 2 with 3 supplements
Gr68a expression in the male foreleg is required for CH503 detection.
(A) Simultaneous stimulation of the male foreleg with 4% sucrose and CH503 or caffeine significantly inhibits the proboscis extension reflex (PER; shown in pictures) in CantonS males (white). The …
Figure 2—figure supplement 1
Sexually dimorphic PER response to CH503.
The PER response to (S, Z, Z)-CH503 is sexually dimorphic. Females do not respond to the more potent stereoisomer (S, Z, Z)-CH503 (green) while males respond across a range of doses (black). Both …
Figure 2—figure supplement 2
Chemical structures of (R, Z, Z)-CH503, (S, Z, Z)-CH503, and CH503 analogs.
https://doi.org/10.7554/eLife.06914.006
Figure 2—figure supplement 3
Characterization of ΔGr68a mutant alleles by quantitative PCR.
Gr68a levels are effectively reduced in homologous recombinant mutant (ΔGr68a) and restored in rescue (Gr68Res) alleles. Gene expression levels are shown normalized to wild-type CantonS levels. The …
Figure 3 with 6 supplements
Gr68a is essential for CH503-evoked neuronal responses in the male foreleg.
(A) Visualization of GFP-labeled Gr68a-expressing neurons reveals neuronal and non-neuronal cells (arrowheads) in tarsal segments T2-5 from the male foreleg. Scale bar: 35 μm. (B) Gr68a-expressing …
Figure 3—figure supplement 1
Line graph representation showing the tonic response of a T2 Gr68a neuron upon stimulation with 500 ng of CH503.
Red arrow indicates the time at which the stimulus was added.
Figure 3—figure supplement 2
Physiological responses of male Gr68a neurons to (S, Z, Z)-CH503.
An increase in intracellular Ca2+ levels was observed in Gr68a-expressing neurons upon application of (S, Z, Z)-CH503. Two cells (o, x) showed a higher ΔF/F increase in response to 500 ng of (S, Z, Z…
Figure 3—figure supplement 3
Physiological responses of Gr68a neurons upon RNAi-mediated silencing of Gr68a expression.
RNAi-mediated suppression of Gr68a severely reduces neural responses induced by (R, Z, Z)-CH503 (red). In most cells, the response to the pheromone was not distinguishable from the response to …
Figure 3—figure supplement 4
Physiological responses of ppk23 proboscis neurons to (R, Z, Z)-CH503.
(A) Application of 500 ng of CH503 elicited a significant ΔF/F increase in ppk23-expressing neurons on the male proboscis (red). In contrast, ppk23-expressing neurons from the female proboscis did …
Figure 3—figure supplement 5
Physiological responses of ppk23 leg neurons to (R, Z, Z)-CH503.
(A) Visualization of GFP-labeled ppk23-expressing neurons in the male foreleg in tarsal segments T2-5. Scale bar: 35 μm. (B) Ppk23-expressing neurons on tarsal segments T2-5 were stimulated with 50 …
Figure 3—figure supplement 6
Gr68a-Gal4 and fruitless (fru)-expression in the foreleg do not co-localize.
Pearson's coefficients: 0.06 (left) and 0.02 (right); scale bar: 50 μm.
Figure 4 with 4 supplements
Higher order neural circuits essential for processing CH503.
(A) Gr68a-Gal4-labeled afferent projections extend to the thoracico-abdominal ganglia (TAG), subesophageal zone (SEZ), and antennal mechanosensory and motor center (AMMC). Image represents a maximum …
Figure 4—figure supplement 1
Central brain screen to identify CH503-processing circuits.
Inactivation of neural activity by expression of the temperature-sensitive Shibire transgene (UAS-Shits1) or UAS-dORKΔC within NPF- and c929-Gal4 circuits resulted in a loss of sensitivity to CH503 …
Figure 4—figure supplement 2
Co-expression of anti-NPF immunostaining with c929-Gal4-directed GFP expression.
(A) Co-expression is observed in cell bodies housed in the thoracico-abdominal ganglia (TAG), subesophageal zone (SEZ), superior medial protocerebrum (SMP), and processes along the median bundle …
Figure 4—figure supplement 3
Screen of tachykinin and small transmitter systems within the c929-Gal4 circuit.
RNAi-mediated silencing of tachykinin (TK) expression within the c929-Gal4 circuit inhibits sensitivity to (S, Z, Z)-CH503 (purple vs white). RNAi manipulation of other neurotransmitter systems did …
Figure 4—figure supplement 4
Characterization of NPF transcript levels.
Quantitative PCR analysis of NPF transcript levels from heads of elav>NPF-RNAi and elav/+ control flies. RNAi induces a 5.3-fold reduction of NPF transcript levels. Gene expression levels are shown …
Figure 5 with 3 supplements
Tachykinin-expressing cells in the SEZ are a second order circuit for Gr68a neurons.
(A) Ablation of TK-expressing circuits using two independent Gal4 drivers (TK2 and TK3) removed sensitivity to CH503. Homozygous or trans-heterozygous ΔTK deletion mutants also exhibit a loss of …
Figure 5—figure supplement 1
Tachykinin is essential for CH503 detection.
Three different TK-Gal4 drivers were tested for their contribution to CH503 processing. Cell ablation or inactivation of neural activity using TK2-Gal4 and TK3-Gal4 (purple vs white) but not TK1-Gal4…
Figure 5—figure supplement 2
Parental control lines for tachykinin mutant rescue experiments.
The presence of the Gal4 or UAS transgene is not sufficient to rescue the response to CH503. N = 23–30, Fisher's exact probability test, all results are not significant.
Figure 5—figure supplement 3
Non-specific diffuse staining is observed in tissue from GRASP negative controls lacking the Gr68a-Gal4 driver.
Left: the brightness of the confocal image is exaggerated in order to visualize the tissue. Right: the fluorescent image is overlaid on a phase-contrast image of the tissue. Scale bar: 50 μm.
Figure 6 with 2 supplements
Tachykinin release within the NPF- and c929-defined circuits is required for the processing of CH503.
(A) RNAi-mediated knockdown of TK only in central NPF-Gal4 circuits abrogates the CH503-induced courtship suppression response. Conditional knockdown only from late pupal stage onwards (29°C …
Figure 6—figure supplement 1
The TK3-Gal4 circuit does not co-localize with NPF.
(A) Inactivation of TK neurons using a third TK-Gal4 line results in a loss of sensitivity to CH503. The sensitivity is restored upon rescue of TK expression. (B) No co-localization or co-expression …
Figure 6—figure supplement 2
Parental control lines for tachykinin mutant rescue experiments.
N = 24–32, Fisher's exact probability test, all results are not significant.
Figure 7
A model for gustatory pheromone perception in peripheral and central neural circuits.
Gr68a neurons on the foreleg relay chemosensory and mechanosensory signals to the subesophageal zone (SEZ) and AMMC, respectively. Movement detection via Gr68a neurons contributes to the decision to …
Videos
Video 1
Physiological response from Gr68a neurons on the male foreleg expressing GCaMP.
Cell bodies in T3 exhibit a tonic response upon stimulation with 500 ng of CH503.
Video 2
Physiological response from ppk23 neurons on the male proboscis expressing GCaMP.
Following stimulation with 500 ng of CH503, the projections of ppk23 neurons exhibit a bursting response. The cell bodies respond in a tonic manner, displaying a gradual increase in fluorescence …
Video 3
Physiological response from ppk23 neurons on the male foreleg expressing GCaMP.
Following stimulation with 500 ng of CH503, cell bodies and projections in T3 display a bursting response.
Tables
Table 1
Average number of GFP-positive cells in male and female foreleg segments labeled using Gr68a-Gal4
| T1 | T2 | T3 | T4 | T5 | Total* | |
|---|---|---|---|---|---|---|
| ♂ neurons | 2 ± 1 | 2 ± 1 | 3 ± 1 | 2 ± 1 | 0 (9/12 flies) | 9 ± 1 |
| ♀ neurons | 2 ± 1 | 1 ± 1 | 2 ± 1 | 1 ± 1 | 0 (11/12 flies) | 6 ± 2 |
| ♂ non-neural cells | 2 ± 1 | 3 ± 0 | 2 ± 0 | 1 ± 0 | 0 | 8 ± 1 |
| ♀ non-neural cells | 0 | 0 | 0 | 0 | 0 | 0 |
-
*
Averaged count (±SD) from 12 flies.
Table 2
Gal4 and RNAi lines used to screen for CH503-related defects
| Stock | Expression pattern or gene targeted* | Source |
|---|---|---|
| c386a-Gal4 | EB | www.fly-trap.org |
| 2-72-Gal4 | EB | gift from U Heberlein (Janelia Farm, VA, USA) |
| 4-67-Gal4 | EB | Gift from U Heberlein |
| 9-161-Gal4 | PC, FSB, MB | Gift from U Heberlein |
| 2-13-Gal4 | interneurons, PC | Gift from U Heberlein |
| c819-Gal4 | (Pan et al., 2012) | (Pan et al., 2012) |
| c061-Gal4 | PC, FSB, MB | (Pan et al., 2012) |
| R71GO1-Gal4 | PI, VNC | (Pan et al., 2012) |
| OK107-Gal4 | MB | DGRC #106098 |
| TrH-Gal4 | 5HT cells | Bloomington #10531 |
| TH-Gal4 | DA cells | Bloomington #8848 |
| Tdc2-Gal4 | TA and OCT cells | Bloomington #9313 |
| MB247-Gal4 | MB, EB | Bloomington #50742 |
| JO-15-Gal4 | Johnston's organ | Bloomington #6753 |
| DDC-Gal4 | DA and 5HT cells | Bloomington #7010 |
| c309-Gal4 | MB, SEZ, CX, AL, PI, TG | Bloomington #6906 |
| c305-Gal4 | MB, EB, AL, glia | Bloomington #30829 |
| c305-Gal4 | MB | Bloomington #30829 |
| c205-Gal4 | FB | Bloomington #30827 |
| c161y-Gal4 | EB, FSB, PC, chordotonal organ | Bloomington #27893 |
| c107-Gal4 | EB, FSB, PC, chordotonal organ | Bloomington #30823 |
| 30Y-Gal4 | MB | Bloomington #30818 |
| CheB42aΔ5–68 | CheB42a | (Park et al., 2006) |
| UAS-TbH-RNAi #1, 2 | Tyrosine β-hydroxylase | VDRC #107070, 51667 |
| UAS-OAMB-RNAi #1, 2, 3 | Mushroom body OA receptor | Bloomington #31233, 31711; VDRC #106511 |
| UAS-Cha-RNAi | Choline acetyltransferase | VDRC #20183 |
| UAS-VAChT-RNAi | Vesicular acetylcholine transporter | VDRC #40918 |
| UAS-DAT-RNAi | DA transporter | VDRC #12082 |
| UAS-TH-RNAi | Tyrosine hydroxylase | VDRC #3308 |
| UAS-Dop1R1-RNAi | DA 1-like receptor 1 | VDRC #107058 |
| UAS-Dop1R2-RNAi | DA 1-like receptor 2 | VDRC #105324 |
| UAS-VGAT-RNAi #1, 2 | Vesicular GABA transporter | VDRC #103586, 45916 |
| UAS-Tdc2-RNAi | Tyrosine decarboxylase | Bloomington #25871 |
| UAS-SERT-RNAi | 5HT transporter | VDRC #11346 |
| UAS-GABA B R1-RNAi | Metabotropic GABA-B receptor subtype1 | VDRC #101440 |
| UAS-GABA B R2-RNAi | Metabotropic GABA-B receptor subtype2 | VDRC #1785 |
| UAS-GABA B R3-RNAi #1, 2 | Metabotropic GABA-B receptor subtype3 | VDRC #108036, 50176 |
| UAS-GAD1-RNAi | Glutamic acid decarboxylase | VDRC #32344 |
-
*
AL: antennal lobe; CX: central complex; EB: ellipsoid body; FSB: fan-shaped body; MB: mushroom body; PC: protocerebrum; PI: pars intercerebralis; SEZ: subesophageal zone; TG: thoracic ganglion; VNC: ventral nerve cord; 5HT: serotonin; DA: dopamine; OCT: octopamine; TA: tyramine.
Table 3
Primers used for quantitative and semi-quantitative (semi-Q) PCR experiments
| Forward primer (5′–3′) | Reverse primer (5′–3′) | Annealing temperature (°C) | |
|---|---|---|---|
| Gr68a (qPCR) | CCAAGGTGATACCGAGGAGGAGA | TCGTGAAGAGTGCGAAAGTG | 60 |
| Gr68a (semi-Q PCR) | CCAAGGTGATACCGAGGAGA | CATTGGCCAGCAGATACTCA | 55 |
| CG6024 | CCAAGGTGATACCGAGGAGA | TCATGAAGAGTGCGAAAGTG | 60 |
| NPF | GCGAAAGAACGATGTCAACAC | TGTTGTCCATCTCGTGATTCC | 60 |
| rp49 | CCAAGGACTTCATCCGCCACC | GCGGGTGCGCTTGTTCGATCC | 55 |
| RMCE vector | GTACTGACGGACACACCGAAG | GGATCAACTACCGCCACCT | 52 |
