Permissive and instructive Hox codes govern limb positioning
- Institute of Neuroanatomy, University of Bonn, Medical Faculty, Germany
- School of Basic Medical Sciences, Ningxia Medical University, China
- Biological and Medical Research Centre (BMFZ), Medical Faculty, Heinrich-Heine-University Duesseldorf, Germany
- Institute of Zoology, School of Life Sciences, Lanzhou University, China
- College of Pastoral Agriculture Science and Technology, Lanzhou University, China
- Key Laboratory of Regenerative Medicine, Ministry of Education, Department of Developmental and Regenerative Biology, Jinan University, China
- Institute of Evolutionary Biology and Animal Ecology, Rheinische Friedrich-Wilhelms-Universität, Germany
- Institute of Anatomy, Department of Cell Biology, University of Bonn, Medical Faculty, Germany
- Deparment of Anatomy and Cell Biology, University Medical School Goettingen, Germany
- University Hospital Bonn, Germany
- Laboratory of Systems Biomedicine and Evolution, School of Life Sciences, University of Warwick, United Kingdom
- School of Biological Sciences, University of Reading, United Kingdom
Figures
Figure 1
Hoxa4/a5/a6/a7 genes are necessary for wing bud formation.
Schemes showing the electroporation in transverse section (a) and in the dorsal view (b). The somite 16 is marked (b). Successful transfection of plasmids as verified by EGFP expression (c). The dn Hox genes downregulated the expression of Tbx5 (B–E), Fgf10 (G–J), and Fgf8 (L–O) and inhibited wing bud formation at the ipsilateral (right) side (Q–T). A–E: HH14; F–O: HH18–19; P–T: HH22; scale bars in c (for c, A–O) and in P (for P–T): 500 μm. The proximodistal (P–D) distance (left in U) of wing buds is significantly reduced in Hox dn-expressing wing buds compared to EGFP electroporated wing buds (right in U). The scheme on the left-hand side shows how measurements were made. Red dotted line: baseline of the wing bud; CTRL: normal control wing buds without any operation; Elect.: wing buds after electroporation without constructs; GFP: wing buds after electroporation with EGFP-expressing constructs; A4dn, A5dn, A6dn, A7dn: wing buds after electroporation with dn Hoxa4/5/6/7 expressing constructs, respectively. Each dot represents one embryo; error bars represent mean ± SEM. **p<0.01.
Figure 2
Hoxa6/a7, but not Hoxa4/a5, are sufficient to induce a neck wing bud.
Scheme showing electroporation of the neck region in the dorsal view (a). The somite 16 is marked. The expression domain of electroporated constructs is marked by a green bar. Expression of Hoxa4 (b), Hoxa5 (c), Hoxa6 (d), Hoxa7 (e) in the LPM anterior to the wing field after electroporation with the respective plasmids as documented by in situ hybridisation. Whereas ectopic cervical expression of Hoxa6/a7 induced the anterior expression (indicated by arrows) of Tbx5 (D, E, I, J), overexpression of Hoxa4/a5 did not induce anterior expression of it (B, C, G, H). Also, only Hoxa6 and Hoxa7, but not a4 or a5, resulted in the anterior extension of the wing bud (arrows in I–J). The ectopic wing buds (fused with or separated from the endogenous one) induced by HoxPG6–7 are indicated by GFP fluorescence (K–O) and in situ hybridisation for Tbx5 (arrows in P–T). b–e and A–E: HH14; F–T: HH22; scale bars in b (for b–e and A–E), in F (for F–J) and in K (for K–T): 500 μm. Arrows indicate induced wing buds (P–T).
Figure 3
The neck wing bud is smaller than the natural wing bud.
The scheme (A) indicates how tissue samples were collected for RNA sequencing. Venn diagram (B) showing the overlap between up-regulated genes expressed in normal wing bud (Wing 948), HoxA6-induced wing bud (A6-Bud 347), and neck tissue (Neck 2202) in the cervical LPM; the heatmap (B’) showing the expression profiles of genes in neck tissue, normal wing bud, and HoxA6-induced wing bud. FC: fold change. Gene Ontology (C) analyses showing top 15 terms in biological process for 221 genes of A6-Bud. The heatmap (D) shows the expression levels of genes related to outgrowth and patterning. The expression of Fgf10 (E, F), Fgf8 (G, H), Shh (I), and Lmx1 (J) in transfected embryos is rechecked by ISH. (E and G): HH18-19; (F, H, I and J): HH22; scale bars in (E) (for E, G) and in (F) (for F, H–J): 500 μm. Arrows indicate induced wing buds.
Figure 4
Permissive, instructive, and inhibitory Hox codes regulate the forelimb positioning.
The phylogenetic tree of gnathostomes (A, redrawn from Hirasawa et al., 2016) shows that despite the variation in the number of cervical vertebrae (C.V.), the pectoral fin and forelimb (dark blue) are always located at the cervical-thoracic boundary. However, their axial positions with respect to somite number vary widely across species (B and C modified from Burke et al., 1995). (B, C) Bright circles: numbered somites; grey shaded circles: thoracic somites; black bars: spinal nerves of the brachial plexus; curved lines: limb bud. In lamprey embryos (D), expression of Tbx5 homologue is restricted to the heart region (Adachi et al., 2016). In skate embryos (E), Tbx5 expression (blue) extended slightly caudally from the heart anlage (Adachi et al., 2016). In avian embryos (F), it extends from the heart over the neck to the wing field. During wing bud formation, Tbx5 expression is restricted to only the heart and the wing bud. In lateral plate mesoderm, Hox4/5 expression (yellow) extends into the neck region, whereas the anterior expression domain of Hox6/7 (green) is at the wing level. Hox9 expression (magenta) starts posteriorly to the wing. The yellow, green, and magenta colours represent permissive, instructive, and inhibitory functions, respectively. The blue curved line outlines the wing bud.
Tables
Table 1
Dominant-negative expression of Hoxa4/a5/a6/a7 down-regulated gene expression.
The numbers of embryos with an unambiguous effect and the total number of embryos analysed are given (effect/total number analysed).
| Tbx5 | Fgf10 | Fgf8 | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Expression level decreased | Expression domain shortened | Both down-regulation | Expression level decreased | Expression domain shortened | Both down-regulation | Expression level decreased | Expression domain shortened | Both down-regulation | |
| A4dn | 15/17 | 12/17 | 10/17 | 10/11 | 9/10 | 9/10 | 10/10 | 6/10 | 6/10 |
| A5dn | 6/6 | 5/6 | 5/6 | 5/6 | 5/6 | 5/6 | 4/6 | 4/6 | 4/6 |
| A6dn | 6/6 | 6/6 | 6/6 | 6/6 | 5/6 | 5/6 | 5/5 | 5/5 | 5/5 |
| A7dn | 5/8 | 4/8 | 5/8 | 6/8 | 6/8 | 6/8 | 6/6 | 5/6 | 5/6 |
Table 2
HoxPG6/7 up-regulated wing bud formation in the neck region.
Number indicates the numbers of embryos in which a cervical extension of the wing bud, or a cervical wing bud separated from the normal wing bud could be observed.
| A6 | B6 | C6 | A7 | B7 | Total | |
|---|---|---|---|---|---|---|
| Extension | 31 | 7 | 5 | 37 | 18 | 98 |
| Separated | 45 | 10 | 10 | 51 | 12 | 128 |
| Total | 76 | 17 | 15 | 88 | 30 | 226 |
Table 3
The name of 221 genes.
221 genes showed that the A6-induced bud closely resembles a normal wing bud.
| Gene name | |
|---|---|
| 221 Genes | ACSBG2 ALC AMPD3 ANGPTL5 AP1S2 APCDD1 APOD ASNS C4orf19 CA9 CALCA CALN1 CAMK1G CAMKK1 CASP10 CBLN3 CCDC3 CCND1 CDC7 CDH17 CG-16 CHRDL1 CKMT2 COMTD1 CRABP-I CRLF1 CRTAC1 CXCR4 CYP26C1 DACH1 DKK1 DLX5 DLX6 DNER DPYSL4 DUSP4 DUSP6 DYNC1I1 ECEL1 EDAR EGR1 EMX1 ENKUR ERMN ESM1 ETV4 ETV7 EXO1 EYA1 EYA2 FAM184B FAM222A FAM49A FGF10 FGF8 FSIP1 FSTL4 G0S2 GABRB2 GABRD GALNT17 GBX2 GJA5 GMNN GNG4 GPR176 GRIK1 GSC GSTO2 H2AFJ HES4 HGF HMP19 HOMER2 HOXA10 HOXA11 HOXA6 HOXA7 HOXA9 HOXB7 HOXC6 HOXC8 HOXC9 HOXD10 HOXD11 HOXD8 HOXD9 HPSE2 HSP90AB1 HSPE1 HTRA1 ID1 IL17RD ITPR2 JARID2 KCNAB1 KCNG1 KCNJ5 KCNT2 LDHB LGR6 LHX2 LHX9 LIMD2 LMO3 LMX1B LONRF3 LYSMD3 MAP2 MAPK11 MECOM MET MIF MSX1 MYB MYCN NEGR1 NKAIN3 NOG NPTX1 NT5E NTS OLFML1 ORC6 OVA PAX3 PCDH10 PDE3B PDGFA PFN4 PGK2 PHF24 PHLDA2 PIGA PRDM1 PRDM16 PTGS2 RAB36 RASD1 RASSF3 RASSF9 RFC3 RGS7 RSPH14 RSPO2 RTN1 RUNX3 SALL1 SCD SCG5 SCUBE1 SCUBE3 SDC1 SHOX SIM2 SLC5A1 SNAI1 SOST SOX8 SP8 SPOCK3 SPRY2 SUV39H2 TBX15 TCAIM TDO2 TEN1 TERB1 THSD7B TMEM132C TMEM132E TMEM59L TNFRSF13B TOM1L1 TOX3 TRARG1 TRMT9B TWIST3 TYW3 VEGFD WFDC1 WNT7A ZADH2 ZBTB32 ZIC2 ZIC5 ZNF385C gene:ENSGALG00000001136 gene:ENSGALG00000002461 gene:ENSGALG00000005037 gene:ENSGALG00000005790 gene:ENSGALG00000006325 gene:ENSGALG00000007131 gene:ENSGALG00000010268 gene:ENSGALG00000011040 gene:ENSGALG00000011747 gene:ENSGALG00000012045 gene:ENSGALG00000012544 gene:ENSGALG00000013268 gene:ENSGALG00000014719 gene:ENSGALG00000015366 gene:ENSGALG00000015692 gene:ENSGALG00000020895 gene:ENSGALG00000022875 gene:ENSGALG00000026154 gene:ENSGALG00000026754 gene:ENSGALG00000027002 gene:ENSGALG00000034918 gene:ENSGALG00000041500 gene:ENSGALG00000042491 gene:ENSGALG00000044224 gene:ENSGALG00000046487 gene:ENSGALG00000046504 gene:ENSGALG00000046714 gene:ENSGALG00000047687 gene:ENSGALG00000048097 gene:ENSGALG00000051549 gene:ENSGALG00000052769 gene:ENSGALG00000054625 gene:ENSGALG00000054964 gene:ENSGALG00000054968 |
Table 4
Gene Ontology analyses showing top 10 terms in Biological Process.
| Wing | A6-Bud | Neck | |||
|---|---|---|---|---|---|
| Term | p-Value | Term | p-Value | Term | p-Value |
| Regulation of transcription from RNA polymerase II promoter | 8.40E-11 | Anterior/posterior pattern specification | 2.50E-10 | Cell adhesion | 4.30E-19 |
| Anterior/posterior pattern specification | 3.20E-10 | Proximal/distal pattern formation | 8.70E-09 | Extracellular matrix organisation | 4.20E-15 |
| Embryonic skeletal system morphogenesis | 2.00E-09 | Regulation of transcription from RNA polymerase II promoter | 3.20E-08 | Transmembrane receptor protein tyrosine kinase signalling pathway | 4.80E-13 |
| Proximal/distal pattern formation | 3.70E-09 | Protein folding | 1.50E-07 | Positive regulation of kinase activity | 1.60E-10 |
| Embryonic limb morphogenesis | 8.10E-09 | Embryonic skeletal system morphogenesis | 1.30E-07 | Multicellular organism development | 3.10E-09 |
| Dorsal/ventral pattern formation | 3.40E-08 | rRNA processing | 4.90E-05 | Cell-cell adhesion | 2.30E-08 |
| Neuron differentiation | 8.30E-08 | Embryonic limb morphogenesis | 1.40E-04 | Heart development | 4.20E-08 |
| Embryonic forelimb morphogenesis | 3.70E-06 | Ribosome biogenesis | 2.70E-04 | Axon guidance | 2.00E-07 |
| Embryonic hindlimb morphogenesis | 5.50E-06 | Neuron differentiation | 4.10E-04 | Negative regulation of cell migration | 1.20E-06 |
| Multicellular organism development | 8.60E-06 | Positive regulation of gene expression | 6.40E-04 | Blood coagulation | 1.40E-06 |
Table 5
Primer sequences used for generating in situ hybridisation probes by PCR.
| Genes | Forward primer | Reverse primer |
|---|---|---|
| Tbx5 | TACTGGAGCCCACTGGATGA | ATGCTCGGTGGTGGAACATT |
| Hoxa4 | ATGACCATGAGTTCGTTTTTGAT | GCTAGCGCGGCCGCGT |
| Hoxa5 | TGAAAAACTCCCTGGGCAACTC | AGCTGCCATGCTCATACTTTTC |
| Hoxa6 | CAGTCCAACACCGTCATTGC | CTCCCCTGACTTTTCCTCTGTT |
| Hoxa7 | TCAAAGCCCGTTCTCTTCCG | AGATCTTGATCTGCCGCTCC |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Permissive and instructive Hox codes govern limb positioning
eLife 13:RP100592.
https://doi.org/10.7554/eLife.100592.3
