1. Microbiology and Infectious Disease

Membrane binding controls the ATPase cycle and localization of MinD in Bacillus subtilis

  1. Helge Feddersen
  2. Charlotte Dyckmans
  3. Marc Bramkamp  Is a corresponding author
  1. Institute for General Microbiology, Christian-Albrechts-University Kiel, Germany
https://doi.org/10.7554/eLife.101517.4
Share this article
Cite this article
  1. Helge Feddersen
  2. Charlotte Dyckmans
  3. Marc Bramkamp
(2026)
Membrane binding controls the ATPase cycle and localization of MinD in Bacillus subtilis
eLife 13:RP101517.
https://doi.org/10.7554/eLife.101517.4
  2. Download BibTeX
  3. Download .RIS
7 figures, 6 tables and 6 additional files

Figures

Figure 1 with 2 supplements
Download asset Open asset
Biochemical analysis of B. subtilis MinD ATPase cycle.

(A) Phosphate release plotted against different MinD concentrations, fitted with a simple linear regression (R2=0.97). Phosphate release was measured using the EnzChek phosphate assay kit. Samples contained 0.2 mg ml–1 liposomes and were pre-incubated for 10 min before addition of 2 mM Mg2+-ATP; n≥3. (B) Specific activity of the MinD ATPase from (A) measured as a function of MinD concentration. (C) Specific activity of MinD measured as a function of ATP concentration, determined as in (B) with fixed MinD concentration of 10 µM. Fitting the Michaelis-Menten equation (black lines) gives kcat = 36.27 hr−1, Vmax = 19.50 nmol mg–1 min–1 and KM = 0.173 mM. (D) Specific activity of MinD measured as a function of liposome concentration, determined as in (B) with fixed MinD concentration of 6 µM. Fitting the Michaelis-Menten equation (black lines) gives kcat = 41.01 hr−1, Vmax = 22.05 nmol mg–1 min–1 and KM = 0.0437 mg ml–1.

Figure 1—figure supplement 1
Download asset Open asset
His-MinD purification analysis.

(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel analysis of purification products of His-MinD (31.7 kDa), stained with Coomassie blue stain. From left to right: Ladder, pellet after lysate, supernatant, Ni-NTA peaks A2, A7, C4 (main peak), concentrated sample, gel filtration peak. Ladder = Color Prestained Protein Standard, Broad Range (New England Biolabs). (B) Western blot of replicate gel from (A) using Penta-His antibody (QIAGEN).

Figure 1—figure supplement 1—source data 1

Original files for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis displayed in Figure 1—figure supplement 1.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig1-figsupp1-data1-v1.zip
Figure 1—figure supplement 1—source data 2

PDF file containing original sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blots for Figure 1—figure supplement 1, indicating the relevant bands.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig1-figsupp1-data2-v1.zip
Figure 1—figure supplement 2
Download asset Open asset
Gel filtration chromatograms of His-MinD and variants.

Gel filtration analysis of purified His-MinD and indicated mutants. Curves were aligned according to the respective void volume after sample injection. Green and red dotted lines mark the calibrated elution volumes corresponding to proteins of 31.69 kDa (His-MinD monomer) and 63.38 kDa (His-MinD dimer), as determined from molecular weight standards.

Figure 2 with 2 supplements
Download asset Open asset
Biochemical analysis of the effect of His-MinC or His-PDZ on MinD ATPase activity.

(A) Left: Specific activity of MinD measured as a function of ATP concentration. Phosphate release was measured using the EnzChek phosphate assay kit. Samples contained 6 µM His-MinD, 6 µM His-MinC, and 0.2 mg ml–1 liposomes and were pre-incubated for 10 min before addition of 2 mM Mg2+-ATP; n≥3. Fitting the Michaelis-Menten equation (black lines) gives kcat = 15.77 hr−1, Vmax = 8.30 nmol mg–1 min–1 and KM = 0.10 mM. Right: Relative activity of 6 µM His-MinD in the presence of 6 µM His-MinC (blue) compared to an internal control of 6 µM His-MinD (black, relative activity = 1). Whiskers represent SD. Specific activity of only His-MinD was 8.61 [nmol mg–1 min–1] (SD = 0.03, n=2). Relative activity of 6 µM His-MinD in the presence of 6 µM His-MinC was 0.95 with SD = 0.071 (n=3). Significance was assessed by performing Welch’s t-test on the raw data. p<0.05. (B) Left: Specific activity of MinD measured as a function of ATP concentration. Phosphate release was measured using the EnzChek phosphate assay kit. Samples contained 6 µM His-MinD, 5 µM His-PDZ, and 0.2 mg ml–1 liposomes and were pre-incubated for 10 min before addition of 2 mM Mg2+-ATP; n≥3. Fitting the Michaelis-Menten equation (black lines) gives kcat = 12.07 hr−1, Vmax = 6.35 nmol mg–1 min–1 and KM = 0.233 mM. Right: Relative activity of 6 μM His-MinD in the presence of different concentrations of His-PDZ (blue) compared to only 6 μM His-MinD (black, relative activity = 1). Whiskers represent SD. Specific activity of an internal control of His-MinD was 4.60 nmol mg–1 min–1 (SD = 0.03, n=2). Relative activities of His-MinD in the presence of 1 µM, 3 µM, and 5 µM His-PDZ were 1.22, 1.37, and 1.25 with SD = 0.07, 0.13, and 0.03, respectively (n=3 each). Significance was assessed by performing Welch’s t-test on the raw data of all samples vs. control. p<0.05 for all PDZ concentrations.

Figure 2—figure supplement 1
Download asset Open asset
His-MinC purification analysis.

(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel analysis of purification products of His-MinC (27.3 kDa), stained with Coomassie blue stain. From left to right: Ladder, Ni-NTA peak, SEC peak. Ladder = Color Prestained Protein Standard, Broad Range (New England Biolabs). (B) Western blot of replicate gels from (A) using Penta-His antibody (QIAGEN).

Figure 2—figure supplement 1—source data 1

Original files for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis displayed in Figure 2—figure supplement 1.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig2-figsupp1-data1-v1.zip
Figure 2—figure supplement 1—source data 2

PDF file containing original sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blots for Figure 2—figure supplement 1, indicating the relevant bands.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig2-figsupp1-data2-v1.zip
Figure 2—figure supplement 2
Download asset Open asset
His-PDZ purification analysis and rendering of MinJ AlphaFold model.

(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel analysis of purification products of His-PDZ (17.6 kDa), stained with Coomassie blue stain. From left to right: Ladder (L), Ni-NTA main peak. Ladder = Color Prestained Protein Standard, Broad Range (New England Biolabs). (B) Western blot of replicate gel from (A) using Penta-His antibody (QIAGEN). (C) Rendering of AlphaFold3 model of B. subtilis MinJ (gray) (Abramson et al., 2024). The truncation expressed with pET-28a-PDZ, which includes the PDZ domain (blue), is highlighted in pink.

Figure 2—figure supplement 2—source data 1

Original files for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis displayed in Figure 2—figure supplement 2.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig2-figsupp2-data1-v1.zip
Figure 2—figure supplement 2—source data 2

PDF file containing original sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blots for Figure 2—figure supplement 2, indicating the relevant bands.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig2-figsupp2-data2-v1.zip
Figure 3
Download asset Open asset
Cartoon of MinD AlphaFold model with highlighted key amino acids and the effects of their mutagenesis.

(A) Left: Rendering of MinD AlphaFold model with ATP binding region highlighted in light blue, membrane targeting sequence (MTS) in turquoise, and key residues in orange. Box: explanation of mutagenesis effects. Right: Close-up on hydrophobic region of amphipathic helix. (B) Representative wide-field microscopy images of B. subtilis expressing indicated Halo-MinD variants as the only MinD copy from the native locus, stained with TMR ligand. Left: phase contrast; scale bar 5 µm. Right: fluorescence.

Figure 4 with 4 supplements
Download asset Open asset
His-MinD mutants are catalytically inactive in ATP hydrolysis assay.

(A) Phosphate release plotted against different His-MinD-I260E concentrations and His-MinD as control, fitted with a simple linear regression. Phosphate release was measured using the EnzChek phosphate assay kit. Samples contain 0.2 mg ml–1 liposomes and were pre-incubated for 10 min before the addition of 2 mM Mg2+-ATP. (B) Same as (A) but with different y-axis scaling for better visualization of His-MinD-I260E baseline activity. (C) Same as (B) but comparing His-MinD mutants G12V, K16A, and D40A to His-MinD at 6 µM concentrations, respectively.

Figure 4—figure supplement 1
Download asset Open asset
His-MinD-I260E purification analysis.

(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel analysis of purification products of His-MinD-I260E (31.7 kDa), stained with Coomassie blue stain. From left to right: Ladder, supernatant after lysis, pellet, Ni-NTA flowthrough, Ni-NTA peaks A10 and C4 (main peak), concentrated sample, gel filtration peak. Ladder = Color Prestained Protein Standard, Broad Range (New England Biolabs). (B) Western blot of replicate gel from (A) using Penta-His antibody (QIAGEN).

Figure 4—figure supplement 1—source data 1

Original files for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis displayed in Figure 4—figure supplement 1.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp1-data1-v1.zip
Figure 4—figure supplement 1—source data 2

PDF file containing original sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blots for Figure 4—figure supplement 1, indicating the relevant bands.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp1-data2-v1.zip
Figure 4—figure supplement 2
Download asset Open asset
His-MinD-G12V purification analysis.

(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel analysis of purification products of His-MinD-G12V (31.7 kDa), stained with Coomassie blue stain. From left to right: Ladder, pellet after lysate, supernatant, Ni-NTA flowthrough, Ni-NTA peaks A2, A10, C4 (main peak), concentrated sample, gel filtration peak. Ladder = Color Prestained Protein Standard, Broad Range (New England Biolabs). (B) Western blot of replicate gel from (A) using Penta-His antibody (QIAGEN).

Figure 4—figure supplement 2—source data 1

Original files for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis displayed in Figure 4—figure supplement 2.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp2-data1-v1.zip
Figure 4—figure supplement 2—source data 2

PDF file containing original sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blots for Figure 4—figure supplement 2, indicating the relevant bands.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp2-data2-v1.zip
Figure 4—figure supplement 3
Download asset Open asset
His-MinD-K16A purification analysis.

(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel analysis of purification products of His-MinD-K16A (31.7 kDa), stained with Coomassie blue stain. From left to right: Ladder, pellet after lysate, supernatant, Ni-NTA flowthrough, Ni-NTA peaks A2, A10, C4 (main peak), concentrated sample, gel filtration peak. Ladder = Color Prestained Protein Standard, Broad Range (New England Biolabs). (B) Western blot of replicate gel from (A) using Penta-His antibody (QIAGEN).

Figure 4—figure supplement 3—source data 1

Original files for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis displayed in Figure 4—figure supplement 3.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp3-data1-v1.zip
Figure 4—figure supplement 3—source data 2

PDF file containing original sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blots for Figure 4—figure supplement 3, indicating the relevant bands.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp3-data2-v1.zip
Figure 4—figure supplement 4
Download asset Open asset
His-MinD-D40A purification analysis.

(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel analysis of purification products of His-MinD-D40A (31.7 kDa), stained with Coomassie blue stain. From left to right: Ladder, supernatant after lysis, pellet, Ni-NTA flowthrough, Ni-NTA peaks A2 and C4 (main peak), concentrated sample, gel filtration peak. Ladder = Color Prestained Protein Standard, Broad Range (New England Biolabs). (B) Western blot of replicate gel from (A) using Penta-His antibody (QIAGEN).

Figure 4—figure supplement 4—source data 1

Original files for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis displayed in Figure 4—figure supplement 4.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp4-data1-v1.zip
Figure 4—figure supplement 4—source data 2

PDF file containing original sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blots for Figure 4—figure supplement 4, indicating the relevant bands.

https://cdn.elifesciences.org/articles/101517/elife-101517-fig4-figsupp4-data2-v1.zip
Figure 5 with 2 supplements
Download asset Open asset
Bio-layer interferometry (BLI) analysis of His-MinD and different mutants.

(A) Left: Cartoon representation of the different BLI steps, starting with (1) establishing a baseline in protein buffer, (2) binding of liposomes through the biotinylated DSPE-PEG(2000) phospholipid, (3) establishing a new baseline, (4) binding of MinD, and finally (5) dissociation of MinD. Right: Exemplary graph resulting from sensor readouts of steps (1)–(5). (B) MinD binding plotted against time through association and dissociation phases (steps 4–5) at different protein concentrations, including the His-MinD-I260E mutant. (C–E) Same as (B) using the indicated respective mutants of His-MinD (G12V, K16A, and D40A).

Figure 5—figure supplement 1
Download asset Open asset
Bio-layer interferometry (BLI) analysis of interactions between His-MinD and His-MinC or His-PDZ.

(A) MinD binding (see Figure 5A) plotted against time through association and dissociation phases (steps 4–5) at different indicated His-MinC concentrations, including His-MinD and His-MinC only controls, all in the presence of freshly added ATP [2 mM]. (B) Same as (A) using the indicated respective concentrations of His-PDZ.

Figure 5—figure supplement 2
Download asset Open asset
Bio-layer interferometry (BLI) analysis of His-MinD without the addition of ATP.

His-MinD binding to liposome-associated BLI sensor (see Figure 5), plotted against time through association and dissociation phases at different protein concentrations without the addition of Mg2+-ATP.

Figure 6
Download asset Open asset
Single-molecule localization microscopy (SMLM) analysis of Halo-MinD and mutants expressed in B. subtilis.

Exponentially growing B. subtilis cells expressing Halo-MinD and variants (n≥48 cells, respectively) were stained with TMR ligand and subsequently imaged. Individual protein trajectories were recorded using SMLM and analyzed with Zen Blue (Zeiss), TrackMate, the SMTracker 2.0 software package, and manual scripts in R. Minimum track-length 4 frames of 24 ms, with at least 2596 trajectories per strain. (A) Heatmap representation of intracellular localization of individual molecules of Halo-MinD and variants, respectively, plotted on normalized cells. Brighter colors indicate higher abundance. (B) Barplot of stationary localization analysis (SLA), comparing different track types within the protein population. Tracks were considered static when not leaving a circular area of 97 nm diameter within 5+ frames. Mobile populations were further divided into free and mixed tracks, where mixed tracks displayed a switch between free and confined movement. (C) Plot of the mean-squared displacement of Halo-MinD and variants over time, fitted with a linear fit excluding the last time lag. (D) Bubble plot displaying single-molecule diffusion rates of the indicated MinD fusions. Populations were determined by fitting the probability distributions of the frame-to-frame displacement (jump distance) data of all respective tracks to a three-component model (fast mobile, slow mobile, and confined protein populations). (E) Probability distributions of jump distances of Halo-MinD and variants. Data was fit with a three-component model, indicating confined, slow, and fast tracks.

Figure 7
Download asset Open asset
Single-molecule localization microscopy (SMLM) analysis of Halo-MinD expressed in B. subtilis wild-type and mutant backgrounds.

Exponentially growing B. subtilis cells expressing Halo-MinD in the indicated genetic backgrounds (n≥115 cells, respectively) were stained with TMR ligand and subsequently imaged. Individual protein trajectories were recorded using SMLM and analyzed with Zen Blue (Zeiss), TrackMate, the SMTracker 2.0 software package, and manual scripts in R. Minimum track-length 4 frames of 24 ms, with at least 2688 trajectories per strain. (A) Heatmap representation of intracellular localization of individual molecules of Halo-MinD in the indicated genetic background, respectively, plotted on normalized cells. Brighter colors indicate higher abundance. (B) Barplot of stationary localization analysis (SLA), comparing different track types within the protein population. Tracks were considered static when not leaving a circular area of 97 nm diameter within 5+ frames. Mobile populations were further divided into free and mixed tracks, where mixed tracks displayed a switch between free and confined movement. (C) Bubble plot displaying single-molecule diffusion rates of Halo-MinD in different genetic backgrounds. Populations were determined by fitting the probability distributions of the frame-to-frame displacement (jump distance) data of all respective tracks to a three-component model (fast mobile, slow mobile, and confined protein populations). (D) Probability distributions of jump distances of Halo-MinD in different genetic backgrounds. Data was fit with a three-component model, indicating confined, slow, and fast tracks.

Tables

Table 1
Measurements of cell length and minicell formation of B. subtilis strains.
StrainRelevant genotypeLength ± SD (µm)Minicells (%)No. cells counted
168Wild type3.32±0.910.20610
BHF077ΔminD5.80±2.1033.53865
BHF078Halo-MinD4.06±0.997.44430
BHF079Halo-MinD (G12V)6.13±2.1334.54443
BHF080Halo-MinD (K16A)5.44±1.8438.45489
BHF081Halo-MinD (D40A)5.67±2.0933.70454
BHF082Halo-MinD (I260E)5.38±1.6833.01721
Table 2
Kinetic constants of His-MinD and variants obtained via bio-layer interferometry (BLI).
ProteinKD [µM]kon [M–1 s–1]kon errorkoff [s–1]koff errorX2R2
MinD7.173.03×1030.13×10321.7×10–30.33×10–316.070.95
MinD-G12V75.380.63×1030.19×10347.8×10–31.13×10–313.890.95
MinD-K16A1.362.03×1030.062×1032.77×10–30.088×10–36.970.95
MinD-D40A0.742.39×1030.053×1031.76×10–30.069×10–36.010.98
MinD-I260E74.360.18×1030.19×10313.45×10–30.38×10–33.610.95

  1. KD = equilibrium dissociation constant; kon = association rate constant; koff = dissociation rate constant.

Table 3
Kinetic constants of His-MinD in combination with His-MinC or His-PDZ.
ProteinKD [µM]kon [M–1 s–1]kon errorkoff [s–1]koff errorX2R2
MinD*31.70.27×1030.21×1038.65×10–30.26×10–34.100.957
+MinC33.40.35×1030.084×10311.7×10–30.16×10–38.070.979
MinD*51.10.34×1030.12×10317.5×10–30.24×10–32.400.986
+PDZ47.50.35×1030.14×10316.6×10–30.25×10–38.980.973

  1. KD = equilibrium dissociation constant; kon = association rate constant; koff = dissociation rate constant.

  2. *

    His-MinD control appears twice, from independent purifications. Since batches were not directly comparable, controls are only compared to samples containing the same batch. Concentrations: His-MinD 8 µM, His-MinC 1–16 µM [1, 2, 4, 8, 16], His-PDZ 1–16 µM [1, 2, 4, 8, 16], see Figure 5—figure supplement 1.

Table 4
Diffusion coefficients obtained from non-comparative square displacement (SQD) analysis of Halo-MinD and variants fitted with three populations.
StrainFast diffusive [µm2 s–1]Slow diffusive [µm2 s–1]Confined [µm2 s–1]
MinD WT0.60 (22.3%)0.084 (50.4%)0.020 (27.3%)
MinD-G12V0.68 (28.5%)0.10 (47.5%)0.026 (24.0%)
MinD-K16A0.70 (27.3%)0.11 (43.9%)0.024 (28.8%)
MinD-D40A0.44 (13.7%)0.063 (50.0%)0.021 (36.3%)
MinD-I260E0.76 (73.4%)0.095 (20.3%)0.022 (6.3%)

  1. Percentages indicate relative population size.

Table 5
Diffusion coefficients obtained from non-comparative square displacement (SQD) analysis of Halo-MinD in different genetic backgrounds fitted with three populations.
StrainFast diffusive [µm2 s–1]Slow diffusive [µm2 s–1]Confined [µm2 s–1]
WT0.57 (22.1%)0.083 (50.2%)0.019 (27.7%)
ΔminC0.31 (29.3%)0.059 (44.3%)0.01 (26.4%)
ΔminJ0.6 (19%)0.069 (41.2%)0.018 (39.7%)

  1. Percentages indicate relative population size.

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
AntibodyPenta-His antibody (Mouse monoclonal)QIAGENCat#: 34660, RRID:AB_2619735WB (1:1000)
AntibodyGoat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, APThermo Fisher ScientificCat#: A16081, RRID:AB_2534755WB (1:10,000)
Strain, strain background (B. subtilis)168Laboratory collectionStrain_ID:168Wild type; trpC2
Strain, strain background (B. subtilis)minC::lox71-kanR-lox66AddgeneStrain_ID:BKK28000B. subtilis BKK Library
Strain, strain background (B. subtilis)minJ::tetBramkamp et al., 2008Strain_ID:RD021
Strain, strain background (B. subtilis)minD::lox71-kanR-lox66AddgeneStrain_ID:BKK27990B. subtilis BKK Library
Strain, strain background (B. subtilis)minD::lox71-kanR-lox66This paperStrain_ID:BHF077BKK27990 gDNA ->168
Strain, strain background (B. subtilis)minD::aad9-Halo-minDThis paperStrain_ID:BHF078EHF054 ->BHF077
Strain, strain background (B. subtilis)minD::aad9-Halo-minD-G12VThis paperStrain_ID:BHF079EHF055 ->BHF077
Strain, strain background (B. subtilis)minD::aad9-Halo-minD-K16AThis paperStrain_ID:BHF080EHF056 ->BHF077
Strain, strain background (B. subtilis)minD::aad9-Halo-minD-D40AThis paperStrain_ID:BHF081EHF057 ->BHF077
Strain, strain background (B. subtilis)minD::aad9-Halo-minD-I260EThis paperStrain_ID:BHF082EHF058 ->BHF077
Strain, strain background (B. subtilis)minD::aad9-Halo-minD, minC::lox71-kanR-lox66This paperStrain_ID:BHF083BKK28000 gDNA ->BHF078
Strain, strain background (B. subtilis)minD::aad9-Halo-minD, minJ::tetThis paperStrain_ID:BHF084RD021 gDNA ->BHF078
Strain, strain background (E. coli)NEB 5-alphaNew England Biolabs (C2987H)Strain_ID:NEB 5-alphafhuA2Δ(argF-lacZ)U169 phoA glnV44 Φ80Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17
Strain, strain background (E. coli)BL21(DE3)pLysSPromegaCat#: L1195F–, ompT, hsdSB (rB–, mB–), dcm, gal, λ(DE3), pLysS, Cmr
Recombinant DNA reagentpUC18 (plasmid)Norrander et al., 1983Plasmid_ID:pUC18lacZα, pMB1 ori, bla (ApR)
Recombinant DNA reagentpET-28a (+) (plasmid)NovagenPlasmid_ID:pET-28a (+)kanR, T7lac, f1 ori, N-term His-tag/thrombin/T7-Tag
Recombinant DNA reagentpET-28a-minCThis paperPlasmid_ID:NAP012MinC amplified from 168
Recombinant DNA reagentpET-28a-minDThis paperPlasmid_ID:NAP013MinD amplified from 168
Recombinant DNA reagentpET-28a-minD-G12VThis paperPlasmid_ID:EHF045Mutagenesis of NAP013
Recombinant DNA reagentpET-28a-minD-K16AThis paperPlasmid_ID:EHF046Mutagenesis of NAP013
Recombinant DNA reagentpET-28a-minD-I260EThis paperPlasmid_ID:EHF047Mutagenesis of NAP013
Recombinant DNA reagentpET-28a-minD-D40AThis paperPlasmid_ID:EHF052Mutagenesis of NAP013
Recombinant DNA reagentpET-28a-PDZThis paperPlasmid_ID:CD001Truncated MinJ PDZ domain
Recombinant DNA reagentpUC18mut-minDNUp-aad9-Halo-minDLaboratory stockPlasmid_ID:EHF042
Recombinant DNA reagentpUC18-minC-aad9-haloTag-minD-minDdownThis paperPlasmid_ID:EHF054NEBuilder HiFi Assembly
Recombinant DNA reagentpUC18-minC-aad9-haloTag-minD-G12V-minDdownThis paperPlasmid_ID:EHF055Mutagenesis of EHF054
Recombinant DNA reagentpUC18-minC-aad9-haloTag-minD-K16A-minDdownThis paperPlasmid_ID:EHF056Mutagenesis of EHF054
Recombinant DNA reagentpUC18-minC-aad9-haloTag-minD-D40A-minDdownThis paperPlasmid_ID:EHF057Mutagenesis of EHF054
Recombinant DNA reagentpUC18-minC-aad9-haloTag-minD-I260E-minDdownThis paperPlasmid_ID:EHF058Mutagenesis of EHF054
Sequence-based reagentMinC-NdeI-FThis paperOligo_ID:NA016GTCATCATATGGTGAAGACCAAAAAGCAG
Sequence-based reagentMinC-XhoI-RThis paperOligo_ID:NA017GTCATCTCGAGTCACATTCCTCCCTCAAG
Sequence-based reagentMinD-NdeI-FThis paperOligo_ID:NA018GTCATCATATGTTGGGTGAGGCTATCGTA
Sequence-based reagentMinD-XhoI-RThis paperOligo_ID:NA019GTCATCTCGAGTTAAGATCTTACTCCGAA
Sequence-based reagentGC-1-pUC18toMinC-FThis paperOligo_ID:HF0245GCCTGCAGGTCGACTCTAGAGGATCCCCGGAACAAAGAATGGACTAACATTG
Sequence-based reagentGC-1-MinCtoSpec-RThis paperOligo_ID:HF0246ACATCCTTTCACCCTTCACATTCCTCCCTCAAG
Sequence-based reagentGC-2-MinCtoSpec-Halo-FThis paperOligo_ID:HF0247GGGAGGAATGTGAAGGGTGAAAGGATGTACTTAAAC
Sequence-based reagentGC-2-Spec-HalotoMinD-RThis paperOligo_ID:HF0248ATAGCCTCACCCAACCCATTGGAAATCTCCAGAG
Sequence-based reagentGC-3-HalotoMinD+Down-FThis paperOligo_ID:HF0249AGATTTCCAATGGGTTGGGTGAGGCTATCGTAATAAC
Sequence-based reagentGC-3-MinDDowntopUC18-RThis paperOligo_ID:HF0250CATGATTACGAATTCGAGCTCGGTACCCGCCTACTTCAATCTGCTGTTC
Sequence-based reagentMinD-G12V-QC-FThis paperOligo_ID:HF0213TCGGGAAAAGtCGGAGTAGGT
Sequence-based reagentMinD-G12V-QC-RThis paperOligo_ID:HF0214AGTTATTACGATAGCCTCAC
Sequence-based reagentMinD-K16A-QC-FThis paperOligo_ID:HF0215CGGAGTAGGTgcGACAACAACATC
Sequence-based reagentMinD-K16A-QC-RThis paperOligo_ID:HF0216CCTTTTCCCGAAGTTATTAC
Sequence-based reagentMinD-I260E-QC-FThis paperOligo_ID:HF0237GATGGCTAAGgaaAAGTCATTTTTCGG
Sequence-based reagentMinD-I260E-QC-RThis paperOligo_ID:HF0238ATTCCTTTGTTTTGCTCTTC
Sequence-based reagentMinD-D40A-QC-FThis paperOligo_ID:HF0239AGTAGATACTgcgATAGGACTGC
Sequence-based reagentMinD-D40A-QC-RThis paperOligo_ID:HF0240AAGCATACGCGCTTC
Sequence-based reagentMinJ-PDZ-28a-BamHI-FThis paperOligo_ID:HF0255CATGGATCCTTGGAGGTCTTGTTCCAGGGACCGCGTATTTTTCTG
Sequence-based reagentMinJ-PDZ-28a-XhoI-RThis paperOligo_ID:HF0256CGCCTCGAGTTATTATGATCCCGAAGCGAC
Peptide, recombinant proteinGel filtration standardBio-RadCat#: 1511901Used for SEC calibration
Commercial assay or kitEnzChek Phosphate Assay KitThermo Fisher ScientificCat#: E6646ATP hydrolysis analysis
Commercial assay or kitQ5 Site-Directed Mutagenesis KitNew England BiolabsCat#: E0554
Commercial assay or kitNEBuilder HiFi DNA Assembly Cloning KitNew England BiolabsCat#: E2621
Software, algorithmAlphaFold2Jumper et al., 2021https://doi.org/10.1038/s41586-021-03819-2; RRID:SCR_025454Structural modeling of MinD
Software, algorithmAlphaFold3Abramson et al., 2024https://doi.org/10.1038/s41586-024-07487-w; RRID:SCR_028034Structural modeling of MinJ
Software, algorithmFiji (ImageJ2)Schindelin et al., 2012https://doi.org/10.1038/nmeth.2019; RRID:SCR_002285Version 1.53 g
Software, algorithmOuftiPaintdakhi et al., 2016https://doi.org/10.1111/mmi.13264; RRID:SCR_016244Manual cell outlines for SMTracker 2.0
Software, algorithmSMTracker 2.0Oviedo-Bocanegra et al., 2021https://doi.org/10.1093/nar/gkab696SMLM track analysis
Software, algorithmMicrobeJDucret et al., 2016https://doi.org/10.1038/nmicrobiol.2016.77; RRID:SCR_023914Version 5.11c
Software, algorithmTrackMateTinevez et al., 2017https://doi.org/10.1016/j.ymeth.2016.09.016Version 6.0.1
Software, algorithmR StudioPositRRID:SCR_000432Version 2023.12.1+402
Software, algorithmGraphPad Prism 9GraphPad SoftwareRRID:SCR_002798Version 9.4.0, data visualization and analysis
Software, algorithmZen Blue/Zen BlackZeissRRID:SCR_013672Image acquisition and SR analysis
Software, algorithmBLItz ProSartoriusVersion 1.3.1.3Kinetic analysis and fitting
Software, algorithmTecan i-controlTecanVersion 2.0Control for Infinite 200 Pro
Software, algorithmR (4.2.2)R Development Core Team, 2022https://www.R-project.org/; RRID:SCR_001905Version 4.2.2
OtherStreptavidin (SA) BiosensorsSartoriusCat#: 18-5019Used with BLItz platform
OtherHaloTag TMR LigandPromega/ZeissCat#: G8251HaloTag staining
OtherNileRedThermo Fisher/InvitrogenCat#: N1142Cell membrane staining (1 µg ml–1)
OtherNi-NTA column (Protino)Macherey-NagelCat#: 745400.1Protein affinity purification
OtherSuperdex 200 Increase 10/300 GLCytivaCat#: 28990944Size-exclusion chromatography
OtherNuclepore Track-Etched MembraneWhatmanCat#: 10419506Polycarbonate membrane (0.1 µm)
OtherGene FramesThermo ScientificCat#: AB05771.5×1.6 cm
OtherAmicon Ultra filter devices 10 kDa MWCOMillipore; MerckCat#: UFC901008Protein concentration
OtherE. coli total extract (lipids)Avanti ResearchCat#: 100500CLiposome preparation
OtherDSPE-PEG(2000)-biotinAvanti ResearchCat#: 880129Liposome preparation

Additional files

Supplementary file 1

Oligonucleotides used in this study.

https://cdn.elifesciences.org/articles/101517/elife-101517-supp1-v1.xlsx
Supplementary file 2

Plasmids used in this study.

https://cdn.elifesciences.org/articles/101517/elife-101517-supp2-v1.xlsx
Supplementary file 3

Strains used in this study.

https://cdn.elifesciences.org/articles/101517/elife-101517-supp3-v1.xlsx
Supplementary file 4

Bio-layer interferometry (BLI) advanced kinetics protocol.

https://cdn.elifesciences.org/articles/101517/elife-101517-supp4-v1.xlsx
MDAR checklist
https://cdn.elifesciences.org/articles/101517/elife-101517-mdarchecklist1-v1.docx
Source data 1

Source data underlying most figures and tables in this paper.

https://cdn.elifesciences.org/articles/101517/elife-101517-data1-v1.xlsx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Helge Feddersen
  2. Charlotte Dyckmans
  3. Marc Bramkamp
(2026)
Membrane binding controls the ATPase cycle and localization of MinD in Bacillus subtilis
eLife 13:RP101517.
https://doi.org/10.7554/eLife.101517.4