Cdhr1a and pcdh15b may link photoreceptor outer segments with calyceal processes revealing a potential mechanism for cone-rod dystrophy
- Department of Biology, University of Kentucky, United States
Figures
Figure 1 with 1 supplement
Evolutionarily conserved localization of pcdh15 and cdhr1 in photoreceptors predicts interactions linking outer segments and calyceal processes.
(A-A”) Confocal microscopy of wildtype 5 dpf retinal cryosections probed with cdhr1a antibody (green), Peanut germ agglutinin (PNA - magenta) to label red-green cones, and pcdh15b (red). White boxes indicate the location of the inset enlargement. White arrowheads highlight the linear localization of cdhr1a along cone OSs (A) and pcdh15b outlining the calyceal process (A’). Merge of all three signals highlights the proximity between cdhr1a and pcdh15b (A”). B=blue cones, RG = red/green cones, UV = UV cones. Scale bar = 5 μm. (B-B”) Confocal microscopy of wildtype 5 dpf retinal cryosections probed with cdhr1a antibody (green), pcdh15b (red), and wheat germ agglutinin (WGA -teal) to label rods. White boxes indicate the location of the inset enlargement. White arrowheads highlight the linear localization of cdhr1a along rod OSs (B) and pcdh15b outlining the calyceal process (B’). Merge of all three signals highlights the proximity between cdhr1a and pcdh15b (B”). Scale bar = 10 μm. (C–E) Structured illumination microscopy (SIM) of 5 dpf wildtype zebrafish retinal cryosections probed with (C) cdhr1a (green) and pcdh15b (red), (D) pcdh15b (red) and actin (white) and (E) pcdh15b (red) and actin (white). White boxes represent the inset enlargement. White arrowheads highlight the juxtaposition or overlap between the cdhr1a, pcdh15b, and actin signals. Scale bar = 2.5 μm. (F–H) Structured illumination microscopy (SIM) of wildtype zebrafish whole mount 5 dpf retina in transverse orientation (OS outlined in magenta) probed with (F) cdhr1a (green) and pcdh15b (red), (G) cdhr1a (green) and actin (white) and (H) pcdh15b (red) and actin (white). White boxes represent the inset enlargement. Scale bar = 2.5 μm. (I) Immuno-gold-TEM detection of cdhr1a (green) and pcdh15b (red) in 5 dpf wildtype retinal sections. The CP is outlined in red and the OS in blue. Scale bar = 500 nm (J) Diagrammatic model of the connection between the OS discs and CPs in both rod and cone cells mediated by the interaction between OS-bound cdhr1a and CP-bound pcdh15b.
Figure 1—figure supplement 1
Expression of USHR genes in the zebrafish retina.
Whole mount in situ hybridization of 5 dpf zebrafish larva for (A) cdhr1a, (B) pcdh15b, (C) pcdh23, (D) ush1ga, (E) harmonin, (F) myo7aa. Ventral images of the embryos are displayed. White arrows indicate expression in the outer nuclear layer of the retina.
Figure 2
Evolutionarily conserved localization of pcdh15 and cdhr1 in photoreceptors predicts interactions linking outer segments and calyceal processes.
Structured illumination microscopy (SIM) of wildtype xenopus (A), mallard duck (B), macaque (C), human (D), mouse (E), rat (F), spiny mouse (G), and gerbil (H), retinal sections probed for cdhr1 (green), pcdh15 (red), and PNA (magenta) to label cone outer segments. White boxes represent the inset enlargements. White arrowheads highlight the juxtaposition of the cdhr1a and pcdh15b signals in each species. Scale bar = 5 μm.
Figure 3
Physical interactions between cdhr1a and pcdh15b can facilitate cell-cell adhesion.
(A) Immunoprecipitation of cdhr1a-FLAG and pcdh15b-MYC performed in HEK293 cell lysates. Pull down of cdhr1a-FLAG using anti-FLAG antibody beads also pulls down pcdh15b-MYC, while pull down of pcdh15b-MYC using anti-MYC antibody beads also pulls down cdhr1a-FLAG. (B) Diagrammatic representation of the K562 cell assay for assessing homophilic or heterophilic interactions between cadherins. (C) Brightfield microscopy analysis of K562 cell aggregation after transfection with either cdhr1a or pcdh15b or after co-culture of the two transfected populations. Magenta boxes indicate regions enlarged in the insets. (D) Quantification of the total number of aggregates observed in a single field of view. (E) Quantification of the number of average number of cells in each observed aggregate.
-
Figure 3—source data 1
Raw western blot images.
- https://cdn.elifesciences.org/articles/102258/elife-102258-fig3-data1-v1.zip
-
Figure 3—source data 2
Annotated western blot images.
- https://cdn.elifesciences.org/articles/102258/elife-102258-fig3-data2-v1.zip
Figure 4 with 1 supplement
Construction and confirmation of the cdhr1a-/- line.
(A) Exon/intron diagram of cdhr1a. The intron 6-exon 6-intron 7 junction is highlighted and the approximate location of the crRNA (black arrows) is depicted. (B) Genomic nucleotide sequence from the cdhr1aΔ173 line highlighting the sequence location of the 173 bp deletion compared to WT sequence. (C) Amino acid sequence alignment between wildtype and the cdhr1aΔ173 line. Alignment indicates that the 173 bp deletion leads to a frameshift and an immediate premature stop codon at AA146. (D) Diagrammatic representation of the domain structure of WT cdhr1a protein vs the cdhr1aΔ173 allele. EC = cadherin domain, TD = transmembrane domain, CD = cytoplasmic domain. (E) Confocal microscopy of 5 dpf retinal cryosections from WT and cdhr1a-/- retinas stained with anti-cdhr1a antibody (green), PNA (red-green cones - magenta) and WGA (blue cones - teal). Cdhr1a signal is detected along photoreceptor outer segments in the wildtype and completely missing in cdhr1a-/-. ROS = rod outer segment, RIS = rod inner segment. Scale bar = 5 μm.
Figure 4—figure supplement 1
Expression of cdhr1a and cdhr1b.
Whole mount in situ hybridization of 5 dpf zebrafish larva for (A–C) cdhr1a, (D–F) cdhr1b in WT, cdhr1a+/-or cdhr1a-/- individuals. Ventral images of the embryos are displayed. Yellow arrows indicate expression in the outer nuclear layer of the retina. cdhr1a retinal expression is lost in the homozygous mutant. cdhr1b expression is absent from the retina in wildtype and cdhr1a mutants.
Figure 5
Loss of cdhr1a function leads to cone outer segment degeneration.
(A–G) Confocal microscopy of wildtype retinal cryosections probed with anti-prph2 antibody (green). B=blue cones, RG = red/green cones, UV = UV cones. Scale bar = 10 μm. (A’-G’) Confocal microscopy of cdhr1a-/- retinal cryosections probed with anti-prph2 antibody (green). A-B’ scale bar = 5 μm, C-G’ scale bar = 10 μm. (H) Quantification of cone OS length at 5, 15, 30, 90, 180, 360, and 720 dpf measured as length of prhp2 signal in wildtype (black dots) and cdhr1a-/- (blue dots). Standard deviation is shown in red. ****=p < 0.0001. ANOVA = p < 0.0001. (I) Line graph depicting the long-term trend of cone OS length changes between wildtype (black) and cdhr1a-/- (blue). (J) Line graph depicting changes in the number of cone cells counted in the observation region over time in wildtype (black) compared to cdhr1a (blue). (K) Transmission electron microscopy micrographs from a 15 dpf wildtype retina. The yellow rectangle represents the enlarged inset. Magenta arrowheads highlight the proper stacking of OS discs. IS = inner segment, OS = outer segment. Scale bar = 500 nm. (L) Transmission electron microscopy micrographs from a 15 dpf cdhr1a-/- retina. The yellow rectangle represents the enlarged inset. Magenta arrowheads highlight the improper and distorted stacking of OS discs. IS = inner segment, OS = outer segment. Scale bar = 500 nm.
Figure 6
Loss of cdhr1a function leads to late-onset rod outer segment degeneration.
(A–B) Confocal microscopy of wildtype retinal cryosections probed with Gnb1 antibody (magenta) and WGA (teal) to identify rod outer segments at 5 and 15 dpf. Scale bar = 10 μm. (A’-B’) Confocal microscopy of cdhr1a-/- retinal cryosections probed with Gnb1 antibody (magenta) and WGA (teal) to identify rod outer segments at 5 and 15 dpf. Scale bar = 10 μm. (C–G) Confocal microscopy of wildtype retinal cryosections probed with prph2 antibody (magenta) and WGA (teal) to identify rod outer segments. A-B’ scale bar = 5 μm, C-G’ scale bar = 10 μm. (C’-G’) Confocal microscopy of cdhr1a-/- retinal cryosections probed with prph2 antibody (magenta) and WGA (teal) to identify rod outer segments. Scale bar = 10 μm. (H) Quantification of rod OS length at 5, 15, 30, 90, 180, 360, and 720 dpf measured as length of WGA signal in wildtype (black dots) and cdhr1a-/- (blue dots). Standard deviation is shown in red. **=p < 0.001, ****=p < 0.0001. ANOVA = p < 0.0001. (I) Line graph depicting the long-term trend of rod OS length changes between wildtype (black) and cdhr1a-/- (blue). (J) Line graph depicting changes in the number of rod cells counted in the observation region over time in wildtype (black) compared to cdhr1a-/- (blue).
Figure 7
Calyceal processes in cones are disorganized in the absence of cdhr1a function.
(A–G) Confocal microscopy of wildtype retinal cryosections probed with PNA (magenta) and actin-antibodies (white) at various timepoints detecting cone CPs. Typical length of CPs observed is demonstrated by yellow lines. Scale bar = 5 μm. (A’-G’) Confocal microscopy of cdhr1a-/- retinal cryosections probed with actin-antibodies (white) at various timepoints detecting cone CPs. Typical length of CPs observed is demonstrated in magenta. (H–N) Confocal microscopy of wildtype retinal cryosections probed with actin-antibodies (white) and gnb1 (A’) (magenta) at various timepoints detecting rod CPs. Typical length of CPs observed is demonstrated in yellow. (H’-N’) Confocal microscopy of cdhr1a-/- retinal cryosections probed with actin-antibodies (white) and gnb1 (F’) (magenta) at various timepoints detecting rod CPs. Typical length of CPs observed is demonstrated by yellow lines. Scale bar = 5 μm. ROS = cone outer segment layer. (O) Quantification of cone cells CP length based on measurements of actin staining in wildtype (black) compared to cdhr1a-/- (blue) at 5, 15, 30, 90, 180, 360, and 720 dpf. Standard deviation is shown in red. **=p < 0.01, ****=p < 0.0001. (P) Quantification of rod cells CP length based on measurements of actin staining in wildtype (black) compared to cdhr1a-/- (blue) at 5, 15, 30, 90, 180, 360, and 720 dpf. Standard deviation is shown in red. ns = not significant, ***=p < 0.001, ****=p < 0.0001. (Q) Line graph depicting the long-term trend of cone cells CP length changes between wildtype (black) and cdhr1a-/- (blue) over time. **=p < 0.01, ****=p < 0.0001. (R) Line graph depicting the long-term trend of rod cells CP length changes between wildtype (black) and cdhr1a-/- (blue) over time. ns = not significant, ***=p < 0.001, ****=p < 0.0001. (S) Confocal microscopy of wildtype (top panels) and cdhr1a-/- (bottom panels) retinal cryosections probed with pcdh15b antibody (red) at various timepoints. Scale bar = 5 μm. COS = cone outer segment layer, ROS = rod outer segment layer.
Figure 8
Loss of pcdh15b function leads to early cone OS defects and mis-localization of cdhr1a.
(A) Diagrammatic representation of the CRISPR/Cas9 strategy for generating a pcdh15b loss-of-function allele. crRNAs were targeted to the flanking sequences of exon 5 and resulted in a heritable deletion of 68 bp which resulted in a frameshift (fs) at AA117 and a premature stop codon (*) at AA118. (B-B”) Confocal microscopy of retinal cryosections from wildtype, pcdh15b+/-, and pcdh15b-/- individuals probed with pcdh15b antibody (red). Scale bar = 10 μm.(C-D”) Confocal microscopy of retinal cryosections from wildtype, pcdh15b+/-, and pcdh15b-/- individuals probed with prhp2 antibody (green) to visualize the cone outer segments (COS) at 5 dpf (C-C”) and 10 dpf (D-D”). B=blue cones, RG = red/green cones, UV = UV cones. Scale bar = 10 μm. (E) Quantification of COS length using prph2 signal for each genotype at each time point is depicted on the right. Standard deviation is shown in red. ns = not significant, **=p < 0.01. ****=p > 0.0001. ANOVA = p < 0.0001. (F-G”) Confocal microscopy of retinal cryosections from wildtype, pcdh15b+/-, and pcdh15b-/- individuals probed with actin antibody (white) to visualize cone CPs at 5 dpf (F-F”) and 10 dpf (G-G”). Scale bar = 10 μm. (H) Quantification of CP length using actin signal for each genotype at each time point is depicted on the right. Standard deviation is shown in red. ns = not significant, **=p < 0.01. ****=p > 0.0001. ANOVA = p < 0.0001. (I-J”) Confocal microscopy of retinal cryosections from wildtype, pcdh15b+/-, and pcdh15b-/- individuals probed with cdhr1a antibody (red) at 5 dpf (I-I”) and 10 dpf (J-J”). White boxes indicate regions enlarged. Scale bar = 10 μm. (K) Quantification of cdhr1a OS length for each genotype at each time point is depicted on the right. Standard deviation is shown in red. ns = not significant, ***=p < 0.001. ****=p > 0.0001. ANOVA = p < 0.0001.
Figure 9
Cone phenotypes are exacerbated by simultaneous loss of pcdh15b and cdhr1a.
(A–D) Confocal microscopy of retinal cryosections from 5 dpf pcdh15b-/-, cdhr1a-/-, cdhr1a-/-; pcdh15b+/- and cdhr1a-/-; pcdh15b-/- larva probed with prph2 antibodies (green). COS = cone outer segment. B=blue cones, RG = red/green cones, UV = UV cones. Scale bar = 10 μm. (E–H) Confocal microscopy of retinal cryosections from 10 dpf pcdh15b-/-, cdhr1a-/-, cdhr1a-/-; pcdh15b+/- and cdhr1a-/-; pcdh15b -/- larva probed with prph2 antibodies (green). COS = cone outer segment. B=blue cones, RG = red/green cones, UV = UV cones. Scale bar = 10 μm. (I) Quantification of cone outer segment length at 5 dpf based on prph2 signal. ns = not significant, ****=p < 0.0001. ANOVA = p < 0.0001. (J) Quantification of cone outer segment length at 10 dpf based on prph2 signal. ns = not significant, **=p < 0.01, ****=p < 0.0001. ANOVA = p < 0.0001. (K–N) Confocal microscopy of retinal cryosections from 5 dpf pcdh15b-/-, cdhr1a-/-, cdhr1a-/-; pcdh15b+/- and cdhr1a-/-; pcdh15b -/- larva probed with actin antibodies (white). COS = cone outer segment. Scale bar = 10 μm. (O–R) Confocal microscopy of retinal cryosections from 10 dpf pcdh15b-/-, cdhr1a-/-, cdhr1a-/-; pcdh15b+/- and cdhr1a-/-; pcdh15b-/-larva probed with actin antibodies (white). COS = cone outer segment. Scale bar = 10 μm. (R) Quantification of cone CP length at 5 dpf based on prph2 signal. ns = not significant, ****=p < 0.0001. ANOVA = p < 0.0001. (T) Quantification of cone CP length at 10 dpf based on prph2 signal. ns = not significant, *=p < 0.05 **=p < 0.01****,=p < 0.0001. ANOVA = p < 0.0001.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (D. rerio) | cdhr1a | GenBank | BX855592.19 | |
| Gene (D. rerio) | pcdh15b | GenBank | CR925795.5 | |
| Strain, strain background E. coli | JM109 | Promega | L2005 | |
| Genetic reagent (D. rerio) | Cdhr1a-/- | This paper | Cdhr1afs*146 | Deletion of 173 bp (Figure 4) |
| Genetic reagent (D. rerio) | Pcdh15b-/- | This paper | pcdh15bfs117*118 | Deletion of 68 bp (Figure 8) |
| Cell line (H. sapiens) | Human leukemia cell line | ATTC | K562, CLL-243 | |
| Cell line (H. sapiens) | Human embryonic kidney cell line | ATCC | CRL-3216 | |
| Sequence-based reagent (D. rerio) | crRNA targeting cdhr1a coding sequence | This paper (Materials and methods) | AB, AE | AB: GTCTGGAAGTAGCATCTATA AE: TCTGGCACATCTACGATGGA |
| Sequence-based reagent (D. rerio) | crRNA targeting pcdh15b coding sequence | This paper (Materials and methods) | PCDH15B.1.AV PCDH15B.1.AA | AV: CACCACAATGGACTGGATGT AA: CGACTATCCGCACCTCGTGT |
| Antibody | Rabbit α-cdhr1a, (D. rerio) Rabbit polyclonal | BosterBio | DZ07988 | (1/100) |
| Antibody | Rabbit a-Peripheirn-2 Rabbit polyclonal | Protein-Tech | 18109–1-AP | (1/100) |
| Antibody | Sheep a-hPCDH15 | Thermo Fisher | PA5-47865 | (1/75) |
| Antibody | Rabbit a-hCDHR1 Rabbit polyclonal | Thermo Fisher | PA5-57832 | (1/100) |
| Antibody | Mouse anti-actin | Thermo Fisher | MA1-140 | (1/100) |
| Antibody | Rabbit anti-GNB1 Rabbit polyclonal | Thermo Fisher | PA5-30046 | (1/100) |
| Antibody | Mouse anti-zfrhodopsin Mouse monoclonal | Fadool lab, Florida State University, FL | 1D1 | (1/100) |
| Antibody | Mouse anti-FLAG Mouse monoclonal | Sigma-Aldrich | F1804 | (1/1000) |
| Antibody | Mouse anti-MYC Mouse monoclonal | Thermo Fisher | MA121316 | (1/1000) |
| Antibody | Goat anti-Rabbit Alexa Fluor 488–5 nm colloidal gold | Thermo Fisher | A-31565 | (1/1000) |
| Antibody | Donkey-Anti-Sheep 25 nm colloidal gold | Electron Microscopy Sciences | 25829 | (1/100) |
| Recombinant DNA reagent (D. rerio) | cdhr1a-FLAG (plasmid) | This paper | pCIG2- cdhr1a-FLAG | (Materials and methods) |
| Recombinant DNA reagent (D. rerio) | pcdh15b-MYC (plasmid) | This paper | pCDNA3-pcdh15b-MYC | (Materials and methods) |
| Sequence-based reagent | Kpn1-Pcdh15b PCR primer | This paper | PCR primer | (Materials and methods) |
| Sequence-based reagent | Pcdh15b-XhoI PCR primer | This paper | PCR primer | (Materials and methods) |
| Peptide, recombinant protein | Alt-R Cas9 v.3 enzyme | IDTDNA | 1081058 | |
| Commercial assay or kit | Anti-FLAG magnetic beads | Thermo Fisher | A36797 | |
| Commercial assay or kit | Anti-MYC magnetic beads | Thermo Fisher | 88842 | |
| Other | Peanut Germ Agglutinin conjugated with a 488 fluorophore | Biotium | #29060 | (1/100) |
| Other | Wheat Germ Agglutinin conjugated with a 405 fluorophore | Biotium | 29028–1 | (1/50) |
Table 1
WISH and genotyping primers used.
| WISH primers | ||
|---|---|---|
| cdhr1a | ATGAAGAATGCAAGGGAAATA | TAATACGACTCACTATAGGGTCCTTCTGGACTGATTTCCAATGC |
| pcdh15b | GGTGATGGATCCAGTTCAGTG | TAATACGACTCACTATAGGGTCACAGAACAGTGGACTGAGA |
| pcdh23 | AGTGATTCAGATGATCGACGA | TAATACGACTCACTATAGGGTCATAACTCTGTGATCTCTAA |
| harmonin | CCTTAGTTTGGTGGGCACCAA | TAATACGACTCACTATAGGGTTAAAAGAATGTCACCTCATC |
| ush1ga | TTCTTGCCTTAATGTCTGTTT | TAATACGACTCACTATAGGGGCGCAGCTTTCACAAAACCAT |
| myo7aa | AAACAAGGACATTTTAACCAC | TAATACGACTCACTATAGGGGAGTCACATCGATCACTGGAC |
| GENOTYPING | ||
| cdhr1a | GTGTTAAAATTTGAATGCTGAG | CTGCATATGCTTAGATGTTACC |
| pcdh15b | GAAACACAAAAGAAGCTGCG | GCCTTTATAATGGAGCGCAAG |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/102258/elife-102258-mdarchecklist1-v1.pdf
-
Source data 1
This source data contains all the individual counts and measurements included in the manuscript.
- https://cdn.elifesciences.org/articles/102258/elife-102258-data1-v1.zip
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Cdhr1a and pcdh15b may link photoreceptor outer segments with calyceal processes revealing a potential mechanism for cone-rod dystrophy
eLife 13:RP102258.
https://doi.org/10.7554/eLife.102258.3
