Companion cells with high florigen production express other small proteins and reveal a nitrogen-sensitive FT repressor
- Department of Biology, University of Washington, United States
- Center for Gene Research, Nagoya University, Japan
- Bioscience and Biotechnology Center, Nagoya University, Japan
- Institute for Advanced Research (IAR), Nagoya University, Japan
- Department of Botany, Graduate School of Science, Kyoto University, Japan
- School of Biological Sciences and Technology, Chonnam National University, Republic of Korea
- Division of Biological Science, Nara Institute of Science and Technology, Japan
- Research Institute of Molecular Alchemy (RIMA), Gyeongsang National University, Republic of Korea
- Department of Biological Chemistry, College of Bioscience and Biotechnology, Chubu University, Japan
- Department of Genome Sciences, University of Washington, United States
- Institute of Transformative Bio-Molecules (WPI-ITbM), Nagoya University, Japan
- Division of Biological Science, Graduate School of Science, Nagoya University, Japan
- Graduate School of Bioagricultural Sciences, Nagoya University, Japan
- RIKEN Center for Sustainable Resource Science, Japan
- School of Biological Sciences, University of California San Diego, United States
- Center for Circadian Biology, University of California San Diego, United States
- Brotman Baty Institute for Precision Medicine, University of Washington, United States
Figures
Figure 1 with 5 supplements
Tissue- and cell-type-specific gene expression in cotyledons and true leaves.
(A) Representative GFP fluorescence images of ClearSee-treated cotyledons and true leaves of pFT:NTF, pSUC2:NTF, pCAB2:NTF, and p35:NTF lines. Scale bar, 500 µm. (B) The first two principal components of bulk RNA-seq analysis for three independent cotyledon and true leaf samples. Cotyledon and true leaf samples are circled in blue and red, respectively. (C) DEseq2-normalized counts of FT transcripts in sorted nuclei for the pFT:NFT, pSUC2:NFT, and pCAB2:NFT lines compared to the p35S:NTF line. Fold enrichments of FT transcripts in each NTF line compared with those in p35S:NTF line are indicated (n=3). ***padj <0.001. (D–K) Expression of genes encoding CO stabilizers (D and E), FT activators (F and G), CO destabilizers (H and I), and FT repressors (J and K) in cotyledons (D, F, H, and J) and true leaves (E, G, I, and K). Genes encoding proteins belonging to the same family were clustered in the heatmap. Bar color indicates log2-scaled fold-change relative to the p35S:NTF line. Asterisks denote significant differences from p35S:NTF (*padj <0.05; **padj <0.01; ***padj <0.001). CO was removed from the analysis due to insufficient reads at ZT4.
-
Figure 1—source data 1
A list of genes expressed in cotyledons of pFT:NTF plants compared with those in cotyledons of p35S:NTF plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig1-data1-v1.xlsx
-
Figure 1—source data 2
A list of genes expressed in cotyledons of pSUC2:NTF plants compared with those in cotyledons of p35S:NTF plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig1-data2-v1.xlsx
-
Figure 1—source data 3
A list of genes expressed in cotyledons of pCAB2:NTF plants compared with those in cotyledons of p35S:NTF plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig1-data3-v1.xlsx
-
Figure 1—source data 4
A list of genes expressed in true leaves of pFT:NTF plants compared with those in true leaves of p35S:NTF plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig1-data4-v1.xlsx
-
Figure 1—source data 5
A list of genes expressed in true leaves of pSUC2:NTF plants compared with those in true leaves of p35S:NTF plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig1-data5-v1.xlsx
-
Figure 1—source data 6
A list of genes expressed in true leaves of pCAB2:NTF plants compared with those in true leaves of p35S:NTF plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig1-data6-v1.xlsx
-
Figure 1—source data 7
Known spatial expression patterns of genes whose expression areis higher in pSUC2:NTF cotyledons than in p35S:NTF cotyledons.
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig1-data7-v1.xlsx
Figure 1—figure supplement 1
A diagram of constructs that express tissue/cell-specific NTF genes and flowcharts of bulk and single nuclei RNA-seq procedures.
(A) A schematic diagram of the constructs containing tissue-specific promoters and nuclear targeting fusion protein (NTF). NTF possesses WPP domain, nuclear envelope-targeting domain; GFP, green fluorescent protein; and BLRP, biotin ligase recognition peptides. (B and C) Procedures for preparing sorted nuclei for bulk RNA-seq (B) and single nuclei RNA-seq (C). (D) An example of a sorted GFP-positive nucleus. DAPI stain of the same nucleus is shown. Scale bar indicates 10 µm.
Figure 1—figure supplement 2
Plots showing 100,000 events of fluorescence-activated nuclei sorting (FANS).
FITC and mCherry channels detect GFP and autofluorescence, respectively. Areas for GFP-positive nuclei and negative particles were determined using whole tissues of the genetic background line pACT2:BirA. GFP-positive nuclei were obtained from cotyledons and true leaves of all transgenic lines.
Figure 1—figure supplement 3
DEseq2-normalized expression of phloem companion cell marker genes (A–E), mesophyll cell marker genes (F and G), and FT transporting genes (H–I) from sorted nuclei bulk RNA-seq of cotyledons and true leaves in the pFT:NTF (shown as pFT), pSUC2:NTF (pSUC2), pCAB2:NTF (pCAB2), and p35S:NTF (p35S) plants.
Normalized counts of SUC2 (A), ARABIDOPSIS H(+)-ATPASE 3 (AHA3) (B), ALTERED PHLOEM DEVELOPMENT (APL) (C), CHORISMATE MUTASE 3 (CM3) (D), AMINO ACID PERMEASE 4 (AAP4) (E), CAB2 (F), RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1 A (RBCS1A) (G), FT-INTERACTING PROTEIN 1 (FTIP1) (H), SYNTAXIN OF PLANTS 121 (SYP121) (I), QUIRKY (QKY) (J), and SODIUM POTASSIUM ROOT DEFECTIVE 1 (NaKR1) (K) are shown. The results are means ± SEM with each dot representing values of biological replicates (n=3). Asterisks denote significant differences from p35S:NTF line (*padj <0.05, **padj <0.01, ***padj <0.001).
Figure 1—figure supplement 4
Cotyledons and true leaves express unique sets of upregulated genes in the sorted nuclei.
(A–C) Quantitative Venn diagrams display the overlap between significantly upregulated genes from cotyledons and true leaves of pFT:NTF (A), pSUC2:NTF (B), and pCAB2:NTF lines (C) compared with the p35S:NTF line. (D–L) The top 10 Metascape enriched terms from genes uniquely upregulated in cotyledons (D, G, and J), true leaves (E, H, and K), and both (F, I, and L) of pFT:NTF (D–F), pSUC2:NTF (G–I), and pCAB2:NTF (J–L).
Figure 1—figure supplement 5
Cotyledons and true leaves express unique sets of downregulated genes in the sorted nuclei.
(A–C) Quantitative Venn diagrams display the overlap between significantly downregulated genes from cotyledons and true leaves of pFT:NTF (A), pSUC2:NTF (B) and pCAB2:NTF lines (C) compared with the p35S:NTF line. (D–L) The top 10 Metascape enriched terms from genes uniquely downregulated in cotyledons (D, G, and J), true leaves (E, H, and K), and both (F, I, and L) of pFT:NTF (D–F), pSUC2:NTF (G–I), and pCAB2:NTF (J–L).
Figure 2 with 6 supplements
Single-nucleus RNA-seq identifies distinct subpopulations of phloem companion cells.
(A) UMAP with the origin of nuclei indicated by color. (B and C) Tables with the number of nuclei originated from each line and sample (B) and median UMI and number of genes detected per nucleus (C). (D) Seurat defined clusters with cluster numbers indicated. (E–G) UMAP annotated with normalized read counts for FT (E), SUC2 (F), and FLP1 (G) expression. (H–I) UMAP annotated with average read counts of genes related to ATP biosynthesis (H), water transport (I), and JA responses (J). Color bars indicate gene expression levels. For the lists of genes for H–I, see Figure 2—figure supplement 2D (pink highlighted), 3E, and 4B, respectively.
-
Figure 2—source data 1
Highly expressed genes in each cell cluster compared with the average cell population in the snRNA-seq analysis in pFT:NTF and pSUC2:NTF plant data combined.
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Characteristics of UMAP clusters 8 and 10.
(A) Total read counts in individual nuclei in clusters 8 and 10. (B) Proportions of nuclei from each sample in clusters 8 and 10. The proportions of pFT:NTF- and pSUC2:NTF-derived nuclei in total and in each cluster were compared using Fisher’s exact test. Clusters significantly different from the total population were denoted with red letters. (C–F) Violin plots showing expression of mesophyll cell marker genes in clusters 8 and 10.
Figure 2—figure supplement 2
Characteristics of the FT-expressing UMAP cluster 7.
(A) Expression of the 268 genes differentially expressed in cluster 7 in the previous translatome analysis in SUC2 and FT expressing cells using whole plants of pSUC2:FLAG-GFP-RPL18 and pFT:FLAG-GFP-RPL18 lines. The color indicates log2 fold-change (FC) compared to the p35S:FLAG-GFP-RPL18 data. (B) Violin plots showing expression of CO stabilizing gene FKBP12 in cluster 7. (C) Top 10 Metascape terms enriched in clusters 7. (D) Oxidative phosphorylation pathway (ath00190) showing genes involved in proton and ATP synthesis. Genes highlighted in pink are significantly enriched in cluster 7, while those denoted in green are not enriched in cluster 7. Genes without color are not Arabidopsis genes.
Figure 2—figure supplement 3
Characteristics of UMAP cluster 4.
(A–C) Leaf vasculature-specific genes. UMAP annotated with normalized read counts for LIPID TRANSFER PROTEIN 1 (LTP1) (A), Xyloglucan endotransglucosylase/hydrolase protein 4 (XTH4) (B), and MLP-LIKE PROTEIN 28 (MLP28) (C). (D) Top 10 Metascape terms enriched in clusters 4. (E) Dot plot showing expression levels of genes encoding aquaporins in each cell cluster. Sizes and colors of dots indicate percents of nuclei expressing genes and average expression levels, respectively. (F) Spatial promoter activity of PIP2;6 marked with FLAG-GFP-RPL18 in 2-week-old true leaf. Abaxial side of the leaf was imaged. The image is generated by the spectrum imaging capturing GFP (green) and autofluorescence spectrum (magenta). The outline of the leaf is indicated by a white thin line (note the tip of the leaf was curled). (G) An enlarged image of a part of the image (F) that shows the strong promoter activity of PIP2;6 in the main vein. Scale bar, 500 µm.
Figure 2—figure supplement 4
Characteristics of UMAP cluster 5.
(A) Top 10 Metascape terms enriched in cluster 5. (B) Dot plot showing expression levels of genes encoding JA-biosynthetic and JA-responsive genes in each cell cluster. Sizes and colors of dots indicate percents of nuclei expressing these genes and average expression levels, respectively.
Figure 2—figure supplement 5
Characteristics of UMAP cluster 6.
(A and B) Average expression of top 50 phloem parenchyma (A) and bundle sheath marker genes (B) (Kim et al., 2021). (C) Subclustering of cluster 6. Colors indicate the positions of each subcluster. (D) Phloem parenchyma marker genes are enriched in subcluster 6.3 and bundle sheath marker genes in subcluster 6.2. (E and F) Violin plots showing expression of phloem parenchyma (E) and bundle sheath marker genes (F). (G) Top 10 Metascape terms enriched in clusters 6. (H) Dot plots showing expression levels of genes related to glucosinolate biosynthesis in each cell cluster. Sizes and colors of dots indicate percents of nuclei expressing genes and average expression levels, respectively.
Figure 2—figure supplement 6
Protoplast isolation procedure and the expression of tissue-specific marker genes in isolated protoplasts.
(A) A schematic diagram of protoplast isolation from true leaves. (B–C) Mesophyll-specific GFP expression of the intact leaf (B) and GFP fluorescence of isolated protoplasts (C) derived from leaves of the pRBCS1A:FLAG-GFP-RPL18 line. Scale bars, 50 µm. (D) Gene expression analysis using quantitative RT-PCR in mesophyll-cell protoplasts. Relative expression levels of FT, companion cell marker genes (SUC2 and AHA3), a gene expressed in minor veins (Sultr2.1), and a stomatal guard cell marker gene (GC1), and epidermal cell marker genes (CER5 and ML1) were analyzed. Intact plants and Plants + Enz indicate detached true leaves with and without protoplasting enzymatic treatment. Epidermis was removed using adhesive tape prior to enzyme treatment but not for Plants + Enz. The results are means ± SEM with each dot representing biological replicates (n=4). Percentage values indicate relative differences.
Figure 3
Phloem companion cell and mesophyll cell marker gene expression in cluster 7.
(A) Subclustering of cluster 7. Colors indicate each subcluster. (B) Table showing the number of nuclei originated from each NTF line in cluster 7. (C) UMAP of normalized read counts of FT and companion cell marker genes (SUC2, and AHA3) and mesophyll cell marker genes (RBCS1A, CAB3, and CAB2). (D) Violin plot of normalized read counts of FT and marker genes for companion cells and mesophyll cells across the three subclusters.
Figure 4 with 3 supplements
FT-expressing cells express genes encoding other small proteins.
(A) Amino acid length of proteins encoded by genes differentially expressed in clusters 4, 5, and 7. Black bars indicate the median amino acid length. (B) Expression of the pFT:NFT line (green) and promoter fusions of selected cluster 7 genes with H2B-tdTomato (red) in true leaves. The selected genes were differentially expressed in cluster 7 and encoded small proteins. The yellow color shows an overlap between green and red signals. Scale bar, 50 µm. (C) Flowering time measurements of T1 transgenic plants overexpressing selected cluster 7 genes driven by the pSUC2 promoter (n≥31). Eight genes were tested, five of which were tested for overlap with FT expression in (B). Asterisks denote significant differences from GFP (*p<0.05, ***p<0.001, one-way ANOVA and Dunnett’s multiple comparison test). n.s. indicates not significant.
Figure 4—figure supplement 1
Spatial expression patterns of GFP signal derived from the pFT:NFT (A, D, and G) and H2B-tdTomato signals controlled by the promoters of representatives of cluster 7-enriched genes: ROXY10 (B), BFT (E), and AT1G24574 (H) in true leaves.
Yellow color shows an overlap between green and red signals (C, F, and I). Scale bar, 1 mm.
Figure 4—figure supplement 2
Enlarged images of phloem companion cells showing spatial expression overlap between FT and cluster 7 genes.
Images of minor leaf veins of pFLP1:H2B-tdTomato/pFT:NTF (A–D), and pROXY10:H2B-tdTomato/pFT:NTF (E–H). H2B-tomato driven by the promoter of cluster 7 gene FLP1 (A) and ROXY10 (E), GFP signals from the NTF protein (B and F), calcofluor white staining (C and G), and merged images (D and H) are shown. Scale bar, 50 µm.
Figure 4—figure supplement 3
The silencing of FT using amiRNA to confirm the overlap of spatial expression between FT and cluster 7-specific ROXY10 genes.
(A) The effect of amiRNA targeting FT mRNA driven by tissue-specific promoters on flowering time. T1 plants were grown on hygromycin selection media for 14 days and transferred to soil in LD +FR. WT and ft-101 plants were grown on non-selection media for 14 days and transferred to soil in LD +FR. Each dot indicates the flowering time of an individual non-transformant and T1 transformant (n≥16). Bars indicate mean values, and different letters indicate a statistically significant difference (p<0.05, one-way ANOVA and Tukey’s multiple comparison test). (B) Normalized read counts of ROXY10, SUC2, PIP2;6, and GC1 genes in wild-type plants in RNA-seq data (Data S10) The results are means ± SEM with each dot representing biological replicates (n=3), and different letters indicate a statistically significant difference (p<0.05, one-way ANOVA and Tukey’s multiple comparison test).
Figure 5 with 3 supplements
NIGT1 transcription factors are repressors of FT.
(A) Motif enrichment analysis using the 500 bp promoters of 268 differentially expressed genes in cluster 7, and flowering time of the pSUC2:NIGT1.2 and pSUC2:NIGT1.4 lines in LD +FR. The NIGT1.2 binding site was the most enriched motif in the promoters of cluster 7 differentially expressed genes. For flowering time results, the bottom and top lines of the box indicate the first and third quantiles, and the bottom and top lines of the whisker denote minimum and maximum values. The bar inside the box is the median value (n=16). Asterisks denote significant differences from WT (***p<0.001, one-way ANOVA and Dunnett’s multiple comparison test). (B) A Venn diagram showing the significantly down-regulated genes from bulk RNA-seq of two independent pSUC2:NIGT1.2 and pSUC2:NIGT1.4 lines compared with wild-type plants. (C) The effect of NIGT1.2, NIGT1.4, and GFP on wild-type and mutated FT promoter activity in tobacco transient assay. The 1 kb of FT promoter (pFT) and the same FT promoter with all NIGT1-binding sites mutated (pFTm) control the expression of firefly luciferase (LUC) gene. The LUC activity was normalized with Renilla luciferase (RLUC) activity controlled by 35 S promoter. The results are means ± SEM with each dot representing biological replicates (n=4 or 5). (D) Relative gene expression levels of FT and BFT in 14 day-old wild-type (WT) and nigtQ seedlings at ZT4. Plants were grown with high nitrogen (+N) and without (–N) in LD +FR. The results are means ± SEM with each dot representing biological replicates (n=6). Asterisks denote significant differences from WT (*p<0.05, **p<0.01, ***p<0.001, t-test). n.s. indicates not significant.
-
Figure 5—source data 1
Enriched DNA motifs and potential transcription factors bind to the motifs in the promoters of 268 genes highly expressed in cluster 7.
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig5-data1-v1.xlsx
-
Figure 5—source data 2
Transcription factors that bind to four tandem repeats of CORE-containing sequences which also contain NIGT1-binding motifs of the FT promoter in yeast one-hybrid analysis.
The TF library containing 1957 genes was used to screen the binding TFs to the sequences.
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig5-data2-v1.xlsx
-
Figure 5—source data 3
A list of differentially expressed genes in pSUC2:NIGT1.2 #1 compared with wild-type plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig5-data3-v1.xlsx
-
Figure 5—source data 4
A list of differentially expressed genes in pSUC2:NIGT1.2 #3 compared with wild-type plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig5-data4-v1.xlsx
-
Figure 5—source data 5
A list of differentially expressed genes in pSUC2:NIGT1.4 #3 compared with wild-type plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig5-data5-v1.xlsx
-
Figure 5—source data 6
A list of differentially expressed genes in pSUC2:NIGT1.4 #8 compared with wild-type plants (n=3).
- https://cdn.elifesciences.org/articles/102529/elife-102529-fig5-data6-v1.xlsx
Figure 5—figure supplement 1
The 400 bp upstream regions of FT promoter sequences (A) and the NIGT-binding site mutated FT promoter sequences (B).
The position of DNA sequences used for the Y1H screening is marked with a box; four tandem repeats of this sequence were used. The potential NIGT1-binding sites and motifs important for CO-dependent FT induction, CO-responsive element (CORE), CCACA, S1/S2, and P1/P2 are indicated. The 5’-UTR is highlighted in gray. The mutations in potential NIGT1-binding sites are indicated with blue capital letters (B).
Figure 5—figure supplement 2
Relative expression levels of NIGT1.2, NiGT1.4, and cluster 7-enriched genes (FT, BFT, FLP1, PARCL, ROXY10, AT2G26695, and AT1G67865) in 14-day-old wild-type (WT), pSUC2:NIGT1.2, and NIGT1.4 plants at ZT4.
The quantitative RT-PCR results represent the means ± SEM. Each dot indicates a biological replicate (n=4). Asterisks denote significant differences from WT (**p<0.01, ***p<0.001, one-way ANOVA and Dunnett’s multiple comparison test).
Figure 5—figure supplement 3
Expression of NIGT1.2 and NIGT1.4 genes and their roles in flowering time.
(A and B) UMAP annotated with normalized read counts for NIGT1.2 (A) and NIGT1.4 (B). (C) Relative expression levels of nitrogen-deficiency marker genes (NRT2.4 and GDH3) in 14-day-old wild-type (WT) and nigtQ seedlings at ZT4. Plants were grown with high nitrogen (+N) and without (–N). (D and E) Percentages of bolted plants grown on 20 mM NH4NO3 (D) and 2 mM NH4NO3 containing media (E). Plants were grown on 20 mM NH4NO3 containing media for 9 days and transplanted to the new media with 20 mM or 2 mM NH4NO3. (F) Leaf numbers of WT and nigtQ plants grown on the media with different nitrogen contents at bolting. The results represent the means ± SEM. Each dot indicates a biological replicate (n=15) (n.s., not significant by two-way ANOVA and Tukey’s multiple comparison test). (G) Leaf numbers of WT and nigtQ plants grown on nitrogen-rich soil. Asterisks denote significant differences from WT (*p<0.05, ***p<0.001, t-test).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Arabidopsis thaliana) | FT | TAIR | AT1G65480 | |
| Gene (Arabidopsis thaliana) | SUC2 | TAIR | AT1G22710 | |
| Gene (Arabidopsis thaliana) | CAB2 | TAIR | AT1G29920 | |
| gene (Arabidopsis thaliana) | NIGT1.2 | TAIR | AT1G68670 | |
| Gene (Arabidopsis thaliana) | NIGT1.4 | TAIR | AT1G13300 | |
| Gene (Arabidopsis thaliana) | BFT | TAIR | AT5G62040 | |
| Gene (Arabidopsis thaliana) | FLP1 | TAIR | AT4G31380 | |
| Gene (Arabidopsis thaliana) | PIP2;6 | TAIR | AT2G39010 | |
| Gene (Arabidopsis thaliana) | ROXY10 | TAIR | AT5G18600 | |
| Strain, strain background (Escherichia coli) | TOP10 | Invitrogen | C404010 | |
| Strain, strain background (Agrobacterium tumefaciens) | GV3101 | Imaizumi lab | ||
| Genetic reagent (Arabidopsis thaliana) | nigtQ | Kiba et al., 2018 | ||
| Genetic reagent (Arabidopsis thaliana) | ft-101 | Takada and Goto, 2003 | ||
| Genetic reagent (Arabidopsis thaliana) | pFT:NTF | Takagi et al., 2025 | ||
| Genetic reagent (Arabidopsis thaliana) | pSUC2:NTF, pCAB2:NTF, and p35S:NTF | This study | See molecular cloning and plant materials in Materials and methods | |
| Genetic reagent (Arabidopsis thaliana) | pBFT:H2B-tdTomato, pAT1G24575:H2B-tdTomato, pAT1G67865:H2B-tdTomato, pROXY10:H2B-tdTomato, pAT2G26695:H2B-tdTomato, pPARCL:H2B-tdTomato, pROXY7:H2B-tdTomato, and pCYSTM12:H2B-tdTomato all in pFT:NTF background | This study | See molecular cloning and plant materials in Materials and methods | |
| Genetic reagent (Arabidopsis thaliana) | pSUC2:GFP, pSUC2:BFT, pSUC2:AT1G24575, pSUC2:AT1G67865, pSUC2:ROXY10, pSUC2:AT2G26695, pSUC2:SAQR, pSUC2:RL4, pSUC2:AT1G54575, pSUC2:NIGT1,2, and pSUC2:NIGT1.4 all in pFT:GUS background | This study | See molecular cloning and plant materials in Materials and methods | |
| Genetic reagent (Arabidopsis thaliana) | pPIP2;6:FLAG-GFP-RPL18 | This study | See molecular cloning and plant materials in Materials and methods | |
| Genetic reagent (Arabidopsis thaliana) | pROXY10:amiR-ft, pSUC2:amiR-ft, pPIP2;6:amiR-ft, and pGC1:amiR-ft | This study | See molecular cloning and plant materials in Materials and methods | |
| Recombinant DNA reagent | pFT:LUC and pFTm:LUC | This study | See tobacco transient promoter LUC assay in Materials and methods | |
| Recombinant DNA reagent | p35S:NIGT1.2, p35S:NIGT1.4, and p35S:GFP | This study | See tobacco transient promoter LUC assay in Materials and methods | |
| Recombinant DNA reagent | pENTR-/D-TOPO | Invitrogen | Cat# K230020SP | |
| Commercial assay or kit | Dual Luciferase Reporter Assay System | Promega | Cat# E1910 | |
| Commercial assay or kit | PrimeScript RT reagent Kit | Takara Bio | Cat# RR037A | |
| Commercial assay or kit | SMART-seq v4 3' DE Kit | Takara Bio | Cat# 635040 | |
| Commercial assay or kit | KAPA SYBR FAST qPCR Master Mix (2 x) kit | Roche | Cat# KK4602 | |
| Commercial assay or kit | Chromium Next GEM Single Cell 3’ GEM, Library & Gel Bead Kit v3.1 | 10X Genomics | Cat# PN-1000128 | |
| Commercial assay or kit | Chromium Next GEM Chip G Single Cell Kit | 10X Genomics | Cat# PN-1000127 | |
| Chemical compound, drug | Cellulase ‘onozuka’ R-10 | Yakult Pharmaceutical Industry | Cat# 636–01441 | |
| Chemical compound, drug | Macerozyme R-10 | Yakult Pharmaceutical Industry | Cat# 635–02631 | |
| Chemical compound, drug | Glycogen | Thermo Fisher Scientific | Cat# R0551 | 20 mg/mL |
| Software, algorithm | Prism 10 | GraphPad | RRID: SCR_002798 | |
| Software, algorithm | Cellranger v3.0.1 | 10X Genomics | RRID: SCR_023221 | |
| software, algorithm | Seurat | Hao et al., 2021 Satija et al., 2015 | RRID: SCR_007322 | |
| Software, algorithm | Eukaryotic Promoter Database | Dreos et al., 2015, Meylan et al., 2020 | RRID: SCR_002132 | |
| Software, algorithm | Simple Enrichment Analysis | Bailey and Grant, 2021 | RRID: SCR_001783 | |
| Software, algorithm | STAR | Dobin et al., 2013 | RRID: SCR_004463 | |
| Other | CellTrics 30 µm | Sysmex | Cat# BV264870 | See nuclei isolation by FANS in Materials and methods. |
| Other | SUPERase-In RNase Inhibitor | Thermo Fisher Scientific | Cat# AM2694 | See nuclei isolation by FANS in Materials and methods. |
Table 1
qRT-PCR primers used in this study.
| Annotation | AGI code | Forward (5'→3') | Reverse (5'→3') |
|---|---|---|---|
| PP2AA3 | AT1G13320 | GCGGTTGTGGAGAACATGATACG | GAACCAAACACAATTCGTTGCTG |
| IPP2 | AT3G02780 | GTATGAGTTGCTTCTCCAGCAAAG | GAGGATGGCTGCAACAAGTGT |
| FT | AT1G65480 | CTGGAACAACCTTTGGCAAT | TACACTGTTTGCCTGCCAAG |
| SUC2 | AT1G22710 | GTGGGAGGTGGACCATTCGACG | CCGGAGGCGGTGAAGGCAAC |
| AHA3 | AT5G57350 | GGCTCATGCACAAAGGACTTTACACG | GCGATCTCAGCTCGTCTCTTGGC |
| Sultr2.1 | AT5G10180 | GGTGTTGAGCTAGTGATCGTTAACCCG | CCCGTAACACAACTGGTCCTTTGA |
| RBCS1A | AT1G67090 | GGCCTCCGATTGGAAAGAAGAAG | GGTGTTGTCGAATCCGATGATCCTA |
| LHCB2.1 | AT2G05100 | TTGGTGTATCCGGTGGTGGCC | GTCCGTACCAGATGCTTTGAGGAGTAGA |
| GC1 | AT1G22690 | TCGTCCAAGAATCAATTGTGGGC | GTGTTGCCGGAGGTTCCCGG |
| CER5 | AT1G51500 | AGGAATATCGCTCGAGATGG | TGTCTCCCGAATCCTTTGAG |
| ML1 | AT4G21750 | CTACTCACAGTTGCGTTTCAGATAC | CCTTCCGAAAACATCGATTAGGCTC |
| NIGT1.2 | AT1G68670 | AAACCAAAAAGCGGTGCGTT | ACTAGCTACTTTCACCGCCG |
| NIGT1.4 | AT1G13300 | CTAACAACGGAAACTCTCAAACG | CGGTAGTCTTGCCCGTAGAGTA |
| BFT | AT5G62040 | CCCGAGTCCTAGTAATCCTTATATGCGTGAAT | TATCTGTGTATTCCCGCCACCGGTTT |
| FLP1 | AT4G31380 | TCCAGTTCCACAAGAGAACTTCG | TCACGGACATGGAAGACGTTAGG |
| PARCL | AT1G64370 | AGAGTCAAGGACATGGGAAGCTCTT | TCACCATTGTTAATGAACATTCCAAGGCC |
| ROXY10 | AT5G18600 | GGAGCAAATCCAGCGGTTTACGAGC | CATGACCTCGTTGGCTCCACCGA |
| AT2G26695 | GATGGAAAACTGGCGATTGGGTT | GCCACCATAATCTCTTGTTGTCTTGCATT | |
| AT1G67865 | TTGGGGTTGCCGGAGGGATTACC | ACCATTGCCGTAGTTTCCCGGACTC | |
| NRT2.4 | AT5G60770 | CCGTCTTCTCCATGTCTTTC | CTGACCATTGAACATTGTGC |
| GDH3 | AT3G03910 | GCAGCTCTAGGGGGAGTCAT | CAGCCTCAGGATCAGTTGGG |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Companion cells with high florigen production express other small proteins and reveal a nitrogen-sensitive FT repressor
eLife 14:RP102529.
https://doi.org/10.7554/eLife.102529.3
