A system for functional studies of the major virulence factor of malaria parasites
- Pathogen section, Bernhard Nocht Institute for Tropical Medicine, Germany
- Interface section, Bernhard Nocht Institute for Tropical Medicine, Germany
- Biophysics, Research Center Borstel, Leibniz Lung Center, Germany
- Centre for translational Medicine & Parasitology, Department of Immunology and Microbiology, University of Copenhagen and Department of Infectious Diseases, Denmark
- Department of Molecular Biology, Faculty of Science, Radboud University, Netherlands
- Department of Molecular Biology, Radboud Institute for Molecular Life Sciences, Oncode Institute, Radboud University, Netherlands
- Department of Biology, University of Hamburg, Germany
Figures
Figure 1 with 1 supplement
SLI-activation of var genes in 3D7.
(A) Schematic for SLI strategy. HR: homology region; ATS: acidic terminal segment; NTS: N-terminal segment; 2 A: T2A skip peptide; NEO-R: G418-resistance; hDHFR: human dihydrofolate reductase; arrows P1-4: primers for diagnostic PCR; X: desired var gene. (B, C) Activation of indicated PfEMP1. Scheme shows domain organization. Agarose gels show PCR products confirming correct integration of the SLI plasmid. Product over 5´ integration junction (5’): P1+P2; 3’ integration junction (3’): P3+P4; original locus (ori): P1+P4; see (A) for primer positions, see Table 1 for sequence of primers used; 3D7: parent; Int: integrant cell line. Fluorescence microscopy images show IFAs with indicated antibodies. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm. (D) Western blot of trypsin cleavage assays with indicated parasites. Asterisks show protected PfEMP1 fragment. α-SBP1-N: control for integrity of host cell (breach of RBC membrane would result in a smaller SBP1 fragment). Marker in kDa. (E, F) Pie charts with proportions of total var gene transcripts determined by qPCR of the indicated cell lines on G418 and after lifting G418. (G, H) Activation of PF3D7_0425800 in 3D7 or 3D7MEED. Scheme shows domain organization. Agarose gels show PCR products confirming correct integration of the SLI plasmid as described in (A). Fluorescence microscopy images show IFAs as described in (B, C). Pie charts show proportions of total var gene transcripts of the indicated cell lines determined by RNAseq (normalized to TPM). (I) SuperPlot (Lord et al., 2020) showing percentage (log scale) of total var gene transcripts for non-activated var genes of the indicated cell line determined by RNAseq (normalized to TPM; small gray dots: individual var genes; large colored dots: average of each replicate; bars: mean of averages of replicates with SD; n=3 biological replicates; unpaired t-test; p-values indicated). See also Source data 1. (J) Volcano plot showing differential expression (RNASeq) of 3D7 or 3D7MEED both containing the same SLI modification to express PF3D7_0425800. Selected hits were color-coded as indicated. ‘Exported’ refers to all proteins that are known or predicted to be exported but do not fall into the selected families of exported proteins labeled with other colors. Short names are given for color-coded hits when available (full names, accession, and total data in Figure 1—source data 4).
-
Figure 1—source data 1
qPCR corresponding to panels E and F.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Unedited agarose gels shown in panels B, C, G, and H.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-data2-v1.zip
-
Figure 1—source data 3
Agarose gels shown in panels B, C, G, and H with annotation.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-data3-v1.zip
-
Figure 1—source data 4
Full and unedited blots corresponding to panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-data4-v1.zip
-
Figure 1—source data 5
Full and unedited blots annotated and indicating the regions shown in panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-data5-v1.zip
-
Figure 1—source data 6
RNASeq data of 3D7 vs 3D7MEED corresponding to panel J.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-data6-v1.xlsx
Figure 1—figure supplement 1
Expression of desired and co-activated genes.
(A) Pie chart with proportions of total var gene transcripts determined by qPCR of the 3D7 parent. (B) Pie charts with proportions of total var gene transcripts of the indicated cell lines determined by RNAseq (normalized to TPM) showing predominant expression of the desired SLI-activated var gene. (C) Coverage plots showing reads mapped to chromosome 8 base pairs 430,000–470,000 and chromosome 12 base pairs 15,000–60,000 of the indicated cell lines determined by RNAseq (shows reciprocal activity of var genes as expected based on the SLI selected target as well as inactivity of neighboring var genes). Gene annotation from PlasmoDB genome browser (PlasmoDB.org) with reads mapped using Artemis. Red: var genes; purple: rif genes. Colored boxes indicated SLI-activated var gene. (D) Pie charts with proportions of total rif gene transcripts of the indicated SLI-activated var gene cell lines determined by RNAseq (normalized to TPM). (E) Pie charts with proportions of total var gene transcripts of the indicated cell lines determined by qPCR. (F) Coverage plots showing mapped reads on chromosome 4 base pairs 1,150,000–1,175,000 of the indicated cell lines determined by RNAseq as in (C). Colored boxes indicate SLI activated var gene. Red: var genes; purple: rif genes. (G) Pie charts with proportions of total rif gene transcripts of the indicated cell lines determined by RNAseq (normalized to TPM). (H) Confirmation of the activation of the indicated rif gene. The scheme shows domain organization (TM, transmembrane domain; C, C-terminal domain; HA, 3xHA tag). Agarose gel shows PCR products confirming correct integration of the SLI plasmid as described in Figure 1A; 3D7 parent; Int: integrant cell line. Fluorescence microscopy: images of IFAs with the indicated antibodies. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm. (I) Pie charts show proportions of total var or rif gene transcripts of the indicated cell lines determined by qPCR. (J) Pie charts with proportions of total var gene transcripts of IT4 wildtype parasites determined by RNAseq (normalized to TPM). (K) Plot showing transcription levels of var19 in the IT4var19-HAendo parasites before and after panning determined by RNAseq (normalized to TPM) (n=4). RNASeq data in Source data 1.
-
Figure 1—figure supplement 1—source data 1
qPCR corresponding to panels A and E.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-figsupp1-data1-v1.xlsx
-
Figure 1—figure supplement 1—source data 2
Unedited agarose gels shown in panel H.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-figsupp1-data2-v1.zip
-
Figure 1—figure supplement 1—source data 3
Unedited agarose gels shown in panel H with annotations.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-figsupp1-data3-v1.zip
-
Figure 1—figure supplement 1—source data 4
qPCR corresponding to panel I.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig1-figsupp1-data4-v1.xlsx
Figure 2 with 1 supplement
Clogging PTEX prevents PfEMP1 transfer into the host cell.
(A) Scheme: options for impact of WR-induced stabilization of mDHFR folding on PfEMP1 export. Relevant domains of modified PfEMP1 indicated. Fluorescence microscopy images of IFAs with parasites of the indicated cell line + and –WR with the indicated antibodies. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm. (B) Effect of blocking PTEX (+WR) with early (mal7 promoter) expressed SBP1-mDHFR-GFP on PfEMP1 export. Relevant expressed products are shown. Live cell images (top rows) and IFAs (bottom rows; as described in (A)) of parasites grown + and -WR. Graph: quantification of parasites with a PfEMP1 export phenotype + and -WR (four biological replicates; dots: % cells per replicate; bars: mean of replicates with SD; n=26 parasites per experiment and condition; +WR only parasites with an SBP1-mDHFR-GFP export phenotype were scored; unpaired t-test; p-values indicated). Scheme shows WR-dependent clogging of PTEX (right) or control (left); features explained in (A). (C) Effect of blocking PTEX with late (crt promoter) expressed SBP1-mDHFR-GFP-2A-KAHRP-mScarlet on PfEMP1 export. Relevant expressed products are shown. Live cell images (top rows) and IFAs (bottom rows, as described in A) + and -WR. Graph: quantification of parasites with PfEMP1 or REX1 export phenotype + and -WR (3 biological replicates; -WR, PfEMP1: n=34, 76, 60; +WR, PfEMP1: n=18, 48, 30; -WR, REX1: n=18, 27, 35; +WR, REX1: n=12, 31, 25), only parasites with a KAHRP-mScarlet (late PTEX block reporter) export phenotype were scored (dots: % cells per replicate; bars: mean of replicates with SD; unpaired t-test; p-values indicated). The scheme shows WR-dependent clogging of PTEX (right) or control (left); features explained in (A); note that due to late block, early expressed REX1 is in the host cell in both conditions.
-
Figure 2—source data 1
PfEMP1 export blocked by SBP1mDHFR, corresponding to panel B.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig2-data1-v1.xlsx
-
Figure 2—source data 2
PfEMP1 and REX1 export block, corresponding to panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig2-data2-v1.xlsx
Figure 2—figure supplement 1
Confirmation of correct integration for PfEMP1 mDHFR fusion parasites.
Agarose gels with PCR products confirming correct integration of the SLI plasmids to generate the indicated cell lines. Product over 5´ integration junction (5’): P1+P2; 3’ integration junction (3’): P3+P4; original locus (ori): P1+P4; see Figure 1A for primer positions, Table 1 for primer sequences; 3D7: parent; Int: integrant cell line.
-
Figure 2—figure supplement 1—source data 1
Unedited agarose gels are shown in the figure.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Unedited agarose gels are shown in the figure with annotations.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig2-figsupp1-data2-v1.zip
Figure 3 with 1 supplement
Activated PfEMP1s in IT4 are functional and cytoadherent.
(A, B) Activation of indicated PfEMP1. Scheme shows domain organization. Agarose gel shows PCR products confirming correct integration of the SLI plasmid as described in Figure 1A; see Table 1 for sequence of primers used: IT4: parent; Int: integrant cell line. Fluorescence microscopy images show IFAs with indicated antibodies. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm. (C) Pie charts show proportions of total var gene transcripts of the indicated cell lines determined by RNAseq (normalized to TPM). (D) Western blot of trypsin cleavage assays with indicated parasites. Asterisks show protected PfEMP1 fragment. α-SBP1-N: control for integrity of host. Marker in kDa. (E, F) SuperPlots showing binding assays of indicated cell lines against decorin or CSA-expressing HBEC-5i cells (three biological replicates with 15 fields of view/experiment and condition; bars: mean of averages of replicates with SD; unpaired t-test; p-values are indicated). Small gray dots: bound iE/field of view, extrapolated to mm2. Larger colored dots: average of bound iE/mm2/replicate. Same color indicates experiment conducted in parallel. iE: infected erythrocytes. (G) SuperPlot of binding assays of indicated cell lines against CHO cells expressing GFP, CD36, or ICAM-1 (three biological replicates with 15 fields of view/ experiment and condition; bars: mean of averages of replicates with SD; unpaired t-test; p-values are indicated). Small gray dots: bound iE/field of view, extrapolated to mm2. Larger colored dots: average bound iE/mm2/replicate. iE: infected erythrocytes.
-
Figure 3—source data 1
Unedited agarose gels are shown in panels A and B.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig3-data1-v1.zip
-
Figure 3—source data 2
Unedited agarose gels are shown in panels A and B with annotation.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig3-data2-v1.zip
-
Figure 3—source data 3
Full and unedited blots corresponding to panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig3-data3-v1.zip
-
Figure 3—source data 4
Full and unedited blots annotated and indicating the regions shown in panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig3-data4-v1.zip
-
Figure 3—source data 5
Binding assays corresponding to panel E.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig3-data5-v1.xlsx
-
Figure 3—source data 6
Binding assays corresponding to panel F.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig3-data6-v1.xlsx
-
Figure 3—source data 7
Binding assays corresponding to panel G.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig3-data7-v1.xlsx
Figure 3—figure supplement 1
Automated scoring pipeline with validation.
(A) Illustration of the pipeline for automated scoring of the number of bound infected erythrocytes in images captured from binding assays. Left: representative image of a binding assay showing binding (top) or no binding (bottom) of infected erythrocytes. Ilastik (Berg et al., 2019) model (trained on 20 images) separates fore- and background of native captured images (left, input images; middle, output images). Foreground: infected erythrocytes; background: CHO/HBEC-5i cells and plastic. Gray box: CellProfiler (Stirling et al., 2021) pipeline to score pre-segmented images (middle, input images; right, output images). (B) Results of binding assays for five parasite lines tested against three different receptor-expressing CHO cells evaluated by manual scoring and the automated pipeline (15 fields of views were analyzed per cell line and receptor, total: 225; bars: mean and SD). ICC: intraclass correlation coefficient. (C) Comparison of all images from (B) evaluated by manual scoring against scoring by the automated pipeline. Red dots: bound infected erythrocytes (iE) in individual images from manual scoring (blue dots) or scoring by the automated pipeline. Man: manual scoring; auto: automated pipeline (n=225; bars: mean and SD; paired t-test; p-value is indicated). (D) Bland-Altman plot comparing evaluation of images of binding assays from (B) by manual scoring and scoring by the automated pipeline. Green lines: limits of agreement; SD: standard deviation.
Figure 4
Activation of further PfEMP1s with different binding properties in IT4.
(A, B, C) Activation of indicated PfEMP1. Scheme shows domain organization. Agarose gel shows PCR products confirming correct integration of the SLI plasmid as described in Figure 1A; see Table 1 for sequence of primers used: IT4: parent; Int: integrant cell line. Asterisks indicate non-specific bands; for the original locus, this likely includes bands from other var genes that result in PCR products of slightly different size to that of the correct var gene. Fluorescence microscopy images show IFAs with indicated antibodies. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm. Pie charts show proportions of total var gene transcripts of the indicated cell lines determined by RNAseq (normalized to TPM). (D) Western blot of trypsin cleavage assays with indicated parasites. Asterisks show protected PfEMP1 fragment. α-SBP1-N: control for integrity of host cell. Marker in kDa. (E, F) SuperPlots of binding assays of indicated cell lines against CHO cells expressing GFP, CD36, ICAM-1, or EPCR (3 biological replicates with 15 fields of view/experiment and condition; bars: mean of averages of replicates with SD; unpaired t-test; p-values are indicated). Small gray dots: bound iE/field of view, extrapolated to mm2. Larger colored dots: average of bound iE/mm2/replicate. iE: infected erythrocytes. (G, H) Pie chart showing proportions of total var gene transcripts as determined by RNAseq (normalized to TPM) and Western blot of trypsin cleavage assay as described in (D) of IT4var19-HAendo parasites after five rounds of panning on EPCR. (I) Volcano plot showing differential expression analysis (DeSeq2) of EPCR-panned against unpanned IT4var19-HAendo parasites (see Source data 1 for full RNASeq data).
-
Figure 4—source data 1
Unedited agarose gels are shown in panels A–C.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data1-v1.zip
-
Figure 4—source data 2
Unedited agarose gels are shown in panels A–C with annotation.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data2-v1.zip
-
Figure 4—source data 3
Full and unedited blots corresponding to panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data3-v1.zip
-
Figure 4—source data 4
Full and unedited blots annotated and indicating the regions shown in panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data4-v1.zip
-
Figure 4—source data 5
Binding assays corresponding to panel E.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data5-v1.zip
-
Figure 4—source data 6
Binding assays corresponding to panel F.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data6-v1.xlsx
-
Figure 4—source data 7
Full and unedited blots corresponding to panel H.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data7-v1.zip
-
Figure 4—source data 8
Full and unedited blots annotated and indicating the regions shown in panel H.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig4-data8-v1.zip
Figure 5
Second endogenous modification with SLI2 in a SLI var gene cell line.
(A) Schematic for SLI2 strategy for second genome modification in SLI cell line with activated var gene. HR: homology region; ATS: acidic terminal segment; NTS: NTS domain; 2 A: T2A skip peptide; NEO-R: neomycin-resistance gene; yDHODH: yeast dihydroorotate dehydrogenase; BSD: Blasticidin-S-deaminase gene, arrows P1-8 primers for diagnostic PCR; X: desired var gene; PTP1: PfEMP1 transport protein 1. (B) Agarose gel shows PCR products confirming correct integration of the SLI2 plasmid and perpetuation of the SLI plasmid integration. SLI2 integration: product over 5′ integration junction (5’): P5+P8; over 3’ integration junction (3’): P7+P6; original locus (ori): P5+P6; SLI integration PCRs as described in Figure 1A; IT4: parent; Int: integrant cell line; primers in Table 1. (C) Fluorescence microscopy images of live IT4var01-HAendo+PTP1TGD-GFP parasites. (D) Fluorescence microscopy images of IFAs with indicated antibodies. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm. (E) Western blot of trypsin cleavage assays with IT4var01-HAendo+PTP1 TGD parasites. α-SBP1-N: control for integrity of host cell. Marker in kDa. (F) SuperPlot of binding assays of indicated cell lines against CHO cells expressing GFP, CD36, or ICAM-1 (3 biological replicates with 15 fields of view/experiment and condition; bars: mean of averages of replicates with SD; unpaired t-test; p-values are indicated). Small gray dots: bound iE/field of view, extrapolated to mm2. Larger colored dots: average of bound iE/mm2/replicate. iE: infected erythrocytes.
-
Figure 5—source data 1
Unedited agarose gels are shown in panel B.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig5-data1-v1.zip
-
Figure 5—source data 2
Unedited agarose gels are shown in panel B with annotations.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig5-data2-v1.zip
-
Figure 5—source data 3
Full and unedited blots corresponding to panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig5-data3-v1.zip
-
Figure 5—source data 4
Full and unedited blots annotated and indicating the regions shown in panel D.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig5-data4-v1.zip
-
Figure 5—source data 5
Binding assays corresponding to panel F.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig5-data5-v1.xlsx
Figure 6 with 2 supplements
Proxiome of PfEMP1 from living parasites.
(A) Schematic of the three different 3xHA-tagged BirA*-IT4var01 fusion constructs and the position respective to the membrane in the fusion constructs reaching the host cell surface. (B, C, D) Confirmation of the activation and modification of the indicated IT4var01-BirA* fusions. Fluorescence microscopy images show IFAs with indicated antibodies or streptavidin. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm. Pie charts show proportions of total var gene transcripts of the indicated cell lines determined by RNAseq (normalized to TPM). (E) Western blot of trypsin cleavage assays with indicated parasites. Asterisks show protected PfEMP1 fragment. α-SBP1-N: control for integrity of host cell. Marker in kDa. (F) SuperPlot of binding assays of indicated cell lines against CHO cells expressing GFP, CD36, or ICAM-1 (3 biological replicates with 15 fields of view/experiment and condition; bars: mean of averages of replicates with SD; unpaired t-test; p-values are indicated). Small gray dots: bound iE/field of view, extrapolated to mm2. Larger colored dots: average of bound iE/mm2/replicate. iE: infected erythrocytes. (G) Western blot of extracts of the indicated cell lines after incubation with biotin for 24 hr. Streptavidin probes biotinylated proteins; α-aldolase is the loading control. (H, I, J) Volcano plots showing enrichment of biotinylated proteins extracted with SDS from the indicated cell lines compared to IT4 wild-type parasites (24 hr growth with biotin; full data in Figure 6—source data 6). Only the quadrant with positive enrichment is shown, full plots in Figure 6—figure supplement 1 and further comparisons in Figure 6—figure supplement 2. Hits are color-coded as indicated and short names are given in the plot for known proteins. Phists and other exported proteins without short names were numbered (accessions are found under abbreviations in Figure 6—source data 6).
-
Figure 6—source data 1
Full and unedited blots corresponding to panel E.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-data1-v1.zip
-
Figure 6—source data 2
Full and unedited blots annotated and indicating the regions shown in panel E.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-data2-v1.zip
-
Figure 6—source data 3
Full and unedited blots corresponding to panel G.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-data3-v1.zip
-
Figure 6—source data 4
Full and unedited blots annotated and indicating the regions shown in panel G.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-data4-v1.zip
-
Figure 6—source data 5
Binding assays corresponding to panel F.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-data5-v1.xlsx
-
Figure 6—source data 6
Mass spectrometry data corresponding to panels H-J.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-data6-v1.xlsx
Figure 6—figure supplement 1
Correct integration of BioID cell lines and full volcano plots.
(A, B, C) Agarose gels show PCR products confirming correct integration of the SLI plasmid for the indicated cell lines. Product over 5′ integration junction (5’): P1+P2; 3’ integration junction (3’): P3+P4; original locus (ori): P1+P4; see Figure 1A for primer positions, Table 1 for sequence; IT4: parent; Int: integrant cell line. Graphs: full volcano plots showing enrichment of biotinylated proteins extracted with Triton (middle row) or SDS (right row, full plots of plots in Figure 6) from the lysates of the indicated cell lines compared to IT4 wild-type parasites. Confidence above – log10 FDR of 0.05 and log2 enrichment of 2 is indicated by red lines (Full data in Figure 6—source data 6).
-
Figure 6—figure supplement 1—source data 1
Unedited agarose gels are shown in panels A–C.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Unedited agarose gels are shown in panels A–C with annotations.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig6-figsupp1-data2-v1.zip
Figure 6—figure supplement 2
Volcano plots with color coding for comparison.
(A, B) Volcano plots of SDS extracts shown in Figure 6—figure supplement 1 with color coding according to similarity between positions (A) or with a general Maurer’s cleft BioID (Blancke Soares et al., 2025) (B). Hits were considered similar in all positions (yellow) when they were in a similar relative position to other hits (A). Hits were in (B) marked as present in general Maurer’s clefts proteome (light blue) if significantly enriched in BioID experiments of a general Maurer’s clefts marker over a protein soluble in the host cell or in the Maurer’s clefts attachment domain of MSRP6 over the control protein soluble in the host cell (Blancke Soares et al., 2025).
Figure 7 with 2 supplements
New proteins needed for PfEMP1 cytoadherence function.
(A) Domain schematic of candidates selected for analysis (Ty1-tagging and disruption (TGD) using SLI2) in IT4var01-BirA*Pos1endo. (B) SuperPlot of binding assays of the indicated cell lines against CHO cells expressing GFP, CD36, or ICAM-1 (3 or 4 (control and PTEF-TGD) biological replicates with 15 fields of view/experiment and condition; bars: mean of averages of replicates with SD; unpaired t-test; p-values are indicated). Small gray dots: bound iE/field of view, extrapolated to mm2. Larger colored dots: average of bound iE/mm2/replicate. iE: infected erythrocytes. (C) Western blot of trypsin cleavage assays with indicated parasites. Asterisks show protected PfEMP1 fragment. α-SBP1-N: control for integrity of host cell. Marker in kDa.
-
Figure 7—source data 1
Binding assays corresponding to panel B.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig7-data1-v1.xlsx
-
Figure 7—source data 2
Full and unedited blots corresponding to panel C.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig7-data2-v1.zip
-
Figure 7—source data 3
Full and unedited blots annotated and indicating the regions shown in panel C.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig7-data3-v1.zip
Figure 7—figure supplement 1
Cell lines and analysis of cytoadherence protein candidates.
(A) Agarose gels show PCR products confirming correct integration of the SLI2 plasmid for the indicated cell line. PCR over 5´integration junction (5’): P5+P8 in Figure 5A; PCR over 3’ integration junction (3’): P7+P6 in Figure 5A; original locus (ori): P5+P6 in Figure 5A; IT4 parent; Int: integrant cell line; primers in Table S6. Fluorescence microscopy images show IFAs of the indicated cell lines with indicated antibodies. Zoomed and boosted: enlargements with boosted intensity of the boxed areas to illustrate the circular signal of TryThrA-Ty and EMPIC3-Ty. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm and 1 µm in the zoomed images. (B) Agarose gels show PCR products confirming correct integration of the SLI2 plasmid and perpetuation of SLI plasmid integration for the indicated cell lines. PCR over 5´ integration junction (5’): P1+P2 in Figure 1A or P5+P8 in Figure 5A; PCR over 3’ integration junction (3’): P3+P4 in Figure 1A or P7+P6 in Figure 5A; original locus (ori): P1+P4 in Figure 1A or P5+P6 in Figure 5A; IT4 parent; Int: integrant cell line; primers in Table 1. Fluorescence microscopy images show live parasites (top rows) or IFAs (bottom rows) with indicated antibodies of the TGD cell lines. Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm.
-
Figure 7—figure supplement 1—source data 1
Unedited agarose gels shown in panels A and B.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig7-figsupp1-data1-v1.zip
-
Figure 7—figure supplement 1—source data 2
Unedited agarose gels shown in panels A and B with annotations.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig7-figsupp1-data2-v1.zip
Figure 7—figure supplement 2
Live cell imaging of episomally expressed SBP1-mCherry in the EMPIC3- and TryThrA-TGD parasites.
(A) Scheme of plasmid used to episomally express SBP1-mCherry in the parasites containing already two SLI modifications (in this case the IT4var01-BirA*Pos1endo cell line with SLI2-mediated TGDs as indicated in B and C). The orange bar indicates the position of the G 107 S change in PfFNT conferring resistance to BH267.meta. (B) and (C), Live cell fluorescence microscopy images of the indicated cell lines containing the plasmid shown in (A) (left) and quantification of phenotype (right; data from 31 cells from 7 independent imaging sessions for the EMPIC3-TGD and 37 cells from 7 independent sessions for the TryThrA-TGD). The arrow shows what was scored as aggregate (disproportionally strong focus compared to other foci). The truncated EMPIC3 and TryThrA are fused with GFP. SBP1-mChe, mCherry fused SBP1; Nuclei: Hoechst 33342; DIC: differential interference contrast; size bars 5 µm.
-
Figure 7—figure supplement 2—source data 1
Quantification of phenotypes of the EMPIC3- and TryThrA-TGDs corresponding to panels B and C.
- https://cdn.elifesciences.org/articles/103542/elife-103542-fig7-figsupp2-data1-v1.xlsx
Tables
Table 1
Primers for confirmation of integration of plasmids into the genome.
| Name of primer/target | Direction | Sequence |
|---|---|---|
| Plasmid region primers (P2, P3, P7, P8) | ||
| Neo40 (P2) | rv | CGAATAGCCTCTCCACCCAAG |
| pARL55 (P3/P7) | fw | GGAATTGTGAGCGGATAACAATTTCACACAGG |
| GFP85 (P8) | rv | ACCTTCACCCTCTCCACTGAC |
| Ty1 (P8) | rv | GTGGATCTTGATTTGTATGC |
| Gene-specific primers (P1, P4, P5, P6) | ||
| 3D7var0809100-HAendo | fw | CCCCCAGTTCCTGCTCCAGCTGGTG |
| rv | CCTAATGCATATTATGAAATATCCAC | |
| 3D7var2csa-HAendo | fw | GGTGGGACATGAATAAATATCACATATGGG |
| rv | CTTTCCATATATTTTATGCATTGCATTTATTAG | |
| 3D7var0425800-HAendo | fw | GTAGATGAATGGATAAAGCTGAAAAAGG |
| rv | CAAAAAATTATGAATCGAATATATTTAG | |
| 3D7MEEDvar0425800-HAendo | fw | GTAGATGAATGGATAAAGCTGAAAAAGG |
| rv | CAAAAAATTATGAATCGAATATATTTAG | |
| 3D7rif0425700-HAendo | fw | GTTTTATGTTAAACATATTTGATGTATTTATAAC |
| rv | GCGCAAAATAATTCATTCATTAAAATACCTG | |
| 3D7rif1254800-HAendo | fw | GTTATAGTTTTTATCATAAAATAATATACGTATCAC |
| rv | CAGTACATGTACCAAACATCCTACCAACATCTAC | |
| 3D7var0809100-mDHFR-HAendo | fw | CCCCCAGTTCCTGCTCCAGCTGGTG |
| rv | CCTAATGCATATTATGAAATATCCAC | |
| 3D7var2csa-mDHFR-HAendo | fw | GGTGGGACATGAATAAATATCACATATGGG |
| rv | CTTTCCATATATTTTATGCATTGCATTTATTAG | |
| IT4var66-HAendo | fw | TAATATGAGTACTAATAGTATGG |
| rv | AAACTCCACATAAAAAAATAAAAATCAAAC | |
| IT4var2csa-HAendo | fw | TAGATATATCCCCTATGTGAGTGATAC |
| rv | ATATACACATATAAATCATCACC | |
| IT4var01-HAendo | fw | CGACAACCACGTGAAGTGACGCATTCCATAGTC |
| rv | CTAATATAGTATCCATAGTAGAATTATCAGG | |
| IT4var16-HAendo | fw | AGTCCTAAATATAAAACATTGATAGAAGTGG |
| rv | AATAAAAAGAAATAATAATATATCG | |
| IT4var19-HAendo | fw | ACATTGATAGAAGTGGTACTAGAACCATCG |
| rv | AAAAAATTCAAACATATGTATATACATACG | |
| PTP1-TGD | fw | TAGAATAACATATAAAAAATATGTATTCTG |
| rv | TTTAACTTTACAAATTCCTTTTAATTTACG | |
| IT4var01-BirA*Pos1endo | fw | CGACAACCACGTGAAGTGACGCATTCCATAGTC |
| rv | CTAATATAGTATCCATAGTAGAATTATCAGG | |
| IT4var01-BirA*Pos2endo | fw | TTAAGGATGATTGTCGTAGTGACACCCCAG |
| rv | CTAATATAGTATCCATAGTAGAATTATCAGG | |
| IT4var01-BirA*Pos3endo | fw | TTAAGGATGATTGTCGTAGTGACACCCCAG |
| rv | AGGTATTCCATAATCTCCTTTAGGTATATCAATAACAC | |
| TryThrA-Ty1 | fw | TTGTTTTTGTCGTATAACAGAACCAATGG |
| rv | GTACATAACAAAAATGGTATATTAAAAAGC | |
| TryThrA-TGD | fw | TTGTTTTTGTCGTATAACAGAACCAATGG |
| rv | CATTAGACATTCCAGAATTTTCATATTTTTCC | |
| PTEF-Ty1 | fw | GAAAATGAAAGATGATGACTATGATGAAAG |
| rv | ACAAAAAAACAAAACAAAATTTTGATTAGG | |
| PTEF-TGD | fw | GGTTCTATTTTTATATAAGTAATCACATAC |
| rv | ATAATAATCTGTTTCATCAATATCATGTTC | |
| EMPIC3-Ty1 | fw | AAAAAGTATGAATTATTTGGTGTGAACAAG |
| rv | TATCTAATTGCATATAAAATTTTACAACAG | |
| EMPIC3-TGD | fw | AAAAAGTATGAATTATTTGGTGTGAACAAG |
| rv | TATCTAATTGCATATAAAATTTTACAACAG | |
| PeMP2-Ty1 | fw | AATTCAAGAATATAATTCAATTAGTTCTTC |
| rv | TTATTTCATTTACGAAAACACCATTTTCAC | |
| PeMP2-TGD | fw | AATTCAAGAATATAATTCAATTAGTTCTTC |
| rv | GTTCCTTATGTATTGATCTTCTTGCTCTGC | |
| PTP7-TGD | fw | ATGGTTTTATTTATTTTTCAATGGAAAAAG |
| rv | CATAATTTTCCTCATCTTCACTATTCTCCG |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (P. falciparum 3D7) | 3D7var0809100-HAendo | This study | See designation | 3D7 SLI var expressor line |
| Cell line (P. falciparum 3D7) | 3D7var1200600-HAendo | This study | 3D7var2csa-HAendo | 3D7 SLI var expressor line |
| Cell line (P. falciparum 3D7) | 3D7var0425800-HAendo | This study | See designation | 3D7 SLI var expressor line |
| Cell line (P. falciparum IT4) | IT4var040025500-HAendo | This study | IT4var66-HAendo | IT4 SLI var expressor line |
| Cell line (P. falciparum IT4) | IT4var120006100-HAendo | This study | IT4var2csa-HAendo | IT4 SLI var expressor line |
| Cell line (P. falciparum IT4) | IT4var060021400-HAendo | This study | IT4var01-HAendo | IT4 SLI var expressor line |
| Cell line (P. falciparum IT4) | IT4var120024500-HAendo | This study | IT4var16-HAendo | IT4 SLI var expressor line |
| Cell line (P. falciparum IT4) | IT4var010005000-HAendo | This study | IT4var19-HAendo | IT4 SLI var expressor line |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos1-HAendo | This study | IT4var01-BirA*Pos1endo | IT4 SLI var expressor line for BioID with BirA* in position 1 |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos2-HAendo | This study | IT4var01-BirA*Pos2endo | IT4 SLI var expressor line for BioID with BirA* in position 2 |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos3-HAendo | This study | IT4var01-BirA*Pos3endo | IT4 SLI var expressor line for BioID with BirA* in position 3 |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos1-HAendo with SLI2 TryThrA-TGD | This study | IT4var01-BirA*Pos1+TryThrA-TGD | IT4 SLI var expressor line with SLI2-mediated disruption of TryThrA |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos1-HAendo with SLI2 EMPIC3-TGD | This study | IT4var01-BirA*Pos1+EMPIC3-TGD | IT4 SLI var expressor line with SLI2-mediated disruption of EMPIC3 |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos1-HAendo with SLI2 PTP1-TGD | This study | IT4var01-BirA*Pos1+PTP1-TGD | IT4 SLI var expressor line with SLI2-mediated disruption of PTP1 |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos1-HAendo with SLI2 PTEF-TGD | This study | IT4var01-BirA*Pos1+PTEF-TGD | IT4 SLI var expressor line with SLI2-mediated disruption of PTEF |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos1-HAendo with SLI2 PeMP2-TGD | This study | IT4var01-BirA*Pos1+PeMP2-TGD | IT4 SLI var expressor line with SLI2-mediated disruption of PeMP2 |
| Cell line (P. falciparum IT4) | IT4var060021400-BirA*Pos1-HAendo with SLI2 PTP7-TGD | This study | IT4var01-BirA*Pos1+PTP7-TGD | IT4 SLI var expressor line with SLI2-mediated disruption of PTP7 |
| Antibody | Monoclonal rat anti-HA (clone 3F10) | Roche | 11867423001, RRID:AB_390918 | IFA (1:2000), WB (1:1000) |
| Antibody | Monoclonal rabbit anti-HA (C29F4) | Cell Signalling Technologies | 3724, RRID:AB_1549585 | IFA (1:1000) |
| Antibody | Monoclonal mouse anti-Ty1 (clone BB2) | Thermo | MA5-23513, RRID:AB_2610644 | IFA (1:20,000) |
| Antibody | Monoclonal rat anti-RFP (5F8) | Chromotek | 5f8 – 100, RRID:AB_2336064 | IFA (1:1000) |
| Antibody | Monoclonal mouse anti-GFP | Roche | 11814460001, RRID:AB_390913 | IFA (1:1000) |
| Antibody | Polyclonal rabbit anti-GFP | Thermo | A-6455, RRID:AB_221570 | IFA (1:1000) |
| Sequence-based reagent | PCR primer Neo40 (P2) | This paper | P2 | CGAATAGCCTCTCCACCCAAG |
| Sequence-based reagent | PCR primer pARL55 (P3/P7) | This paper | P3/P7 | GGAATTGTGAGCGGATAACAATTTCACACAGG |
| Sequence-based reagent | PCR primer GFP85 (P8) | This paper | P8 | ACCTTCACCCTCTCCACTGAC |
| Sequence-based reagent | PCR primer Ty1 (P8) | This paper | P8 | GTGGATCTTGATTTGTATGC |
| Other | Biotin | Sigma Aldrich | B4639 | BioIDs |
| Other | Hoechst 33342 | Cayman | K9061 | Live cell and IFA DNA stain |
| Other | 4',6-diamidino-2-phenylindole (DAPI) | Roche | 10236276001 | IFA DNA stain |
Author response table 1
Parent vs IT4-Var19 panned and unpanned.
| Gene ID | Average of IT4 parent (n=3) | Average Var19 panned (n=4) | Average Var19 not panned (n=4) | |
|---|---|---|---|---|
| PfiT_140083100 | 2,45596041 | 3,14231686 | 0,35897933 | |
| PfiT _140084700 | 4,97115609 | 17,5952948 | 0,84662599 | |
Author response table 2
TGD lines with binding phenotype vs parent.
| Gene ID | SLI_BioIDPos1_Empic3 -TGD | SLI_BioIDPos1_TryThraA -TGD | SLI_ptp1-TGD | SLI_BirAPos1_var |
|---|---|---|---|---|
| PfiT_140083100 | 2,25443223 | 1,06975218 | 1,20352604 | 1,4791184 |
| PfiT_140084700 | 3,41126305 | 22,3717269 | 18,7216101 | 14,2297336 |
Additional files
-
Supplementary file 1
Sequences of Plasmid constructs.
- https://cdn.elifesciences.org/articles/103542/elife-103542-supp1-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/103542/elife-103542-mdarchecklist1-v1.docx
-
Source data 1
RNA Seq and differential gene expression results for the tested SLI lines.
- https://cdn.elifesciences.org/articles/103542/elife-103542-data1-v1.xlsx
-
Source data 2
Whole genome sequencing comparison of Var01-EMPIC3-TGD and Var01-TryThrA-TGD parasites with the Var01 parent cell line (IT4var01-BirA*Pos1).
- https://cdn.elifesciences.org/articles/103542/elife-103542-data2-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A system for functional studies of the major virulence factor of malaria parasites
eLife 13:RP103542.
https://doi.org/10.7554/eLife.103542.3
