A Commander-independent function of COMMD3 in endosomal trafficking
- Department of Molecular, Cellular and Developmental Biology, University of Colorado, United States
Figures
Figure 1
Genetic analysis of genes encoding Retromer and Commander subunits using unbiased genome-wide CRISPR screens.
(A) Cartoon representation of the Retromer and Commander complexes. (B) Table listing genes encoding the subunits of the Retromer and Commander complexes. (C) Ranking of genes encoding the Retromer and Commander complexes in an unbiased CRISPR screen that was conducted to identify genes required for the surface homeostasis of GLUT-SPR (Wang et al., 2023). The GLUT-SPR reporter was constructed by inserting a hemagglutinin (HA) epitope into an exoplasmic loop of the glucose transporter GLUT4, with a GFP tag fused to the intracellular C-terminus of GLUT4 (Gulbranson et al., 2017; Klip et al., 2019; Blot and McGraw, 2008). Surface expression (HA staining) of the reporter was normalized to total reporter expression (GFP fluorescence) as a measure of relative surface levels of the reporter. Each dot represents a gene. The dashed line depicts the P-value cutoff at 0.05. (D) Essentiality scores of genes encoding the Retromer and Commander complexes were calculated by comparing gRNA abundance in a passage cell population (without any selection) with that in the initial CRISPR library. Genes with essentiality scores below the horizontal cutoff line are predicted to be essential to cell survival or growth. Full datasets of the CRISPR screens are included in a previous report (Wang et al., 2023).
-
Figure 1—source data 1
CRISPR screen data ranked by significance is shown in Figure 1C.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Gene essentiality scores are shown in Figure 1D.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig1-data2-v1.xlsx
Figure 2
Intracellular sequestration of GLUT-SPR in COMMD3-deficient cells.
(A) Representative immunoblots showing the indicated proteins in wild-type (WT) and Commd3 KO mouse preadipocytes. (B) Normalized surface levels of GLUT-SPR measured by flow cytometry in WT and KO preadipocytes. The cells were either untreated or treated with 100 nM insulin for 1 hr before surface GLUT-SPR was labeled using anti-HA antibodies and APC-conjugated secondary antibodies. To calculate surface levels of GLUT-SPR, mean APC values were divided by mean GFP fluorescence. To inhibit insulin signaling, 100 nM wortmannin was added prior to insulin stimulation. In all figures, data normalization was performed by setting the mean value of WT data points as 100 or 1, and all data points including WT ones were normalized to that mean value. Data are presented as mean ± SD of three biological replicates. **p<0.01; *p<0.05 (calculated using Student’s t-test). (C) Normalized surface levels of GLUT-SPR in WT and KO adipocytes. Data are presented as mean ± SD of three biological replicates. ***p<0.001; n.s., p>0.05 (calculated using Student’s t-test). (D) Representative confocal images showing the localization of GLUT-SPR in unpermeabilized WT and Commd3 KO adipocytes, which were either untreated or treated with 100 nM insulin for one hour. Surface GLUT-SPR was labeled using anti-HA antibodies and Alexa Fluor 568-conjugated secondary antibodies. Nuclei were stained with Hoechst 33342. Scale bars: 10 µm.
-
Figure 2—source data 1
PDF file containing original immunoblots for Figure 2A, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig2-data1-v1.zip
-
Figure 2—source data 2
Original files for immunoblot analysis displayed in Figure 2A.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig2-data2-v1.zip
-
Figure 2—source data 3
Flow cytometry data of wild-type (WT) and Commd3 KO preadipocytes shown in Figure 2B.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig2-data3-v1.xlsx
-
Figure 2—source data 4
Flow cytometry data of wild-type (WT) and Commd3 KO adipocytes shown in Figure 2C.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig2-data4-v1.xlsx
Figure 3
Abnormal endosomal morphology in COMMD3-deficient cells.
(A) Representative confocal images showing the localization of EEA1 and GLUT-SPR in permeabilized wild-type (WT) and Commd3 KO adipocytes stimulated with 100 nM insulin for 1 hr (scale bars: 10 µm). Enlarged inset images depict co-localization of EEA1 and GLUT-SPR (scale bars: 5 µm). (B) Violin plot showing quantification of EEA1-positive puncta using Fiji threshold analysis. Data of the KO adipocytes were normalized to those of WT cells. Three independent experiments are shown with ten cells analyzed in each experiment. ***p<0.001 (calculated using Student’s t-test). (C) Violin plot depicting quantification of GFP mean fluorescence intensity (MFI) in EEA1-positive puncta using Fiji threshold analysis. Data of KO adipocytes were normalized to those of WT cells. Three independent experiments are shown with ten cells analyzed in each experiment. ***p<0.001 (calculated using Student’s t-test). (D) Representative Structured Illumination Microscopy (SIM) images showing the subcellular localization of Rab5 and GLUT-SPR in WT and Commd3 KO preadipocytes (scale bars: 5 µm). (E) Quantification of Rab5 and GLUT-SPR co-localization based on SIM images, which were captured as in (D) and analyzed using ImageJ. Each dot represents data of a subcellular region of interest. Five cells were analyzed and three regions per cell were quantified. ***p<0.001 (calculated using Student’s t-test).
-
Figure 3—source data 1
Quantification of EEA1 + areas in wild-type (WT) and Commd3 KO cells is shown in Figure 3B.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Quantification of GFP in EEA1 + compartments in wild-type (WT) and Commd3 KO cells is shown in Figure 3C.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig3-data2-v1.xlsx
-
Figure 3—source data 3
Flow cytometry data of wild-type (WT) and Commd3 KO cells is shown in Figure 3D.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig3-data3-v1.xlsx
Figure 4 with 1 supplement
COMMD3 regulates a group of cargo proteins independent of other COMMD proteins.
(A–D) Normalized surface levels of ITGA6 (A), GLUT-SPR (B), TfR (C), and LAMP1 (D) measured by flow cytometry in the indicated preadipocyte cell lines. To calculate surface levels of GLUT-SPR, mean APC values were divided by mean GFP fluorescence. Data of all cell samples were normalized to those of wild-type (WT) cells. Data of ITGA6 (n=3), GLUT-SPR (n=6), TfR (n=10), and LAMP1 (n=3) are presented as mean ± SD. **p<0.01; ***p<0.001; n.s., p>0.05 (calculated using one-way ANOVA).
-
Figure 4—source data 1
Flow cytometry data of wild-type (WT) and KO cells is shown in Figure 4A.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Flow cytometry data of wild-type (WT) and KO cells is shown in Figure 4B.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig4-data2-v1.xlsx
-
Figure 4—source data 3
Flow cytometry data of wild-type (WT) and KO cells is shown in Figure 4C.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig4-data3-v1.xlsx
-
Figure 4—source data 4
Flow cytometry data of wild-type (WT) and KO cells are shown in Figure 4D.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig4-data4-v1.xlsx
Figure 4—figure supplement 1
Quantification of transferrin receptor (TfR) in wild-type (WT) and mutant cell lines.
(A) Quantification of total TfR levels in the indicated preadipocyte cell lines based on protein intensities from immunoblots, analyzed using ImageJ. Data were normalized to WT cells. Data are presented as mean ± SD from three biological replicates. **p<0.01; n.s., p>0.05 (one-way ANOVA). (B) Normalized surface-to-total TfR ratio. Surface TfR levels, measured by flow cytometry, were normalized to total protein expression. Data are presented as mean ± SD from three biological replicates. *p<0.05; ***p<0.001; n.s., p>0.05 (one-way ANOVA).
-
Figure 4—figure supplement 1—source data 1
Flow cytometry data of wild-type (WT) and KO cells is shown in Figure 4—figure supplement 1A.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig4-figsupp1-data1-v1.xlsx
-
Figure 4—figure supplement 1—source data 2
Flow cytometry data of wild-type (WT) and KO cells is shown in Figure 4—figure supplement 1B.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig4-figsupp1-data2-v1.xlsx
Figure 5 with 1 supplement
Upregulation of COMMD3 in cells deficient in CCDC93 or VPS35L.
(A) Representative immunoblots showing protein expression in the indicated preadipocyte cell lines. (B–D) Normalized surface levels of transferrin receptor (TfR) measured by flow cytometry in the indicated preadipocyte cell lines. Data of all cell samples were normalized to those of WT cells. Data are presented as mean ± SD of three biological replicates. **p<0.01; ***p<0.001; n.s., p>0.05 (calculated using one-way ANOVA).
-
Figure 5—source data 1
PDF file containing original immunoblots for Figure 5A, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig5-data1-v1.zip
-
Figure 5—source data 2
Original files for immunoblot analysis displayed in Figure 5A.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig5-data2-v1.zip
-
Figure 5—source data 3
Flow cytometry data of the indicated cell lines shown in Figure 5B.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig5-data3-v1.xlsx
-
Figure 5—source data 4
Flow cytometry data of the indicated cell lines shown in Figure 5C.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig5-data4-v1.xlsx
-
Figure 5—source data 5
Flow cytometry data of the indicated cell lines shown in Figure 5D.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig5-data5-v1.xlsx
Figure 5—figure supplement 1
Quantification of total COMMD3 levels.
Total COMMD3 levels in the indicated preadipocyte cell lines were quantified based on protein intensities from immunoblots, analyzed using ImageJ. Data were normalized to wild-type (WT) cells. Data are presented as mean ± SD from three biological replicates. ***p<0.001; *p<0.05 (one-way ANOVA).
-
Figure 5—figure supplement 1—source data 1
Flow cytometry data of the indicated cell lines is shown in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig5-figsupp1-data1-v1.xlsx
Figure 6 with 1 supplement
The Commander-independent function of COMMD3 is mediated by its N-terminal domain (NTD).
(A) Top, diagram depicting the domain organization of COMMD3. Bottom: the structural model of COMMD3 (AlphaFold Protein Structure Database: AF-Q9UBI1-F1) showing the independently folded NTD and C-terminal domain (CTD). (B) Normalized surface levels of transferrin receptor (TfR) measured by flow cytometry in the indicated preadipocyte cell lines. Data of all cell samples were normalized to those of wild-type (WT) cells. Data are presented as mean ± SD of three biological replicates. *p<0.05; ***p<0.001 (calculated using one-way ANOVA). (C) Diagrams of full-length (FL) and truncated COMMD3 proteins used in proteomic experiments. The proteins were tagged with mCherry (mCh) and 3xFLAG (3xF). (D) Procedures of proteomic analysis to determine the interactomes of FL and truncated COMMD3 proteins. (E) Venn diagram showing the interactomes of COMMD3 proteins. (F) A scatter plot showing the fold change of protein abundance over vector control in the interactomes of FL COMMD3 and the NTD of COMMD3. Selected proteins are labeled. (G) Representative immunoblots showing the interactions of ARF1 Q71L with COMMD3-NTD. HA-tagged ARF1 Q71L and 3xFLAG-tagged COMMD3-NTD were co-expressed in 293T cells. COMMD3-NTD and associated proteins were immunoprecipitated using anti-FLAG antibodies and detected using immunoblotting. The ARF Q71L mutant was used here because it adopts a GTP-bound configuration (Cohen and Donaldson, 2010; Zhang et al., 1994).
-
Figure 6—source data 1
Flow cytometry data of the indicated cell lines is shown in Figure 6B.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig6-data1-v1.xlsx
-
Figure 6—source data 2
Original data of the plot is shown in Figure 6F.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig6-data2-v1.xlsx
-
Figure 6—source data 3
PDF file containing original immunoblots for Figure 6G, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig6-data3-v1.zip
-
Figure 6—source data 4
Original files for immunoblot analysis displayed in Figure 6G.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig6-data4-v1.zip
Figure 6—figure supplement 1
The C-terminal domain (CTD) of COMMD3 is unable to rescue transferrin receptor (TfR) surface levels.
Normalized surface levels of TfR were measured by flow cytometry in the indicated preadipocyte cell lines. Data were normalized to wild-type (WT) cells. Results are presented as mean ± SD from three biological replicates. ***p<0.001; n.s., p>0.05 (one-way ANOVA).
-
Figure 6—figure supplement 1—source data 1
Flow cytometry data of the indicated cell lines is shown in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig6-figsupp1-data1-v1.xlsx
Figure 7
The N-terminal domain (NTD) of COMMD3 stabilizes ARF1.
(A) Representative Structured Illumination Microscopy (SIM) images showing the subcellular localization of ARF1 and COMMD3-NTD expressed in HeLa cells. HA-tagged ARF1 and 3xFLAG-tagged COMMD3-NTD were transiently expressed in HeLa cells and stained using anti-HA and anti-FLAG antibodies, respectively (scale bars: 5 µm). (B) Quantification of ARF1 and COMMD3-NTD co-localization based on SIM images, which were captured as in (A) and analyzed using ImageJ. Each dot represents data of an individual cell. In randomized samples, ARF1 images were rotated 90° clockwise, whereas COMMD3-NTD images were not rotated. ***p<0.001 (calculated using Student’s t-test). (C) Representative immunoblots showing the ARF1-stabilizing effects of COMMD3-NTD. HA-tagged ARF1 Q71L and 3xFLAG-tagged COMMD3-NTD were transiently expressed in HeLa cells and their total expression levels were measured using immunoblotting. (D) Representative immunoblots showing protein expression in the indicated preadipocyte cell lines. (E) Normalized surface levels of TfR measured by flow cytometry in the indicated preadipocyte cell lines. Data of all cell samples were normalized to those of wild-type (WT) preadipocytes. Data are presented as mean ± SD of three biological replicates. ***p<0.001; n.s., p>0.05 (calculated using one-way ANOVA).
-
Figure 7—source data 1
Original data of the plot shown in Figure 7B.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig7-data1-v1.xlsx
-
Figure 7—source data 2
PDF file containing original immunoblots for Figure 7C and D, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig7-data2-v1.zip
-
Figure 7—source data 3
Original files for immunoblot analysis displayed in Figure 7C and D.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig7-data3-v1.zip
-
Figure 7—source data 4
Flow cytometry data of the indicated cell lines is shown in Figure 7E.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig7-data4-v1.xlsx
Figure 8
The COMMD3-ARF1 interaction is critical to the Commander-independent function of COMMD3.
(A) Left: the AlphaFold3-predicted structure of the COMMD3:ARF1 heterodimer visualized using ChimeraX1.8. The structural prediction was performed using COMMD3-NTD (a.a. 1–120, purple), ARF1 (pink), and GTP (green) as input. Right: key residues at the COMMD3-ARF1 binding interface. The CIF file of the structural model is included in Supplementary Dataset 1. (B) Predicted alignment error (PAE) heatmap of the structural model shown in (A). (C) Diagrams showing the residues mutated in a COMMD3-NTD mutant (COMMD3-NTD*, only a.a. 56–65 are shown). Mutated residues are shown in red. (D) Quantification of COMMD-NTD and NTD* stably expressed in preadipocytes based on Structured Illumination Microscopy (SIM) images, which were captured and analyzed as in Figure 7A–B. Each dot represents data of an individual cell. MFI, mean fluorescence intensity. n.s., p>0.05 (calculated using Student’s t-test). (E) Normalized surface levels of transferrin receptor (TfR) measured by flow cytometry in the indicated preadipocyte cell lines. Data of all cell samples were normalized to those of wild-type (WT) cells. Data are presented as mean ± SD of three biological replicates. ***p<0.001; n.s., p>0.05 (calculated using one-way ANOVA). (F) Quantification of endogenous ARF1 in the indicated preadipocyte cell lines based on intensities of proteins on immunoblots quantified using ImageJ. Data of all samples were normalized to those of WT cells. Data are presented as mean ± SD of three biological replicates. *p<0.05; n.s., p>0.05; **p<0.01 (calculated using one-way ANOVA).
-
Figure 8—source data 1
Flow cytometry data of the indicated cell lines shown in Figure 8D.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig8-data1-v1.xlsx
-
Figure 8—source data 2
Flow cytometry data of the indicated cell lines shown in Figure 8E.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig8-data2-v1.xlsx
-
Figure 8—source data 3
Flow cytometry data of the indicated cell lines shown in Figure 8F.
- https://cdn.elifesciences.org/articles/105264/elife-105264-fig8-data3-v1.xlsx
Figure 9
Model of the Commander-independent function of COMMD3 in endosomal trafficking.
For clarity, Retromer and other endosomal recycling regulators are not shown.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (H. sapiens) | COMMD3 | Uniprot | Q9UBI1 | Sequence codon optimized to avoid Cas9 targeting |
| Gene (H. sapiens) | ARF1 | Entrez | PVNH8 | Cloned from Addgene # 39554 |
| Cell line (M. musculus) | Preadipocytes | Dr. Shingo Kajimura | N/A | |
| Cell line (H. sapiens) | HeLa | ATCC | CCL-2 | |
| Cell line (H. sapiens) | HEK 293T | ATCC | CRL-3216 | |
| Recombinant DNA reagent (M. musculus) | pLenti-CRISPR-v2 | Addgene | #52961 | Lentiviral construct to infect and express Cas9 and gRNA. |
| Recombinant DNA reagent (M. musculus) | pLentiGuide-Puro vector | Addgene | #52963 | Lentiviral construct to infect and express gRNA. |
| Recombinant DNA reagent (H. sapiens, M. musculus) | SHC003 GFPD | Addgene | #133301 | Mammalian expression plasmid backbone. |
| Recombinant DNA reagent (H. sapiens, M. musculus) | SHC003 GFPD-humanCOMMD3-FL-mCherry-3xFLAG | This paper | N/A | Lentiviral construct to infect/transfect cells and express genes. |
| Recombinant DNA reagent (H. sapiens, M. musculus) | SHC003 GFPD-humanCOMMD3-NTD-mCherry-3xFLAG | This paper | N/A | Lentiviral construct to infect/transfect cells and express genes. |
| Recombinant DNA reagent (H. sapiens, M. musculus) | SHC003 GFPD-mCherry-humanCOMMD3-CTD-3xFLAG | This paper | N/A | Lentiviral construct to infect/transfect cells and express genes. |
| Recombinant DNA reagent (H. sapiens, M. musculus) | SHC003 GFPD-humanARF1-HA | This paper | N/A | Lentiviral construct to infect/transfect cells and express genes. |
| Sequence-based reagents | COMMD3 CRISPR guide RNA sequence primers | This paper | N/A | CTTCGCGCTTCTCCTCCGGG |
| Sequence-based reagents | COMMD3 CRISPR guide RNA sequence primers | This paper | CTTGAAACAGATCGACCCAG | |
| Sequence-based reagents | COMMD1 CRISPR guide RNA sequence primers | This paper | TCACGGACACTCGGGTGTCA | |
| Sequence-based reagents | Commd1 CRISPR guide RNA sequence primers | This paper | ACTGCTCAAACCAAAAAGCA | |
| Sequence-based reagents | Commd5 CRISPR guide RNA sequence primers | This paper | GTTGTTGAAACTCGTAGTCG | |
| Sequence-based reagents | Commd5 CRISPR guide RNA sequence primers | This paper | TGCCAGCGCCAACCTGTCAG | |
| Sequence-based reagents | Ccdc93 CRISPR guide RNA sequence primers | This paper | CGAAAGTACCGACGGCAGCG | |
| Sequence-based reagents | Ccdc93 CRISPR guide RNA sequence primers | This paper | GATGACCGCCATGGCAAACG | |
| Sequence-based reagents | Vps35l CRISPR guide RNA sequence primers | This paper | GGATTATGTGAACCGCATAG | |
| Sequence-based reagents | Vps35l CRISPR guide RNA sequence primers | This paper | GGAGGTTTGCAAGTGCATCA | |
| Antibody | anti-HA mouse monoclonal | BioLegend | #901501, RRID:AB_2565006 | Flow (1:250), IF (1:1000) |
| Antibody | APC-conjugated anti-LAMP1 mouse monoclonal | BioLegend | #328619, RRID:AB_1279055 | Flow (1:250) |
| Antibody | anti-ITGA6 rat monoclonal | Invitrogen | #14-0495-82, RRID:AB_891480 | Flow (1:250) |
| Antibody | APC-conjugated anti-mouse secondary antibodies rat monoclonal | eBioscience | #17-4015-82, RRID:AB_2573205 | Flow (1:1000) |
| Antibody | APC-conjugated anti-rat antibodies goat polyclonal | Invitrogen | #A10540, RRID:AB_10562535 | Flow (1:1000) |
| Antibody | APC-conjugated anti-TfR/CD71 antibodies mouse monoclonal | BioLegend | #334108, RRID:AB_10915138 | Flow (1:500) |
| Antibody | anti-FLAG M2 mouse monoclonal | Sigma-Aldrich | #F1804, RRID:AB_262044 | IF (1:1000) |
| Antibody | Alexa Fluor 647-conjugated anti-rabbit IgG goat polyclonal | Invitrogen | #A32733, RRID:AB_2633282 | IF (1:1000) |
| Antibody | Alexa Fluor 568-conjugated anti-mouse IgG goat polyclonal | Thermo Fisher Scientific | #A11004, RRID:AB_2534072 | IF (1:1000) |
| Antibody | Anti-COMMD3 rabbit polyclonal | Bethyl | #A304-092A, RRID:AB_2621341 | IB (1:200) |
| Antibody | anti-VPS35L rabbit polyclonal | Invitrogen | #PA5-28553, RRID:AB_2546029 | IB (1:500) |
| Antibody | anti-CCDC93 mouse monoclonal | Santa Cruz Biotechnology | #sc-514600 | IB (1:100) |
| Antibody | anti-alpha-tubulin mouse monoclonal | DSHB | #12G10, RRID:AB_1210456 | IB (1:1000) |
| Antibody | HRP-conjugated anti-FLAG M2 mouse monoclonal | Sigma-Aldrich | #A8592, RRID:AB_439702 | IB (1:1000) |
| Antibody | HRP-conjugated anti-HA rat monoclonal | Roche | #12013819001, RRID:AB_390917 | IB (1:1000) |
| Antibody | HRP-conjugated anti-rabbit IgG goat polyclonal | Sigma-Aldrich | #A6154, RRID:AB_258284 | IB (1:2000) |
| Antibody | HRP-conjugated anti-mouse IgG sheep polyclonal | Sigma-Aldrich | #A6782, RRID:AB_258315 | IB (1:2000) |
| Software, algorithm | AlphaFold3 (AF3) | PMID:38718835 | Used for structural prediction |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/105264/elife-105264-mdarchecklist1-v1.pdf
-
Supplementary file 1
The interactome of COMMD3.
- https://cdn.elifesciences.org/articles/105264/elife-105264-supp1-v1.xlsx
-
Source data 1
Original CIF file of the structural model shown in Figure 8A.
- https://cdn.elifesciences.org/articles/105264/elife-105264-data1-v1.cif
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A Commander-independent function of COMMD3 in endosomal trafficking
eLife 14:RP105264.
https://doi.org/10.7554/eLife.105264.3
