Genome organization by SATB1 binding to base-unpairing regions (BURs) provides a scaffold for SATB1-regulated gene expression
- Department of Orofacial Sciences, University of California, San Francisco, United States
- Lawrence Berkeley National Laboratory, United States
- Department of Biological Chemistry, School of Medicine, Johns Hopkins University, United States
- Institute of Genetics and Molecular and Cellular Biology (IGBMC), France
- Laboratory of Experimental Immunology, Immunology Frontier Research Center, Osaka University, Japan
- Department of Pathology, University of Southern California, United States
- Department of Dermatology, Boston University School of Medicine, United States
- Laboratory for Transcriptional Regulation, RIKEN Center for Integrative Medical Sciences, Japan
Figures
Figure 1
Scheme of urea ChIP-seq and difference from standard ChIP-seq.
(A) An illustration for a BUR anchored to the high-salt extraction resistant SATB1 subnuclear architecture (Cai et al., 2003). DNA-FISH signals (red dots) for a cloned SATB1-bound DNA in both alleles are shown in Satb1+/+(WT) and Satb1-/-(KO) thymocytes on slides treated with 2 M NaCl solution to produce DNA halos around the nuclei (blue loops). SATB1 and the SATB1-bound DNA remain in the residual nucleus in WT thymocytes after salt treatment. However, in KO thymocytes, the DNA regions normally bound by SATB1 are located in the DNA halos after the treatment. (B) A comparative overview of the urea ChIP-seq and standard ChIP-seq protocols. In urea ChIP-seq, entire crosslinked chromatin purified by 8 M urea ultracentrifugation is solubilized (see Materials and methods) before chromatin immunoprecipitation. By contrast, in standard ChIP-seq, crosslinked chromatin in whole nuclei is sonicated, centrifuged, and the soluble fraction is isolated for chromatin immunoprecipitation. These critical steps that are different between urea and standard ChIP-seq are highlighted in boxed texts. (C) Differences in the profiles of the peaks generated from urea ChIP-seq versus standard ChIP-seq. A diagram is shown for ChIP-seq peaks using antibodies (α) against a DNA direct-binding protein (pink), a DNA indirect-binding protein (blue), and DNA direct-binding protein that resides in the inaccessible chromatin region (green). Note: This diagram illustrates a hypothetical scenario where some of the proteins (green) in the inaccessible chromatin region may also reside in the accessible chromatin binding indirectly to chromatin.
Figure 2 with 1 supplement
Identification of BURs as direct targets of SATB1 in vivo by urea ChIP-seq.
(A) Contrasting distributions of SATB1-binding profiles determined by urea ChIP-seq (Urea) compared to standard ChIP-seq (Std) in mouse thymocytes. (B) A zoomed-in view of the gray-highlighted region shown in (panel A). The track 3 (panels A and B) represents all potential BUR sites serving as a reference for BUR sites. For both panels A and B, two independent urea and standard ChIP-seq experiments show high reproducibility (tracks 1 and 2 and tracks 4 and 5). Track 6 (CTCF) and track 7 (H3K27ac) [ENCODE, Bring Ren’s Laboratory at the Ludwig Institute for Cancer Research (LICR)] and tracks 8 (DNase 1 HS) and 9 (RNAseq) (ENCODE, the University of Washington (UW) group). (C) The percentages of urea (Urea) and standard (Std) SATB1 ChIP-seq peaks that intersect with the BUR reference map (see Supplementary file 1). The significance (p values) of the overlap in each of the four cases (urea and standard ChIP-seq samples with two replicates each) with BURs is estimated as the fraction of the overlap counts greater than or equal to the observed count over 1000 random bootstrapped genomic features. p<0.001: none of 1000 random fragments showed greater overlap with BURs than observed in ChIP-seq samples, p=1 means all 1000 random fragments showed greater overlap with BURs than observed in ChIP-seq, indicating avoidance of BURs (see Materials and methods). (D) Normalized genome-wide average intensity distribution profiles (normalized relative score) of SATB1 binding sites determined by standard ChIP-seq, urea ChIP-seq as well as BURs, over a ±3 kb window centered at BUR peaks. Relative distance, projection, and Jaccard tests all indicate strong correlation (p<0.05) between urea ChIP-seq peaks for SATB1 and BURs, but no overlap (p<0.05) between standard ChIP-seq peaks for SATB1 and BUR peaks. (E) (Left) Heatmaps showing SATB1 ChIP-seq signal intensity centered on all BUR elements. Signal is plotted within ±3 kb of each BUR center using 50 bp bins using EnrichedHeatmap package (v1.30.0). The line plots above the heatmaps display the average SATB1 signal across all regions. Only a subset of BURs exhibits strong SATB1 binding, consistent with selective occupancy. (Right) Heatmaps showing BUR signal intensity centered on SATB1-bound regions (from ChIP-seq peaks). The vast majority of SATB1 binding events are positioned within BURs, as evidenced by sharp, centered BUR signal at nearly all SATB1 peaks. Line plots reflect the average BUR signal profile across all SATB1 sites in each domain class. BUR intensities are derived from in vitro SATB1 BUR-binding assays.
Figure 2—figure supplement 1
Zoomed-in view of Figure 2B showing precise coincidence of SATB1 urea ChIP-seq peaks with a subset of BURs.
(A) Peak A, Peak B, Peak C, and Peak D shown in tracks 4 and 5 overlap with BURs in track 3. The bottom panel is a zoom-in view of the top panel (from Figure 2B). (B) High-resolution views of each peak region showing precise co-mapping of BUR (red peak) and SATB1 peak (blue peak). (C) A representative BUR sequence (a cluster of ATC/ATC sequences) from Peak B.
Figure 3 with 2 supplements
Identical CTCF-binding profiles are produced by urea and standard ChIP-seq, independent of SATB1.
(A) Urea ChIP-seq (Urea) profiles for CTCF in Satb1+/+ (WT) thymocytes and Satb1-/- (KO) thymocytes (track 2 and 3), and for SATB1 in WT thymocytes (track 1). These binding patterns were compared against CTCF-binding profiles generated by standard ChIP-seq (Std) from ENCODE (tracks 4 and 5) for testis and thymocytes (ENCODE, LICR), respectively, along with the DNase1 HS profile from ENCODE, UW (track 6) as well as the SATB1-binding profile from standard ChIP-seq (track 7). (B) Genome-wide average intensity distribution (relative score) of peaks from CTCF and SATB1 urea ChIP-seq for Satb1+/+ thymocytes (WT), CTCF urea ChIP-seq for Satb1-/- thymocytes (KO), and SATB1 standard ChIP-seq (WT) over a ±3 kb window centered at CTCF peaks (WT). Relative distance, projection, and Jaccard tests all indicate strong correlation (p<0.05) between CTCF urea ChIP-seq peaks for WT and KO thymocytes, between these peaks and standard ChIP-seq peaks for SATB1, but no overlap (p<0.05) between SATB1 urea ChIP-seq peaks. (C) Urea-ChIP-Western results for CTCF, RAD21, and SATB1, showing that SATB1 does not associate with CTCF nor RAD21 on chromatin. Also, CTCF and RAD21 co-binding to chromatin appears to be infrequent, suggested by the weak ChIP-Western signals. (D) Hi-C interaction heatmaps for Satb1+/+:Cd4-Cre (WT) (top right triangle) and Satb1fl/fl:Cd4-Cre (KO) thymocytes (bottom left triangle) show essentially identical patterns. (E) Genome-wide comparison of distributions of cis-Eigenvector 1 values shows no difference between WT and KO thymocytes (high correlation at r=0.998), indicating that genomic compartmentalization is unaffected in Satb1 KO thymocytes. Experiments were done in two replicates each for WT and KO samples. The data shown in D and E were generated by combining data from the replicates for each condition.
-
Figure 3—source data 1
Original raw data for ChIP-Western results shown in Figure 3C (labelled).
- https://cdn.elifesciences.org/articles/105915/elife-105915-fig3-data1-v1.pdf
-
Figure 3—source data 2
Original raw data for ChIP-Western results shown in Figure 3C.
- https://cdn.elifesciences.org/articles/105915/elife-105915-fig3-data2-v1.zip
Figure 3—figure supplement 1
Similar DNA binding profiles for PRC2 core subunits obtained by standard ChIP-seq and Urea ChIP-seq.
The DNA binding profiles of PRC2 core subunits, Jarid2, Suz12, and Ezh2 obtained by standard ChIP-seq (Peng et al., 2009, GEO repository [GSE18776]) were compared against the DNA binding profiles of these proteins by urea ChIP-seq. Their binding profiles in the Hoxd cluster region on chromosome 2 (mm9) are shown. Their DNA binding profiles by urea ChIP-seq and by standard ChIP-seq are very similar.
Figure 3—figure supplement 2
SATB1 does not directly co-bind chromatin with CTCF and RAD21 or has a role in TAD formation.
(A) Urea ChIP-Western studies for CTCF, RAD21, and SATB1. Original data for Figure 3C is shown. The excised areas used are shown in Figure 3—source data 1. Input chromatin in the leftmost panel indicates whole urea-purified chromatin before immunoprecipitation. Western blot with the anti-H3 antibody shows that the original urea-purified chromatin samples before ChIP were similar in amount (right panel). (B) Read alignment statistics for Hi-C datasets, as absolute reads (left) and relative reads (in %, right). ‘ds.accepted.intra’ are all intra-chromosomal reads used for all downstream analyses. (C) Distribution of TAD sizes and number of TAD calls per sample using hic-ratio TAD caller at 10kb bin resolution and the insulation score of 100kb windows. (D) Scatter plot of pair-wise comparisons of TAD activities (the sum of normalized Hi-C chromatin contacts inside the TAD in WT) between WT and KO thymocyte samples, showing well-conserved intra-TAD activity in KO thymocytes. (E) The Pearson correlation estimates computed between the counts for every pair of 10kb bins on chromosome 2 show that WT (control: upper right triangle) and KO (observed: lower left triangle) thymocytes have no difference in compartmentalization. The compartment A (red) and compartment B (blue). (F) The scaling plots displaying how the Hi-C contacts decrease as a function of genomic distance.
Figure 4 with 1 supplement
SATB1-bound sites identified by standard ChIP-seq at regulatory regions are SATB1 dependent.
SATB1-binding profiles in immature thymocytes determined by urea ChIP-seq (Urea) and standard ChIP-seq (Std) covering three loci at Rag1/Rag2 (top) Foxp3 (middle), and Runx3 (bottom) are shown. For each of the three loci, the standard SATB1 ChIP-seq generates peaks in Satb1+/+ (WT) thymocytes (track 3), but not in Satb1-/- (KO) thymocytes (tracks 9 for Rag 1/2 and Runx3 and tracks 11 for Foxp3). Input chromatin for standard ChIP-seq in these regions did not produce any major peaks (track 10 in Rag1/Rag2 and Runx3 and track 12 in Foxp3). The SATB1 peaks from standard ChIP-seq in Rag1/Rag2 and Runx3 loci largely overlap with enhancers (marked by H3K4me1 and H3K27ac). At the Foxp3 locus in immature thymocytes, SATB1 peaks (track 3) appear in a region marked by low levels of H3K27ac and H3Kme1 (tracks 4 and 5) where super-enhancer is established upon differentiation of thymocytes into Treg cells (tracks 6 and 7; Kitagawa et al., 2017). SATB1-bound peaks produced by urea ChIP-seq (track 2) are consistently located in distinct positions from those peaks obtained by standard ChIP-seq in these gene loci. Urea ChIP-seq did not generate peaks in KO thymocytes with anti-SATB1 antibody, and input chromatin also did not produce any peaks (tracks 7 and 8 for Rag1/Rag2 and Runx3, and track 9 and 10 for Foxp3). H3K27ac and H3Kme1 data (tracks 4 and 5) are from Encode, generated by Bing Ren’s laboratory at LICR, and data for Treg shown in (tracks 6 and 7) are from Kitagawa (Kitagawa et al., 2017).
Figure 4—figure supplement 1
Standard ChIP-seq for SATB1 produces non-specific peaks in Satb1-/- thymocytes.
(A) Urea ChIP-seq (Urea) and std ChIP-seq (Std) profiles for SATB1 and input chromatin in a randomly chosen, 3.12 Mb region in chromosome 17 show appearance of some peaks in input chromatin from std ChIP-seq that match with peaks for SATB1 in std ChIP-seq (top). For Satb1-/- thymocytes (KO), using either anti-SATB1 antibody 1583 (rabbit polyclonal, SATB1-1) or rabbit monoclonal ab109122 (SATB1-2), urea and std ChIP-seq experiments for SATB1 were performed. With std ChIP-seq, multiple peaks were generated in KO thymocytes in the similar regions observed in WT thymocytes (panel A track 7 versus 9 and 10), while urea ChIP-seq produced only a few peaks (panel A top, track 2 versus 4 and 5). A zoomed-in view of the blue-highlighted SATB1-clustered regions (bottom) shows that in standard ChIP-seq, multiple peaks in KO thymocytes co-mapped with peaks in WT thymocytes, while others did not (panel A bottom, track 7 versus 9 and 10). (B) Another randomly chosen 3.45 Mb region in X chromosome (panel B top) and its zoom-in view (panel B bottom) shows high incidence of std ChIP-seq peaks in KO thymocytes co-mapping with std ChIP-seq peaks in WT thymocytes (tracks 7 versus 9 and 10).
Figure 5 with 4 supplements
SATB1 mediates dense chromatin interactions over Rag1/2-containing gene-rich region.
(A) Chromatin interactions detected by urea 4C-seq using a SATB1-bound BUR (BUR-1) and another site (BUR-2) as baits. These baits are located near the border of a gene-poor region and a gene-rich region containing SATB1-regulated Rag1 and Rag2 genes (pink vertical bar with arrowhead). BUR-2 was found to be one of the interacting sites of BUR-1. Therefore, it was used as a reciprocal control for BUR-1 to check the reproducibility of BUR-1 interactions. We used Satb1+/+ (WT) and Satb1-/- (KO) thymocytes from 2 weeks old mice for urea 4C-seq. BUR-1 and BUR-2 interact with many sites within the ~5.8 Mb gene-rich region, containing Rag1 and Rag2 (tracks WT-BUR1 and WT-BUR2). These interactions were greatly reduced upon SATB1 deletion (track KO-BUR1). (B) A zoom-in view, focusing on the Rag1 and Rag2 region, shows that BUR-1 interacts extensively over this region in WT thymocytes (shown by parabolas). Such interactions were virtually diminished in the absence of SATB1 (KO-BUR1 and KO-BUR2 tracks). The pink vertical bars with arrowheads indicate the positions of the BUR-1 and BUR-2 bait primers. Each of these primer sequences is located at the end of the HindIII fragment containing the primer. These HindIII fragments are marked by thick purple bars adjacent to pink arrowheads pointing to primer positions. The map of HindIII fragments is shown for interacting regions (track HindIII sites). BUR-1 and BUR-2, along with other BURs bound by SATB1 (as confirmed by SATB1 urea ChIP-seq peaks and the BUR reference) that interact with BUR-1 or BUR-2 are marked by small red stars in the BUR track. Note: Reads to the HindIII fragment immediately adjacent to each of the bait primers (BUR-1 and BURs) were removed as they comprised more than 2% of the total reads, typically derived from re-ligation of digested chromatin fragments to their original neighboring sequences and/or from a small undigested chromatin fraction.
Figure 5—figure supplement 1
Urea 4C-seq protocol.
Starting with urea-ultracentrifugation purified formaldehyde crosslinked chromatin: (1) A bait sequence is designed adjacent to a HindIII site of a HindIII–HindIII fragment containing SATB1 bound site (e.g. BUR-1). (2) Ligation is performed to ligate the original SATB1-bound fragment (bait) with other fragments whose close proximity was fixed by formaldehyde at the time of crosslinking and presumably retained after urea purification. The fixed chromatin structure with proximity is illustrated by pink shade. (3) Chromatin is decrosslinked and purified. (4) Ligated genomic DNA fragments are digested with HaeIII (secondary restriction enzyme). (5) A Linker fragment containing an Xho1 site and biotin labeled on one strand is blunt-end ligated to HaeIII sites of the ligated genomic DNA fragments shown in step 4 to generate A, B, C, D double-stranded fragments. The Xho1 sites are indicated by red arrowheads. (6) The ligated products are digested with Xho1. (7) Biotin-labeled double-stranded DNA (B, C, and D) is captured by Streptavidin-Dynabeads. (8) The beads are treated with NaOH to convert DNA to single-strand DNA. This will result in dissociation and elution of non-biotinylated single-strand DNA (derived from B and C) from the Dynabeads. (9) Using a specific primer including the HindIII of the bait sequence at the end and another primer from the Linker, captured DNA fragments are PCR amplified. (10) A control experiment is performed to confirm that Linker primer alone does not generate any amplified products. Once this is confirmed, the experiment is expected to contain minimum background signals from non-specific sequences.
Figure 5—figure supplement 2
Long-range chromatin interactions from BUR-1 traverse TADs.
BUR-1 interactions determined by urea 4C-seq for wild type (WT) and SATB1-KO thymocytes cover the entire 5.75 Mb gene-rich region and these interactions bypass multiple small TADs revealed by the Hi-C heatmap (mm10) generated in the same region. Dotted line indicates the position of BUR-1.
Figure 5—figure supplement 3
Long-distance interactions covering distal gene-rich regions by BUR-1.
(A) A wide view (44.61 Mb) covering distal gene-rich regions shows BUR-1 (red bracket) frequently interacts with distal gene-rich DNase 1 hypersensitive (HS) regions including clusters of H3Kme1 and H3K27a (indicated by blue horizontal bars). DNase 1 HS regions, which indicate highly accessible chromatin (or ‘open’ chromatin). These interactions were greatly reduced in Satb1-/- (KO) thymocytes. A gene-rich region (indicated by a black horizontal bar) that does not correspond to DNase 1 HS is enriched in olfactory receptor genes. Lamin B-DamID data shown is from Chen et al., 2018. H3Kme1 and H3K27ac data are from ENCODE (LICR) and DNase 1 HS data are from ENCODE (University of Washington). (B) SATB1 peaks identified by standard (Std) ChIPseq in this region are mostly valid and only detected in Satb1+/+ (WT) and not in Satb1-/- (KO) thymocytes, indicating that SATB1 is binding to these regions, presumably indirectly.
Figure 5—figure supplement 4
SATB1-dependent genes identified within the three gene-rich regions that interact with BUR-1.
Genes showing differential expression depending on SATB1 with adjusted p value (FDR)<0.05 are shown in red (SATB1 activated) and in blue (SATB1 repressed). The three gene-rich regions are accessible chromatin regions (enriched in DNase 1 hypersensitive sites) indicated by blue bars in Figure 5—figure supplement 3. RNA-seq data are from Zelenka et al., 2022.
Figure 6
SATB1 binds to BURs in a cell-type-dependent manner.
(A) SATB1-binding profiles in a ~2.4 Mb region in chromosome 6 containing Cd4 in a gene-rich region from standard ChIP-seq (Std) (track 2) and urea ChIP-seq (Urea) (tracks 3–8). Urea ChIP-seq-derived SATB1 profiles in thymocytes (track 3), brain (track 4), and skin (track 5) show differences in peak numbers depending on cell type (see Supplementary files 1 and 2). This contrasts with mostly identical CTCF patterns in these cell types (tracks 11–13). (B) SATB1-binding profiles in a 406 kb region in chromosome 5 containing Gabra2 and Gabrg1, highly expressed in brain, also show much increased BUR binding in brain, compared to thymocytes and skin similar to A. In this region, there is no SATB1-binding site detected by standard ChIP-seq (track 2), and CTCF binding sites are mostly absent (track 9). (C) Percentages of SATB1 urea-ChIP-seq peaks in skin, thymocytes, and brain intersecting with the BUR reference map, indicating that the majority of the peaks are BURs (Supplementary file 1). (D) The percentage of BURs among all BURs identified in the BUR reference map that intersected with urea SATB1 ChIP-seq peaks identified in skin, thymocytes, and brain. DNase1 HS data are from ENCODE (UW), the CTCF-binding profile and H3K27ac data from standard ChIP-seq are from ENCODE (LICR).
Figure 7 with 4 supplements
BURs largely co-map with LADs.
(A) The BUR distribution (BUR reference map, track 2) was compared against Lamin B1-DAM-ID sites (Chen et al., 2018) (track 1) and SATB1-binding sites derived from urea-ChIP-seq (Urea) (tracks 3 and 4) over an 8.97 Mb region in chromosome 5 containing neuronal genes, Gabrg1, Gabra2, Gabra4, and Gabrb1. In this region, co-mapping of BURs and Lamin B1-DAM-ID regions is confirmed. Among BURs, SATB1-bound BURs derived from urea ChIP-seq (Urea) show differences in the number of peaks depending on cell type (see Supplementary files 1 and 2). SATB1-binding sites derived from urea ChIP-seq avoid CTCF-binding sites, H3Kme1, H3K27ac sites (from Encode LICR). (B) Average Lamin B1 DamID signal (black dotted), standard ChIP signal for SATB1 (black) and urea ChIP for SATB1 (blue) signal over LADs (gray shaded) and flanking regions (inter-LAD sized at 10% of adjacent LAD). (C) Average Lamin B1 DamID signal (dotted black), BUR signal (red), and urea ChIP for CTCF (orange) signal over LADs (gray shaded) and flanking regions (inter-LAD sized at 10% of adjacent LAD). (D) Average BUR signal (red), urea ChIP for SATB1 (blue) signal, Lamin B1 DamID (black, dotted), H3K4me1 (light green), and H3K27ac (light orange) signals over a ±3 kb window centered at H3K4me1 peaks within LADs (LADs are gray shaded and DiPS that reside inside large LADs are unshaded, see text). (E) Average BUR signal (red), urea ChIP for SATB1 (blue) signal, H3K4me1 (light green) and H3K27ac (light orange) signals over a ±3 kb window centered at H3K4me1 peaks outside LADs. Relative distance, projection, and Jaccard tests all indicate strong correlation (p<0.05) between urea ChIP-seq peaks for SATB1 and LADs, between BURs and LADs, but no overlap (p<0.05) between urea ChIP-seq SATB1 and H3K27ac and H3K4me3 peaks. The results in B to E represent normalized average intensities of signals.
Figure 7—figure supplement 1
BURs and BUR-bound SATB1 largely co-map with LaminB1-DamID.
The BUR distribution assessed by the BUR reference map (tracks 2) was compared against Lamin B1-DamID (track 1) over a 47.4 Mbp region in chromosome 3. Lamin B1-DamID data are from Chen et al., 2018. The BUR distribution shows very similar overall distribution of LADs mapped by Lamin B1-DamID. BUR-binding frequency of SATB1 in thymocytes (track 3) is lower than that in brain (track 4). Distribution of BURs (track 2) and SATB1-binding regions determined by urea ChIP-seq (Urea) (track 3, 4, and 5) largely overlap with LADs (track 1). These regions mostly avoid DNase hypersensitive regions (HS)(track 10), which overlap with SATB1-binding sites determined by standard ChIP-seq (Std)(track 6), CTCF-binding sites (track 7), enhancer marks H3Kme1 and H3K27ac (tracks 8 and 9, respectively). Data for CTCF, H3Kme1, and H3K27ac are from ENCODE (LICR) and for DNase 1 hypersensitive sites (HS) is from ENCODE (University of Washington).
Figure 7—figure supplement 2
Some SATB1-bound BURs located in SATB1-dependent gene loci are outside of LADs.
SATB1-bound BURs shown in Figure 4 (indicated by black box) in the Rag1/Rag2, Foxp3, and Runx3 gene loci are found outside LADs mapped by LaminB1-DamID. These are close to H3Kme1 and H3K27ac sites. H3Kme1 and H3K27ac data are from ENCODE (LICR). Lamin B-DamID data shown is from Chen et al., 2018.
Figure 7—figure supplement 3
SATB1 occupancy relative to BURs, and BUR signal relative to SATB1-bound loci.
(Left) Heatmaps showing SATB1 ChIP-seq signal intensity centered on all BUR elements, stratified by lamina association (LAD vs interLAD). Signal is plotted within ±3 kb of each BUR center using 50 bp bins using EnrichedHeatmap package (v1.30.0). The line plots above the heatmaps display the average SATB1 signal across all regions. Only a subset of BURs exhibits strong SATB1 binding, consistent with selective occupancy. (Right) Heatmaps showing BUR signal intensity centered on SATB1-bound regions (from ChIP-seq peaks), also separated into LAD and iLAD groups. The vast majority of SATB1 binding events are positioned within BURs, as evidenced by sharp, centered BUR signal at nearly all SATB1 peaks. Line plots reflect the average BUR signal profile across all SATB1 sites in each domain class. BUR intensities are derived from in vitro SATB1 BUR-binding assays.
Figure 7—figure supplement 4
Interaction sites from BUR-1 or BUR-2 are mostly confined to the inter-LAD region.
The region containing BUR-1 and BUR-2 as baits is light gray shaded with a pink arrowhead. This region is near the border of a LAD and an inter-LAD region, shown by LADs identified by Lamin B-DamID. Interaction profiles from either BUR-1 and BUR-2 obtained in wild-type thymocytes (WT-BUR1 or WT-BUR2) are found in a region surrounded by LADs. These interactions are greatly reduced in Satb1-KO thymocytes (KO-BUR1). Many interaction sites are close to H3Kme1 and H3K27ac sites. H3Kme1 and H3K27ac data are from ENCODE (LICR). Lamin B-DamID data shown is from Chen et al., 2018.
Figure 8
A model for SATB1-mediated chromatin organization with direct and indirect binding of SATB1 with chromatin.
This model is based on the chromatin-binding profile of SATB1 obtained from urea ChIP-seq, which shows direct binding of SATB1 to BURs, and from standard ChIP-seq, which indicates presumably indirect binding of SATB1 to gene-rich, accessible chromatin regions. Additionally, the model incorporates chromatin interactions of selected SATB1-bound BURs detected by urea 4C-seq in this study. Once BURs are bound by SATB1, they are tightly anchored to the SATB1-rich nuclear substructure, which resists high salt extraction, as demonstrated in previous studies (Cai et al., 2003; de Belle et al., 1998). We showed that SATB1-bound BURs reside in discrete DNase 1-inaccessible chromatin, excluding enhancers and CTCF-bound sites, even in otherwise gene-rich accessible chromatin neighborhoods outside LADs. We propose that the direct binding of SATB1 to BURs within the SATB1-rich nuclear substructure is stable and forms a chromatin scaffold. This chromatin scaffold interacts dynamically with active gene-rich regions through indirect binding, creating functional chromatin complexes (or hubs) that regulate gene expression depending on the cell type. Future studies are needed to determine the potential role of soluble SATB1 proteins and other regulatory factors in these interaction events.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mouse) | Satb1fl/fl | This paper Generated by Kohwi’s lab; details are in Balamotis et al, manuscript in preparation | Satb1cKO | Maintained on a C57BL/6J background |
| Genetic reagent (Mouse) | Satb1fl/fl: Cd4cre | Kakugawa et al., 2017; Kitagawa et al., 2017 | Satb1fl/fl: Cd4cre | Maintained on a C57BL/6J background |
| Genetic reagent (Mouse) | Satb1-/- | Alvarez et al., 2000; Generated by Kohwi’s lab | Satb1KO | Maintained on a C57BL/6J background |
| Genetic reagent (Mouse) | Satb1+/+ | The Jackson Laboratory | WT | C57BL/6J Strain #:000664 RRID:IMSR_JAX:000664 |
| Antibody | Anti-CTCF (Rabbit polyclonal) | Active MOTIF | Catalog # 61311 | ChIP |
| Antibody | Anti-CTCF (Rabbit monoclonal) | Abcam | Catalog # Ab70303 | Western (1:1000) |
| Antibody | Anti-CTCF (Rabbit polyclonal) | Millipore | Catalog # 7–729 | ChIP Western (1:1000) |
| Antibody | Anti-RAD21 (Rabbit polyclonal) | ABclonal Science | Catalog # A18850 | Western (1:1000) |
| Antibody | Anti-SATB1 (Rabbit polyclonal) | Generated by Kohwi’s Lab | 1583D | ChIP (after SATB2 absorption) |
| Antibody | Anti-SATB1 (Rabbit monoclonal) | Abcam | Catalog # Ab109122 | ChIP Western (1:1000) |
| Antibody | Anti-Histone H3 (Rabbit polyclonal) | Abcam | Catalog # Ab1791 | Western (1:4000) |
| Chemical compound, drug; | Proteinase inhibitor; cOmplete Tablets | Roche | Catalog # 4693132001 | |
| Chemical compound, drug; | Urea | Sigma | Catalog # U5378-500G | |
| Other | RNase inhibitor | New England Biolabs | Catalog # M030L | |
| Other | RNaseA | ThermoFisher | Catalog # EN0531 | |
| Other | AmpliTaq Gold DNA polymerase | AppliedBiosystems | Catalog # 4311806 | |
| Other | Dynabeads Protein A (protein purification beads) | Invitrogen | Catalog # 10001D | |
| Other | Dynabeads Protein A/G (protein purification beads) | ThermoFisher | Catalog # 26,157 X | |
| Commercial assay or kit | Quick PCR purification kit | Invitrogen (Qiagen) | Catalog # K310001 | |
| Commercial assay or kit | Quick PCR purification kit | Macherey-Nagel (MN) | Catalog # 740609.25 | |
| Commercial assay or kit | TruPLEX DNA-seq kit | Rubicon Genomics | Catalog # QAM-150–001 | |
| Commercial assay or kit | NEBNext Ultra II DNA Library Prep Kit for Illumina | New England Biolab | Catalog # NEB #71035 L | |
| Commercial assay or kit | Arima HiC +kit | Arima Genomics | Catalog # A510008 | |
| Other | SPRIselect (DNA purification beads) | Beckman Coulter | Catalog # B23317 | |
| Sequence-based reagent | Linker top strand (Biotin modified) | This paper | Linker oligomer | aattcggtacctctagagat*at* ccgatcgctcgagaagctt *: Biotin modified 5’→3’ |
| Sequence-based reagent | Linker bottom strand | This paper | Linker oligomer | aagcttctcgagcgatcggatatc tctagaggtaccgaatt 5’→3’ |
| Sequence-based reagent | Illumina sequence-BUR-1-bait oligomer | This paper | Sequence primer | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-gaagggggtaggaaagaaagctt Capital letter: Illumina sequence 5’→3’ |
| Sequence-based reagent | Illumina sequence-BUR-2-bait oligomer | This paper | Sequence primer | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-cgactcattcctactgaagctt Capital letter: Illumina sequence 5’→3’ |
| Sequence-based reagent | Illumina sequence-linker oligomer | This paper | Sequence primer | CAAGCAGAAGACGGCATACGAGAT- (barcode, e.g. CGTGAT)-GTGACTGGAGTTC-gcgatcggatatctctagaggtaccgaattc Capital letter: Illumina sequence 5’→3’ |
| Sequence-based reagent | BUR-1-bait sequence oligomer: | This paper | Sequence primer | CTTTCCCTACACGAC-gaagggggtaggaaagaaagctt Capital letter: Illumina sequence 5’→3’ |
| Sequence-based reagent | BUR-2-bait sequence oligomer | This paper | Sequence primer | ACTCTTTCCCTACACGAC-cgactcattcctactgaagctt Capital letter: Illumina sequence 5’→3’ |
| Sequence-based reagent | Linker specific barcode oligomer | This paper | Sequence primer | gaattcggtacctctagagatatccgatcgc-GAACTCCAGTCAC Capital letter: Illumina sequence 5’→3’ |
| Sequence-based reagent | Satb1fl/fl mice genotyping validation CKO2SETF (forward) | This paper | PCR primer CKO2SETF | ACGCAAACAGAACCCACTG 5’→3’ |
| Sequence-based reagent | Satb1fl/fl mice genotyping validation CKO2SETR (reverse) | This paper | PCR primer CKO2SETR | ACCAGGCAGAAAAATCATTG 5’→3’ |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/105915/elife-105915-mdarchecklist1-v1.docx
-
Supplementary file 1
Intersection analysis of ChIP-seq samples.
- https://cdn.elifesciences.org/articles/105915/elife-105915-supp1-v1.xlsx
-
Supplementary file 2
ChIP-seq sample identification and peak number.
- https://cdn.elifesciences.org/articles/105915/elife-105915-supp2-v1.xlsx
-
Supplementary file 3
Intersection analysis of WT and KO ChIP-seq samples.
- https://cdn.elifesciences.org/articles/105915/elife-105915-supp3-v1.xlsx
-
Supplementary file 4
WT and KO ChIP-seq sample identification and total peak number.
- https://cdn.elifesciences.org/articles/105915/elife-105915-supp4-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Genome organization by SATB1 binding to base-unpairing regions (BURs) provides a scaffold for SATB1-regulated gene expression
eLife 14:RP105915.
https://doi.org/10.7554/eLife.105915.3
