C-terminal tagging, transmembrane domain hydrophobicity, and an ER retention motif influence the secretory trafficking of the inner nuclear membrane protein emerin
- Cardiovascular Research Institute, University of California, San Francisco, United States
- Department of Pharmaceutical Chemistry, University of California, San Francisco, United States
- Department of Physiology, University of California, San Francisco, United States
Figures
Figure 1
EMD ΔLEM does not traffic in U2OS cells, while the transmembrane domain (TMD) alone does.
(A) U2OS cells expressing mouse EMD-GFP and ΔLEM-GFP were induced with 1 µg/mL doxycycline for 24 hr, treated with 100 nM lysosome blocking agent bafilomycin A1 (BafA1) overnight, and fixed and stained for lysosome marker Lamp1. Scale bar, 10 µm. (B) Summary of EMD domains and truncation mutants. (C) EMD enriches at the inner nuclear membrane (INM) by binding to the nuclear lamina or exits the endoplasmic reticulum (ER) into the secretory pathway. Before reaching the lysosome, EMD transiently accesses the cell surface where lumenal GFP is exposed to anti-GFP antibody. (D) Example FACS plot of mouse WT vs ΔLEM surface labeling; fluorescent anti-IgG secondary antibody included as background control. Antibody signal is divided by total GFP+ signal to yield histograms on the right. (E) Quantification of the antibody:GFP ratio from 4 independent experiments, with error bars representing SD. * indicates adjusted p-value=0.0451 by one-way ANOVA with Šídák’s multiple comparisons test. (F) U2OS cells expressing mouse TMD-GFP (lumenal tag) or GFP-TMD (cytosolic tag) were treated overnight with BafA1, then fixed and stained with an anti-GFP antibody. (G) Example surface labeling FACS histogram of U2OS cells expressing WT, LEM-TMD-GFP, or TMD-GFP.
Figure 2 with 1 supplement
Emerin’s trafficking depends on its transmembrane domain (TMD), not on the LEM domain.
(A) Surface anti-GFP antibody:GFP histogram of human WT EMD, ΔLEM, and EMD with mouse cytochrome B5 TMD (EMDCyb5 TMD) chimera. (B) U2OS cells expressing mouse EMD-GFP and EMDCyb5 TMD-GFP were induced with 1 µg/mL doxycycline for 24 hr, treated with 100 nM lysosome blocking drug bafilomycin A1 (BafA1) overnight, and fixed and stained for lysosome marker Lamp1. Scale bars, 10 µm. (C) TMD mutation strategy. The TM alpha helix of human EMD was divided into N-terminal and C-terminal halves, and the aromatic residues in each half were mutated to alanine to generate mutants with similar ΔG-insertion values. For the full TMD mutant, all aromatic residues were mutated to alanine, yielding a predicted ΔG-insertion of –2.299. (D) Surface antibody:GFP FACS histogram and (E) quantification of the mutants diagrammed in (C). N=4 independent experiments. (F) Surface antibody:GFP FACS histogram and (G) quantification of mouse WT EMD, RA, ΔLEM, and ΔLEMΔQRRR truncation surface expression. N=4 independent experiments. (H) Summary of emerin constructs that do or do not traffic. (I) Western blot analysis of emerin constructs induced with 2 µg/mL doxycycline for 48 hr, then washed and incubated for an 18 hr chase. (J) Quantification of western blot band intensity from (I). GFP antibody signal after washout was divided by the respective unwashed condition to yield the fraction GFP remaining after doxycycline washout across three independent replicates. For all panels: *** indicates adjusted p-value<0.0005, * indicates p=0.0104. All p-values were obtained by one-way ANOVA with Šídák’s or Tukey’s multiple comparisons tests.
-
Figure 2—source data 1
Original files for WB displayed in Figure 2.
- https://cdn.elifesciences.org/articles/105937/elife-105937-fig2-data1-v1.zip
-
Figure 2—source data 2
PDF files of uncropped WB displayed in Figure 2, annotated bands and MW markers.
- https://cdn.elifesciences.org/articles/105937/elife-105937-fig2-data2-v1.zip
Figure 2—figure supplement 1
Emerin contains a long, hydrophobic transmembrane domain and a conserved RXR motif.
(A) Lengths and predicted ΔG-insertion values of endoplasmic reticulum (ER) protein cytochrome B5, plasma membrane (PM) protein syntaxin 3, and emerin inner nuclear membrane (INM) proteins emerin and Lap2β. (B) Single-pass human transmembrane proteins from Membranome database plotted by free energy of transfer into a lipid bilayer. Lines represent median; **** indicates p<0.0001 by one-way ANOVA with Tukey’s multiple comparisons test. (C) Transmembrane domain (TMD) length (by amino acid count) of the proteins in (B). ** indicates p=0.0028; **** indicates p<0.0001. (D) Protein sequence alignment of emerin’s LEM domain across species. Conserved LEM domain amino acid class indicated in blue. QRRR motif is conserved in mammals and is exposed in the ΔLEM construct. (E) FACS plots of WT EMD-GFP and TMD mutant expression upon dox induction. Fewer cells express C-TMDm and full TMDm, though topology of constructs that are expressed is not altered (see F). (F) Antibody accessibility upon differential permeabilization of U2OS cells expressing full TMDm. Cells were incubated with digitonin to permeabilize the plasma membrane, Triton X-100 to permeabilize all internal membranes, or left unpermeabilized, then stained with antibodies against emerin (cytosolic epitope) and GFP (lumenal epitope).
Figure 3 with 1 supplement
RXR motif limits transmembrane domain (TMD)-dependent trafficking of emerin and LAP2β without influencing COPI binding.
(A) Surface anti-GFP:GFP histogram and (B) quantification of indicated RA+ TMD mutant combinations. ** indicates p=0.0021. N=3 independent experiments. (C) Diagram of LAP2β domain structure and position of RXR motifs. APEX2 fusion contains no RXR motifs. (D) Antibody:GFP histogram and (E) quantification of the highest 25% GFP-expressing cells diagrammed in (C). RXRmut: LAP2β RXR1 mutated to AAA. * indicates p=0.0173; ** indicates p=0.0072. (F) Spectral counts of COPI proteins immunoprecipitated by WT FLAG-EMD normalized to negative control IP. Spectral counts of the mouse EMD bait and common contaminant filamin A (FLNA) plotted for comparison. N=2 independent experiments. (G) Spectral counts of proteins immunoprecipitated by FLAG-WT and FLAG-RA mouse EMD normalized to each respective bait. Dotted line represents equal co-immunoprecipitation with the two constructs. COPI proteins and endogenous human EMD highlighted in yellow and green, respectively. All p-values were obtained by one-way ANOVA with Šídák’s or Tukey’s multiple comparisons tests.
Figure 3—figure supplement 1
Controls for LAP2B trafficking and emerin immunoprecipitation experiments.
(A) GFP vs surface anti-GFP FACS plots of negative control anti-IgG, WT LAP2β/RXR1mut, and WT EMD/LAP2β APEX2-TMD. (B) Median anti-GFP antibody:GFP ratio of the highest 25% GFP-expressing cells in (A). (C) Western blot analysis of anti-FLAG immunoprecipitations. U2OS cells expressing no FLAG construct (neg), FLAG-WT mouse EMD, and FLAG-RA mutant were lysed and incubated with anti-FLAG magnetic beads. Equal volume equivalents were separated by SDS-PAGE and blotted with an anti-EMD antibody to visualize tagged and untagged EMD. (D) U2OS cells expressing FLAG-EMD were incubated with lysosome blocker bafilomycin A1 (BafA1) overnight, then fixed and permeabilized with 0.1% Triton X-100, 0.02% SDS, 10 mg/mL BSA in PBS. Cells were stained with anti-FLAG antibody to visualize relocalization during BafA1 treatment. Scale bars, 20 µm.
-
Figure 3—figure supplement 1—source data 1
Original files for WB in Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/105937/elife-105937-fig3-figsupp1-data1-v1.zip
-
Figure 3—figure supplement 1—source data 2
PDF files containing uncropped annotated WB for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/105937/elife-105937-fig3-figsupp1-data2-v1.zip
Figure 4 with 1 supplement
Safe harbor expression reveals that C-terminal GFP destabilizes emerin.
(A) Diagram of emerin integration into the AAVS1 locus. Landing pad BFP is exchanged for mCherry-P2A-emerin±GFP via Bxb1 and PhiC31 integrases. Integrases irreversibly recombine landing pad attP and donor attB sites into attR and attL sites. (B) Strategy to compare overexpressed emerin to knockout (KO) rescue. (C) Western blot analysis of WT and EMD KO dual integrase cassette exchange (DICE) hiPSCs expressing N- and C-terminally GFP-tagged emerin. Untagged endogenous EMD and GFP-tagged EMD are detected by the same anti-EMD antibody. (D) Anti-GFP surface labeling histogram and (E) quantification of C-terminally tagged emerin integrants from (B–C). Statistical significance was determined using one-way ANOVA with Šídák’s multiple comparisons test. N=3 independent experiments. (F) FACS plot and (G) quantification of steady-state GFP abundance. Data were normalized to the GFP-EMD signal in the EMD WT background. N=3 independent experiments. ** indicates p=0.0079 by two-way ANOVA with Tukey’s multiple comparisons test. (H) DICE landing pad WT, EMD KO, and KO re-integrated with untagged constructs were lifted, fixed, and stained with anti-EMD antibody. Fluorescence was quantified by flow cytometry and normalized to the WT DICE integrant. MFI, median fluorescence intensity of antibody signal. N=5 replicates over 4 independent experiments. **** indicates p<0.0001 by mixed effects analysis.
-
Figure 4—source data 1
Original files for WB displayed in Figure 4.
- https://cdn.elifesciences.org/articles/105937/elife-105937-fig4-data1-v1.zip
-
Figure 4—source data 2
PDF file containing uncropped annotated WB in Figure 4.
- https://cdn.elifesciences.org/articles/105937/elife-105937-fig4-data2-v1.zip
Figure 4—figure supplement 1
Differential trafficking behavior of tagged and untagged emerin.
(A) EMD knockout (KO) dual integrase cassette exchange (DICE) hiPSCs were integrated with GFP-tagged EMD constructs. Cells were treated with vehicle or lysosome blocker bafilomycin A1 (BafA1) overnight, then fixed and stained with anti-LAMP1 antibody. (B) U2OS cells expressing indicated constructs were induced with doxycycline for 4 hr (bottom panels) or left uninduced (top panels). Cells were then shifted to 10°C or continued incubation at 37°C for 2 hr. Cells were then fixed and stained for endogenous emerin (top panel) and Sec31a to mark ERES. (C) Pearson correlation coefficient was calculated between endogenous emerin or EMD-GFP and Sec31a. N=31–54 cells over 3 independent experiments. *** indicates p=0.0006 by one-way ANOVA with Tukey’s multiple comparisons test. (D) EMD KO DICE hiPSCs were integrated with untagged EMD WT, TMD mutant, or RA mutant. Cells were treated overnight with BafA1, then fixed and stained with anti-EMD antibody. Scale bars, 20 µm. (E) We mined a dataset of matched RNAseq and quantitative protein abundances across 29 human tissues to evaluate EMD transcript and protein abundances. EMD protein and transcript abundance are largely uncorrelated (R2~0), while, for comparison, the enzyme spleen tyrosine kinase (SYK) has well-correlated protein and RNA levels (R2=0.89).
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | EMD | NA | NCBI RefSeq:NM_000117.3 | |
| Gene (Homo sapiens) | Lap2B | NA | NCBI RefSeq:NM_001032283.3 | |
| Gene (Mus musculus) | EMD | NA | NCBI RefSeq:NM_007927.4 | |
| Gene (Mus musculus) | Cyb5a | NA | NCBI RefSeq:NM_025797.4 | |
| Cell line (human, female) | U2OS | UCSF Cell and Genome Engineering Core | ATCC:HTB-96 | |
| Cell line (human, male) | WTC-11 hiPSC | Berkeley Stem Cell Center | hPSCreg:UCSFi001-A | |
| Cell line (human, male) | AAVS1 DICE landing pad hiPSC+EMD KO | This paper | WTC-11 with single-copy landing pad at AAVS1 locus, EMD gene deletion | |
| Cell line (human, male) | AAVS1 DICE landing pad hiPSC | This paper | WTC-11 with single-copy landing pad at AAVS1 locus | |
| Transfected construct (human, DICE landing pad hiPSC) | EMD-GFP DICE donor | This paper | Uniprot ID: P50402; pJM358 | Stable single-copy integration of EMD WT (C-terminal tag) |
| Transfected construct (human, DICE landing pad hiPSC) | GFP-EMD DICE donor | This paper | Uniprot ID: P50402; pJM417 | Stable single-copy integration of EMD WT (N-terminal tag) |
| Transfected construct (human, DICE landing pad hiPSC) | RA-GFP DICE donor | This paper | Uniprot ID: P50402; pJM415 | Stable single-copy integration of EMD mutant residues 44–47→AAAA (C-terminal tag) |
| Transfected construct (human, DICE landing pad hiPSC) | GFP-RA DICE donor | This paper | Uniprot ID: P50402; pJM418 | Stable single-copy integration of EMD mutant residues 44–47→AAAA (N-terminal tag) |
| Transfected construct (human, DICE landing pad hiPSC) | TMDm-GFP DICE donor | This paper | Uniprot ID: P50402; pJM416 | Stable single-copy integration of EMD mutant W226A, F232A, F235A, F240A, F241A, Y243A (C-terminal tag) |
| Transfected construct (human, DICE landing pad hiPSC) | GFP-TMDm DICE donor | This paper | Uniprot ID: P50402; pJM419 | Stable single-copy integration of EMD mutant W226A, F232A, F235A, F240A, F241A, Y243A (N-terminal tag) |
| Transfected construct (human, DICE landing pad hiPSC) | Untagged EMD DICE donor | This paper | Uniprot ID: P50402; pJM401 | Stable single-copy integration of EMD WT |
| Transfected construct (human, DICE landing pad hiPSC) | Untagged RA DICE donor | This paper | Uniprot ID: P50402; pJM411 | Stable single-copy integration of EMD mutant |
| Transfected construct (human, DICE landing pad hiPSC) | Untagged TMDm DICE donor | This paper | Uniprot ID: P50402; pJM412 | Stable single-copy integration of EMD mutant W226A, F232A, F235A, F240A, F241A, Y243A |
| Transfected construct (human, U2OS) | XLone EMD-GFP | This paper | Uniprot ID: P50402; pJM225 | PiggyBac vector for stable expression of hEMD WT |
| Transfected construct (human, U2OS) | XLone RA-GFP | This paper | Uniprot ID: P50402; pJM271 | PiggyBac vector for stable expression of EMD 47–50→AAAA |
| Transfected construct (human, U2OS) | XLone ΔLEM-GFP | This paper | Uniprot ID: P50402; pJM272 | PiggyBac vector for stable expression of EMD Δ1–43 |
| Transfected construct (mouse, U2OS) | XLone TMD-GFP | This paper | Uniprot ID: P50402; pJM217 | PiggyBac vector for stable expression of mEMD 212–259 |
| Transfected construct (mouse, U2OS) | XLone GFP-TMD | This paper | Uniprot ID: P50402; pJM222 | PiggyBac vector for stable expression of mEMD 212–259 |
| Transfected construct (human, U2OS) | XLone N-TMDm-GFP | This paper | Uniprot ID: P50402; pJM328 | PiggyBac vector for stable expression of EMD W226A, F232A, F235A |
| Transfected construct (human, U2OS) | XLone C-TMDm-GFP | This paper | Uniprot ID: P50402; pJM330 | PiggyBac vector for stable expression of EMD F240A, F241A, Y243A |
| Transfected construct (human, U2OS) | XLone TMDm-GFP | This paper | Uniprot ID: P50402; pJM331 | PiggyBac vector for stable expression of EMD W226A, F232A, F235A, F240A, F241A, Y243A |
| Transfected construct (human, U2OS) | XLone N-TMDm-GFP+RA | This paper | Uniprot ID: P50402; pJM355 | PiggyBac vector for stable expression of EMD W226A, F232A, F235A, and 47-50AAAA |
| Transfected construct (human, U2OS) | XLone C-TMDm-GFP+RA | This paper | Uniprot ID: P50402; pJM356 | PiggyBac vector for stable expression of EMD F240A, F241A, Y243A, and 47-50AAAA |
| Transfected construct (human, U2OS) | XLone TMDm-GFP+RA | This paper | Uniprot ID: P50402; pJM357 | PiggyBac vector for stable expression of EMD W226A, F232A, F235A, F240A, F241A, Y243A, and 47-50AAAA |
| Transfected construct (human, U2OS) | XLone EMD+Cyb5 TMD-GFP | This paper | Uniprot ID: P50402; pJM273 | PiggyBac vector for stable expression |
| Transfected construct (human, U2OS) | XLone LAP2B-GFP | This paper | Uniprot ID: P42167; pJM326 | PiggyBac vector for stable expression of LAP2B WT |
| Transfected construct (human, U2OS) | XLone LAP2B RxR1-GFP | This paper | Uniprot ID: P42167; pJM333 | PiggyBac vector for stable expression of LAP2B 48–50 →AAA |
| Transfected construct (human, U2OS) | XLone APEX2-LAP2B TMD-GFP | This paper | Uniprot ID: P42167 (LAP2B); pJM312 | PiggyBac vector for stable expression of APEX2+LAP2B 281–454 |
| Transfected construct (mouse, U2OS) | XLone EMD-GFP | This paper | Uniprot ID: O08579; AB_E00175 | PiggyBac vector for stable expression of mEMD WT |
| Transfected construct (mouse, U2OS) | XLone RA-GFP | This paper | Uniprot ID: O08579; pJM228 | PiggyBac vector for stable expression of mEMD 47–50 →AAAA |
| Transfected construct (mouse, U2OS) | XLone DLEM-GFP | This paper | Uniprot ID: O08579; pJM202 | PiggyBac vector for stable expression of mEMD delta 1–43 |
| Transfected construct (mouse, U2OS) | XLone EMD+Cyb5 TMD-GFP | This paper | Uniprot ID: O08579 (EMD); Uniprot ID:P56395 (Cyb5); pJM214 | PiggyBac vector for stable expression of mEMD 1–225+Cyb5 95–134 |
| Transfected construct (mouse, U2OS) | XLone DLEMDQRRR-GFP | This paper | Uniprot ID: O08579; pJM227 | PiggyBac vector for stable expression of mEMD delta 1–47 |
| Transfected construct (mouse, U2OS) | CMV-FLAG-EMD | This paper | Uniprot ID: O08579; pJM244 | Constitutive stable expression of FLAG-EMD |
| Transfected construct (mouse, U2OS) | CMV-FLAG-RA | This paper | Uniprot ID: O08579; pJM258 | Constitutive stable expression of FLAG-mEMD 47-50AAAA |
| Antibody | Anti-EMD rabbit polyclonal | ProteinTech | 10351-1-AP | WB: 1:2000, IF: 1:250 |
| Antibody | Rabbit polyclonal anti-GFP | ChromoTek | PABG1 | IF: 1:1000 for selective permeabilization assay |
| Antibody | Anti-GFP Alexa Fluor 647 | BioLegend | FM264G | Surface staining for flow cytometry: 1:20 |
| Antibody | Anti-rabbit IgG Alexa Fluor 647 | Thermo Fisher | A27040 | Anti-IgG surface FACS control: 1:200 |
| Antibody | Mouse monoclonal anti-FLAG | Sigma-Aldrich | F1804 | IF (1:1000), WB (1:1000) |
| Antibody | Rabbit polyclonal anti-LAMP1 | Abcam | ab24170 | IF (1:250) |
| Antibody | Mouse monoclonal anti-Sec31A | BD | 612350 | IF (1:500) |
| Antibody | Mouse monoclonal anti-FLAG beads | Sigma-Aldrich | M8823 | 40 µL per immunoprecipitation |
| Recombinant DNA reagent (plasmid) | Xlone | Addgene | 96930 | Gift from Xiaojun Lian |
| Recombinant DNA reagent (plasmid) | DICE landing pad HDR template | This paper | pJM313 | AAVS1 attP-PGK-TK-P2A-TagBFP-attP |
| Recombinant DNA reagent (plasmid) | Dual integrase expression vector | Other | pEN476 | CAGGS-BxbI-P2A-PhiC31 gift from Dr. Elphege Nora |
| Recombinant DNA reagent (plasmid) | PiggyBac Transposase | System Biosciences | PB200A_1 | |
| Sequence-based reagent | 5' EMD guide RNA | Synthego | 11400580 | ACAGAUUGGCUAGCGGCAGG |
| Sequence-based reagent | 3' EMD guide RNA | Synthego | 11400580 | ACAUGGGAGAAAAGCUCCAA |
| Sequence-based reagent | AAVS1 guide RNA | Synthego | 11400580 | accaauccugucccuag |
| Peptide, recombinant protein | Benzonase | EMD-Millipore | 70664-10KUN | 1:1000 in lysis buffer |
| Peptide, recombinant protein | pyogenes WT Cas9-NLS, purified | Berkeley QB3 MacroLab | 2 µg/12.5 pmol per 100 µL reaction | |
| Peptide, recombinant protein | 3x FLAG peptide | MedChem Express | HY-P0319A | FLAG elution during immunoprecipitation |
| Commercial assay or kit | PreOmics iST kit | PreOmics | P.O.00027 | MS sample prep |
| Commercial assay or kit | NEB Site-Directed Mutagenesis Kit | New England Biolabs | E0554 | Site-directed mutagenesis |
| Commercial assay or kit | NEB HiFi DNA Assembly Kit | New England Biolabs | E5520 | High-efficiency DNA assembly |
| Commercial assay or kit | MMLV reverse transcriptase | New England Biolabs | M0253 | cDNA generation |
| Commercial assay or kit | ZymoPURE II Midiprep Kit | Zymo Research | D4202 | High-purity plasmid preparation |
| Chemical compound, drug | Blasticidin | Research Products International | B12150-0.1 | 5 µg/mL for U2OS selection |
| Chemical compound, drug | G418 (Geneticin) | Fisher Scientific | 501363278 | 400 µg/mL (U2OS selection), 200 µg/mL (U2OS maintenance) |
| Chemical compound, drug | Doxycycline | Sigma-Aldrich | D9891 | Inducible expression; 1–2 µg/mL |
| Chemical compound, drug | Bafilomycin A1 | Sigma-Aldrich | B1793 | Lysosome blocking agent; 100 nM |
| Chemical compound, drug | Puromycin | Millipore-Sigma | 540411-25mg | 0.25 µg/mL for hiPSC selection |
| Software, algorithm | Fiji | https://imagej.net | Image and WB analysis | |
| Software, algorithm | FlowJo | https://www.flowjo.com/ | Flow cytometry analysis | |
| Software, algorithm | Nikon Elements | https://www.microscope.healthcare.nikon.com/products/software/nis-elements | Image acquisition | |
| Software, algorithm | GraphPad Prism | https://www.graphpad.com | Statistical tests | |
| Software, algorithm | Jupyter Lab | https://jupyter.org/ | Analysis and plotting of MS data | |
| Other | McCoy’s 5A Medium | Thermo Fisher | 16600082 | Culture medium for U2OS cells |
| Other | mTeSR+Medium | StemCell Technologies | 85850 | Culture medium for WTC-11 hiPSCs |
| Other | ReLeSR | StemCell Technologies | 100-0483 | Clump passaging of hiPSCs |
| Other | ROCK inhibitor | Selleck Chemicals | 101763-964 | 10 µM |
| Other | Accutase | Fisher Scientific | NC9464543 | Single-cell passaging of hiPSCs |
| Other | Matrigel | Corning | 354277 | Coating for hiPSC culture vessels |
| Other | Hoechst 33342 | Tocris Bioscience | 5117 | Used at 10 µg/mL |
| Other | Protease inhibitor cocktail | Sigma-Aldrich | P8340 | |
| Other | PhosSTOP phosphatase inhibitor | Roche | 4906845001 | |
| Other | Lipofectamine 2000 | Invitrogen | 11668019 |
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
C-terminal tagging, transmembrane domain hydrophobicity, and an ER retention motif influence the secretory trafficking of the inner nuclear membrane protein emerin
eLife 14:RP105937.
https://doi.org/10.7554/eLife.105937.3
