Aging-associated increase of GATA4 levels in articular cartilage is linked to impaired regenerative capacity of chondrocytes and osteoarthritis
- Department of Orthopaedic Surgery, University of Pittsburgh School of Medicine, United States
- Department of Bioengineering, University of Pittsburgh Swanson School of Engineering, United States
- Xiangya Hospital Central South University, China
- Department of Biological Sciences, University of Pittsburgh Kenneth P. Dietrich School of Arts & Sciences, United States
- Department of Pharmacology and Chemical Biology, University of Pittsburgh School of Medicine, United States
- Organ Pathobiology and Therapeutics Institute, University of Pittsburgh School of Medicine, United States
- Department of Biomedical Engineering, Vanderbilt University, United States
- Bethel Family Musculoskeletal Research Center (BMRC), University of Pittsburgh School of Medicine, United States
Figures
Figure 1 with 3 supplements
GATA4 is predicted to regulate chondrocyte aging.
(A) Healthy chondrocytes were isolated from knee joint cartilage from young and old donors without osteoarthritis (assessed by experienced surgeons). P0 cells were used for RNA sequencing analysis. (B) Volcano plot demonstrating 303 upregulated and 163 downregulated genes in old chondrocytes when compared to young cells. (C) Top 50 genes that are significantly differently expressed in young and old chondrocytes. (D) Activation z-score of top 10 transcription regulators that are activated (positive) or inhibited (negative) in aged versus young chondrocytes. A comprehensive list of gene names can be found in Appendix 1—table 3. (E) Ingenuity Pathway Analysis (IPA) of young versus old cells. The gray bars indicate that no activity pattern is identified in IPA despite the highly significant association of the genes within the pathway. Orange, positive z-score; white, zero z-score. OBs = osteoblasts; OCs = osteoclasts. (F) GATA4 IHC of healthy human cartilage tissue from young and aged donors. Bar = 50 µm. (G) Relative protein levels of GATA4 in P1 chondrocytes from individual human donors were analyzed by western blot.
-
Figure 1—source data 1
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig1-data1-v1.zip
-
Figure 1—source data 2
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig1-data2-v1.zip
Figure 1—figure supplement 1
GATA4 IHC of healthy human cartilage tissue from three young (Y1, Y2, and Y3) and aged (O1, O2, and O3) donors.
Scale bar = 50 µm.
Figure 1—figure supplement 2
GATA4 IHC of healthy mouse cartilage tissue from young (left) and old (right) mice.
Scale bar = 50 µm.
Figure 1—figure supplement 3
Western blot to examine protein levels in chondrocytes treated with doxorubicin (100 nM) or vehicle control for 3 days.
-
Figure 1—figure supplement 3—source data 1
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig1-figsupp3-data1-v1.zip
-
Figure 1—figure supplement 3—source data 2
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig1-figsupp3-data2-v1.zip
Figure 2 with 3 supplements
Overexpressing GATA4 impairs the hyaline cartilage formation capacity of young chondrocytes.
(A) Timeline depicting the study. (B) IHC to assess GATA4 protein levels in young cells overexpressing GFP control or GATA4. Scale bar = 50 µm. (C) RT-qPCR analysis of GATA4 gene expression in two groups. (D) Western blot to measure GATA4 protein levels. (E) Safranin O staining and (F) collagen type II (COLII) IHC to examine the production of cartilage matrix. Scale bar = 50 µm. (G) RT-qPCR analysis of gene expression of cartilage matrix proteins aggrecan (ACAN) and collagen type II-α1 (COL2A1) and hypertrophy markers collagen type X-α1 (COL10A1) and Indian hedgehog (IHH). (H) RT-qPCR analysis of gene expression of proinflammatory cytokines, including interleukin (IL)6, IL8, and tumor necrosis factor-alpha (TNFA) (n = 6). (I) Concentrations of IL6, IL8, and chemokine (C–C motif) ligand 2 (CCL2) in condition medium (n = 3). (J) RT-qPCR analysis of relative gene expression of matrix-degrading enzymes, including matrix metalloproteinases (MMP) 1, 2, 3, 12, and 13, and a disintegrin and metalloproteinase (ADAMTS) 4 and 5 (n = 6). (K) MMP1 concentration in condition medium (n = 3). Student’s two-tailed t-test with Welch’s correction for standard deviation and a p-value of 0.05 was used for all statistical analysis. Created with BioRender.com.
-
Figure 2—source data 1
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig2-data1-v1.zip
-
Figure 2—source data 2
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig2-data2-v1.zip
Figure 2—figure supplement 1
Successful overexpression of GATA4 in chondrocytes.
(A) GATA4 overexpression of young, pooled chondrocytes in monolayer culture 48 hr after infection. The lentiviral control contained the EF1A promoter-driven expression of green fluorescent protein (GFP), and the GATA4 lentivirus contained the EF1A promoter-driven overexpression of GATA4 with dTomato fluorescent protein. Scale bar = 100 µm. (B) Western blot to measure GATA4 protein levels. (C) RT-qPCR analysis of relative gene expression of cartilage matrix proteins aggrecan (ACAN) and collagen type II-α1 (COL2A1), and hypertrophy markers collagen type X-α1 (COL10A1) and Indian hedgehog (IHH).
-
Figure 2—figure supplement 1—source data 1
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig2-figsupp1-data2-v1.zip
Figure 2—figure supplement 2
Safranin-O staining for pellets derived from young, individual chondrocyte (Y1–3) transduced with GFP control lentivirus or GATA4 lentivirus.
Pellets were cultured in chondrogenic medium for 7 days. Scale bar = 50 μm.
Figure 2—figure supplement 3
Western blot to examine MMP13 protein levels in pellets derived from two young chondrocyte lines (Y1 and Y2) overexpressing GFP control (GFP C) or GATA4.
-
Figure 2—figure supplement 3—source data 1
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig2-figsupp3-data1-v1.zip
-
Figure 2—figure supplement 3—source data 2
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig2-figsupp3-data2-v1.zip
Figure 3
GATA4 overexpression activates SMAD1/5.
(A) Schematic showing the experiment. Western blot to assess protein levels of phosphorylated SMAD1/5 (pSMAD1/5), phosphorylated SMAD2/3 (pSMAD2/3), and GATA4 in pellets derived from young (B) individual (Y1–3) or (C) pooled chondrocytes, which were infected with lentiviral vectors carrying GATA4 or control genes and then stimulated with (+) or without (−) TGFβ3 for 2 hr. Relative protein levels of (D) GATA4, (E) pSMAD1/5, and (F) pSMAD2/3 were semi-quantified using ImageJ (n = 3). (G) The ratio of pSMAD1/5 compared to pSMAD2/3 was also calculated. Statistics were conducted using one-way analysis of variance (ANOVA) with Dunnett’s post hoc analysis. Created with BioRender.com.
-
Figure 3—source data 1
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig3-data1-v1.zip
-
Figure 3—source data 2
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig3-data2-v1.zip
Figure 4 with 2 supplements
Influence of GATA4 knockdown on in vitro cartilage formation of old chondrocytes.
(A) Schematic showing the study. (B) Safranin O staining and (C) COLII IHC to examine the production of cartilage matrix in the scrambled control or GATA4 siRNA group. Scale bar = 50 µm. (D) RT-qPCR analysis of relative gene expression of cartilage matrix proteins ACAN and COL2A1 and hypertrophy marker COL10A1 (n = 6). (E) RT-qPCR analysis of relative gene expression of proinflammatory cytokines IL6 and IL8 (n = 6). (F) Concentrations of IL6, IL8, and chemokine (CCL2) in condition medium (n = 3). (G) The relative protein levels of pSMAD1/5, pSMAD2/3, and phosphorylated p65 (pP65) in two groups. (H) RT-qPCR analysis of relative gene expression of matrix-degrading enzymes, including MMP1, 2, 3, 12, and 13, and ADAMTS 4 and 5 (n = 6). (I) MMP1, 2, and 13 concentrations in condition medium (n = 3). Student’s two-tailed t-test with Welch’s correction for standard deviation and a p-value of 0.05 was used for all statistical analysis. Created with BioRender.com.
-
Figure 4—source data 1
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig4-data1-v1.zip
-
Figure 4—source data 2
Uncropped blots of Western blot membranes.
- https://cdn.elifesciences.org/articles/106224/elife-106224-fig4-data2-v1.zip
Figure 4—figure supplement 1
Assessment of GATA4 siRNAs in monolayer.
(A) Schematic of the four different GATA4 siRNAs with corresponding target sequences assessed for GATA4 knockdown in monolayer culture of old pooled chondrocytes. (B) RT-qPCR assessing GATA4 levels after siRNA treatment (n = 3). Created with BioRender.com.
Figure 4—figure supplement 2
Assessment of GATA4 small-molecule inhibitor, NSC140905.
Pooled old human chondrocytes were pelleted and treated with the chondrogenic medium with or without supplanting NSC140905 for 14 days. (A) RT-qPCR analysis of relative gene expression of matrix-degrading enzymes, including MMP1, 13 and ADAMTS 4 and 5 (n = 3). Student’s two-tailed t-test with Welch’s correction for standard deviation and a p-value of 0.05 was used for all statistical analysis. (B) Safranin-O/Fast green staining. Bar = 50 μM.
Figure 5 with 1 supplement
Gata4 overexpression in the knee joints accelerates OA progression in mice.
(A) Schematic of the study. Mice received one intra-articular injection of lentiviral vectors that carried mCherry or Gata4 gene 1 week before DMM surgery was performed. Knee joints were harvested 6 weeks post-surgery. Levels of Gata4 (B, C) and pP65 (D, E) were assessed with IHC (B, D), and the staining was semi-quantitated with ImageJ (C, E). Cartilage degradation was assessed with (F) Safranin O/fast green (FG) staining, and (G) OARSI score was calculated. (H) Knee hyperalgesia 6 weeks post-surgery. 507 g was the threshold baseline for non-surgery mice (dashed line). Student’s two-tailed t-test with Welch’s correction for standard deviation and a p-value of 0.05 was used for all statistical analysis. Created with BioRender. com.
Figure 5—figure supplement 1
Assessment of synovial inflammation.
(A) Hematoxylin and eosin (H&E) staining and (B) pP65 IHC to assess synovial inflammation in mice treated with lentiviral vectors carrying mCherry Control or Gata4. (C) pP65 IHC staining was also semi-quantitated.
Tables
Appendix 1—table 1
Information of chondrocyte donors.
| RNA sequencing | ||
|---|---|---|
| Age | Gender | Ascension number |
| 24 | Female | P0 |
| 36 | Female | P0 |
| 38 | Female | P0 |
| 70 | Female | P0 |
| 73 | Female | P0 |
| 74 | Female | P0 |
| Western blot | ||
| Age | Gender | Ascension number |
| 22 | Male | P0 |
| 26 | Male | P0 |
| 29 | Male | P0 |
| 69 | Male | P0 |
| 70 | Male | P0 |
| 73 | Female | P0 |
| Human cartilage tissue IHC | ||
| Age | Gender | Ascension number |
| 24 | Male | P0 |
| 25 | Female | P0 |
| 27 | Female | P0 |
| 33 | Male | P0 |
| 67 | Female | P0 |
| 76 | Female | P0 |
| 78–1 | Female | |
| 78–2 | Male | |
| Young chondrocyte pool | ||
| Age | Gender | Ascension number |
| 22 | Male | P3 |
| 29 | Male | P3 |
| 38 | Female | P3 |
| 42 | Female | P3 |
| P3 | ||
| P3 | ||
| Old chondrocyte pool #1 | ||
| Age | Gender | Ascension number |
| 66 | Male | P3 |
| 70 | Male | P3 |
| 73 | Female | P3 |
| Old chondrocyte pool #2 | ||
| Age | Gender | Ascension number |
| 66–1 | Male | P3 |
| 66–2 | Male | P3 |
| 70–1 | Male | P3 |
| 70–2 | Male | P3 |
| Monolayer young individual chondrocytes | ||
| Age | Gender | Ascension number |
| 29 | Male | P3 |
| 36 | Female | P3 |
| 38 | Female | P3 |
| Pellet young individual chondrocytes | ||
| Age | Gender | Ascension number |
| 21 | Male | P3 |
| 35 | Male | P3 |
| 38 | Female | P3 |
Appendix 1—table 2
Antibodies used for immunofluorescence (IF), immunohistochemistry (IHC), or western blot (WB).
| Antibody | Origin | Cat. No. | Species | Assay | Dilution |
|---|---|---|---|---|---|
| Anti-Human Collagen Type II | MP Biomedicals | SKU 0863171 | Mouse | IHC | 1:200 |
| Biotinylated Goat Anti-Rabbit IgG | Vector Laboratories | PK-6101 | Rabbit | IHC | 1:50 |
| Goat Anti-Rabbit IgG H&L (HRP) | Abcam | Ab6721 | Goat | WB | 1:5000 |
| GAPDH (D16H11) XP Rabbit mAb | Cell Signaling Technology | 5174s | Rabbit | WB | 1:2000 |
| Smad1 (D59D7) XP Rabbit mAb | Cell Signaling Technology | 6944s | Rabbit | WB | 1:500 |
| Anti-GATA4 antibody (ab84593)- Discontinued | Abcam | ab84593 | Rabbit | IHC/WB | 1:500 |
| GATA-4 (D3A3M) Rabbit mAb | Cell Signaling Technology | 369366s | Rabbit | IHC/WB | 1:1000 |
| Phospho-Smad1/5 (Ser463/465) (41D10) Rabbit mAb | Cell Signaling Technology | 9516s | Rabbit | WB | 1:500 |
| Phospho-Smad2 (Ser465/467) (138D4) Rabbit mAb | Cell Signaling Technology | 3108s | Rabbit | WB | 1:500 |
| Smad2/3 (D7G7) XP Rabbit mAb | Cell Signaling Technology | 8685s | Rabbit | WB | 1:500 |
| Anti-NF-kB p65 (phospho S536) antibody [EP2294Y] | Abcam | ab76302 | Rabbit | WB | 1:500 |
| Anti-NF-kB p65 antibody [E379] | Abcam | ab32536 | Rabbit | WB | 1:500 |
| Anti-p21 antibody [EPR362] – BSA and Azide free | Abcam | ab218311 | Rabbit | WB | 1:1000 |
| Phospho-Histone H2A.X (Ser139) (20E3) Rabbit mAb | Cell Signaling Technology | 9718s | Rabbit | WB | 1:500 |
Appendix 1—table 3
Full names of genes shown in Figure 1.
| Transcription regulator name | Acronym |
|---|---|
| Hypoxia-inducible factor 1-alpha | HIF1A |
| GATA-binding protein 4 | GATA4 |
| MAF bZIP transcription factor B | MAFB |
| Homeobox D10 | HOXD10 |
| CCAAT enhancer binding protein alpha | CEBPA |
| Forkhead box L2 | FOXL2 |
| Caudal type homeobox 2 | CDX2 |
| Early Growth Response 1 | EGR1 |
| Signal Transducer and Activator of Transcription 3 | STAT3 |
| Paired Box 1 | PAX1 |
| Sequestosome 1 | SQSTM1 |
| Myocardin Related Transcription Factor B | MRTFB |
| WW Domain Binding Protein 2 | WBP2 |
| Scleraxis bHLH Transcription Factor | SCX |
| Twist Family bHLH Transcription Factor 1 | TWIST1 |
| Myocyte Enhancer Factor 2D | MEF2D |
| Lysine Methyltransferase 2D | KMT2D |
| Achaete-scute Family bHLH Transcription Factor 1 | ASCL1 |
| Recombination Signal Binding Protein for Immunoglobulin kappa J region | RBPJ |
| SIX homeobox 1 | SIX1 |
| FERM domain containing 3 | FRMPD3 |
| Ceruloplasmin | CP |
| SPARC-related modular calcium binding 2 | SMOC2 |
| ATP-binding cassette subfamily A member 13 | ABCA13 |
| Inositol 1,4,5-triphosphate receptor type 1 | ITPR1 |
| NIM1 serine/threonine protein kinase | NIM1K |
| Fibroblast growth factor 13 | FGF13 |
| Ankyrin repeat domain 12 | ANKRD12 |
| GTP binding protein overexpressed in skeletal muscle | GEM |
| Erythroferrone | FAM132B |
| Pappalysin 1 | PAPPA |
| PPARG coactivator 1 alpha | PPARGC1A |
| Synaptotagmin like 2 | SYTL2 |
| Leucine rich repeat transmembrane neuronal 2 | LRRTM2 |
| G-protein-coupled receptor class C group 5 member B | GPRC5B |
| Polypeptide N-acetylgalactosaminyltransferase 15 | GALNT15 |
| Growth associated protein 43 | GAP43 |
| Fibroblast growth factor binding protein 1 | FGFBP1 |
| ATRX chromatin remodeler | ATRX |
| Protocadherin gamma subfamily B, 2 | PCDHGB2 |
| Calsyntenin 2 | CLSTN2 |
| Fibroblast growth factor-binding protein 2 | FGFBP2 |
| Desmocollin 2 | DSC2 |
| TNF receptor superfamily member 21 | TNFRSF21 |
| Kinesin family member 13B | KIF13B |
| Plexin A2 | PLXNA2 |
| Cysteine rich protein 2 | CRIP2 |
| Cysteine rich protein 1 | CRIP1 |
| KLF transcription factor 2 | KLF2 |
| Serum/glucocorticoid regulated kinase 1 | SGK1 |
| LIM zinc finger domain containing 2 | LIMS2 |
| Long intergenic non-protein coding RNA 1133 | LINC01133 |
| Adipogenesis regulatory factor | ADIRF |
| Ornithine decarboxylase 1 | ODC1 |
| Kazrin, periplakin interacting protein | KAZN |
| Chondroitin polymerizing factor | CHPF |
| RAB23, member RAS oncogene family | RAB23 |
| Alkaline phosphatase, biomineralization associated | ALPL |
| Signal transducer and activator of transcription 4 | STAT4 |
| G-protein-coupled receptor 1 | GPR1 |
| Spectrin alpha, non-erythrocytic 1 | SPTAN1 |
| Very low-density lipoprotein receptor | VLDLR |
| Fatty acid desaturase 3 | FADS3 |
| Cancer susceptibility candidate 4 | CASC4 |
| NAD(P)H quinone dehydrogenase 1 | NQO1 |
| Pyrroline-5-carboxylate reductase 1 | PYCR1 |
| ERBB receptor feedback inhibitor 1 | ERRFI1 |
| NmrA-like family domain containing 1 pseudogene | LOC344887 |
| Desumoylating isopeptidase 2 | DESI2 |
| Basonuclin zinc finger protein 1 | BNC1 |
Appendix 1—table 4
Primers for qRT-PCR.
| Gene | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| RPL13A | GCCATCGTGGCTAAACAGGTA | GTTGGTGTTCATCCGCTTGC |
| GATA4 | CAGTCTACGTGCCCACACC | TCCCGCCTGGCTCCAT |
| ACAN | AGTCACACCTGAGCAGCATC | AGTTCTCAAATTGCATGGGGTGTC |
| COL2A1 | GGATGGCTGCACGAAACATACCGG | CAAGAAGCAGACCGGCCCTATG |
| COL10A1 | CCCTCTTGTTAGTGCCAACC | AGATTCCAGTCCTTGGGTCA |
| IHH | AACTCGCTGGCTATCTCGGT | GCCCTCATAATGCAGGGACT |
| IL6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
| IL8 | TTTTGCCAAGGAGTGCTAAAGA | AACCCTCTGCACCCAGTTTTC |
| TNFA | CCTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
| MMP1 | AAAATTACACGCCAGATTTGCC | GGTGTGACATTACTCCAGAGTTG |
| MMP2 | GGTCACATCGCTCCAGACT | TACAGGATCATTGGCTACACACC |
| MMP3 | CGGTTCCGCCTGTCTCAAG | CGCCAAAAGTGCCTGTCTT |
| MMP12 | GGAATCCTAGCCCATGCTTTT | CATTACGGCCTTTGGATCACT |
| MMP13 | ACTGAGAGGCTCCGAGAAATG | GAACCCCGCATCTTGGCTT |
| ADAMTS4 | GAGGAGGAGATCGTGTTTCCA | CCAGCTCTAGTAGCAGCGTC |
| ADAMTS5 | GAACATCGACCAACTCTACTCCG | CAATGCCCACCGAACCATCT |
Appendix 1—table 5
Information of Luminex assay kit.
| Target molecule | Method | Catalog number and supplier |
|---|---|---|
| IL8 | Luminex assay | HAGP1MAG-12K, EMD Millipore |
| IL6, CCL2, MMP1, MMP2, MMP13 | Luminex assay | LXSAHM-18, R&D Systems |
Appendix 1—table 6
Comprehensive list of proteins assessed in LUMINEX.
| Target molecule | Catalog number and supplier |
|---|---|
| Interleukin 6 (IL6) | LXSAHM-18, R&D Systems |
| Interleukin 13 (IL13) | LXSAHM-18, R&D Systems |
| Matrix Metallopeptidase 3 (MMP3) | LXSAHM-18, R&D Systems |
| Periostin (OSF2) | LXSAHM-18, R&D Systems |
| Vascular Endothelial Growth Factor Receptor 2 (VEGFR2) | LXSAHM-18, R&D Systems |
| MMP8 | LXSAHM-18, R&D Systems |
| Adiponectin (AdipoQ) | LXSAHM-18, R&D Systems |
| Complement Factor D/Adipsin (CFD) | LXSAHM-18, R&D Systems |
| Ectonucleotide Pyrophosphatase/Phosphodiesterase 2 Autotaxin (ENPP2) | LXSAHM-18, R&D Systems |
| MMP2 | LXSAHM-18, R&D Systems |
| Osteopontin (OPN) | LXSAHM-18, R&D Systems |
| C–C motif ligand 2 (CCL2) | LXSAHM-18, R&D Systems |
| (C–X–C motif) ligand 1 (CXCL1) | LXSAHM-18, R&D Systems |
| IL1ra | LXSAHM-18, R&D Systems |
| MMP1 | LXSAHM-18, R&D Systems |
| MMP13 | LXSAHM-18, R&D Systems |
| Tissue Inhibitor of Metalloproteinase 1 (TIMP1) | HTMP1MAG-54K, EMD Millipore |
| TIMP2 | HTMP1MAG-54K, EMD Millipore |
| Angiopoietin 2 (Ang2) | HAGP1MAG-12K, EMD Millipore |
| Bone Morphogenic Protein 9 (BMP9) | HAGP1MAG-12K, EMD Millipore |
| Epidermal Growth Factor (EGF) | HAGP1MAG-12K, EMD Millipore |
| Endoglin (CD105) | HAGP1MAG-12K, EMD Millipore |
| Endothelin 1 (ET1) | HAGP1MAG-12K, EMD Millipore |
| Fibroblast Growth Factor 1 (FGF1) | HAGP1MAG-12K, EMD Millipore |
| FGF2 | HAGP1MAG-12K, EMD Millipore |
| Follistatin (FSH) | HAGP1MAG-12K, EMD Millipore |
| Granulocyte Colony-Stimulating Factor (GCSF) | HAGP1MAG-12K, EMD Millipore |
| Heparin-Binding EGF-like Growth Factor (HBEGF) | HAGP1MAG-12K, EMD Millipore |
| Hepatocyte Growth Factor (HGF) | HAGP1MAG-12K, EMD Millipore |
| IL8 | HAGP1MAG-12K, EMD Millipore |
| Leptin (LEP) | HAGP1MAG-12K, EMD Millipore |
| Placental Growth Factor (PLGF) | HAGP1MAG-12K, EMD Millipore |
| VEGFA | HAGP1MAG-12K, EMD Millipore |
| VEGFD | HAGP1MAG-12K, EMD Millipore |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Aging-associated increase of GATA4 levels in articular cartilage is linked to impaired regenerative capacity of chondrocytes and osteoarthritis
eLife 14:RP106224.
https://doi.org/10.7554/eLife.106224.4
