Genetic parallels in biomineralization of the calcareous sponge Sycon ciliatum and stony corals
- Department of Earth and Environmental Sciences, Paleontology and Geobiology, Ludwig Maximilians-Universität München, Germany
- Gene Center—Laboratory for Functional Genome Analysis, Ludwig-Maximilians-Universität München, Germany
- GeoBio-Center, Ludwig-Maximilians-Universität München, Germany
Figures
Figure 1
Skeletal organization and spicule formation in S. ciliatum.
(A) The S. ciliatum skeleton features specific spicule types in distinct body regions: parallel diactines in the oscular region (upper inset), radial tubes supported by triactines and tufted with diactines (lower inset), and the atrial skeleton composed of triactines and tetractines. (B) The upper oscular region shows increased spicule formation (calcein staining) in the growing zone of new radial tubes and around the osculum, where oscular diactines are predominantly produced (modified from Voigt et al., 2014). Scale bars: 0.5 mm. (C) Spicules are formed by sclerocytes, specialized cells controlling spicule formation. Diactine formation involves two sclerocytes, triactine formation six (f=founder cell, t=thickener cell).
Figure 2 with 2 supplements
Calcarin and galaxin predicted structures and occurrences in sponges and corals.
(A) Structural similarities in AlphaFold predictions of galaxins (A. millepora) and selected calcarins (S. ciliatum). (B) Beta-hairpins in Cal7 connected by disulfide bridges of di-cysteines. (C) Number of calcarins, galaxin-like, and galaxins transcripts in sponges and corals, assigned to orthogroups. Additional AlphaFold structure predictions of selected S. ciliatum calcarins and coral galaxin-like proteins are provided in Figure 2—figure supplements 1 and 2.
Figure 2—figure supplement 1
AlphaFold structure predictions of additional selected S. ciliatum calcarins.
Figure 2—figure supplement 2
AlphaFold predictions of galaxin-like proteins from octocorals and stony corals that fall in orthogroups with S. ciliatum calcarins.
Two octocoral galaxin-like proteins exhibit the same number of beta-hairpins as S. ciliatum calcarins Cal2, Cal4, and Cal6 (top left). In contrast, stony coral galaxin-like proteins belonging to the same orthogroups as S. ciliatum Cal12 or Cal14 display considerably more beta-hairpins than their calcareous sponge counterparts (top right, bottom). Notably, the galaxin-like proteins shown here were not detected in the skeletal matrix proteomes of the respective cnidarian species.
Figure 3 with 3 supplements
Expression of calcarins.
Insets indicate the location of the depicted view within the sponge body, where applicable. To improve accessibility for individuals with red/green color vision deficiency, original RGB channel colors (Figure 3—figure supplement 3) were modified to a cyan/magenta/blue color scheme. AF: autofluorescence; osc = osculum; rt: radial tubes; Spic: Spiculin (A–D) Cal1, Cal2, and Spiculin expression in a regenerated S. ciliatum at the asconoid juvenile stage. Scale bars = 50 µm. (A) Overview of the entire specimen, highlighting distinct gene expression with minimal co-expression in the apical half of the sponge. Arrow points to the ring of founder and thickener cells that form the oscular diactines. (B) Detailed view on the expression around the oscular region; Spiculin in thickener cells (apical), Cal2 in diactine founder cells (basal), and Cal1 in triactine/tetractine founder cells (f). (C) Sponge wall detail; Cal2 in diactine founder cells, Spiculin in thickener cells (arrow: one diactine thickener cell). (D) Triactine/tetractine founder cells expressing Cal1, thickener cells expressing Spiculin. (E) Cal1 expression in founder cells ceases as they transform into thickener cells, and Spiculin expression sets in. Cal1 continues to be expressed in actine-producing founder cells in triactines, but in the diactine actine-forming founder cell, it is replaced by Cal 2 expression in later stages. Scale bars; 10 µm. (F) Expression of Cal3 in founder cells and Spiculin in thickener cells attached to the preserved diactine (di) and triactine (tri) spicules (overlay with light microscopic image). Note how thickener cells thinly ensheath the spicule. Scale bar: 50 µm. (G) Cal7 expression in the founder cells of oscular diactines. Co-expression of Spiculin and Cal7 rarely occurs in transient stages of emerging thickener cells. Scale bar: 50 µm. (H) Early triactine stage with six founder cells expressing Cal7. Scale bar: 50 µm. (I) In later triactine formation stages, thickener cells no longer express Cal7. Scale bar: 50 µm. (J) Expression of Cal4 and Cal5 in thickener cells. Scale bar: 50 µm. (K) Cal6 and Spiculin expression in oscular region (osc: oscular opening) and expression at the distal end of radial tubes (rt) of the body wall. Scale bars = 100 µm, inset 20 µm. (L) Expression of Cal8 in founder cells and Spiculin in thickener cells of diactines at the end of radial tubes (left) and of a triactine (right).
Figure 3—figure supplement 1
Expression of biomineralization genes in radial tubes (rt).
(A) Overview of fluorescent signals in radial tubes. Inset in the top left shows bright-field view for orientation. Dotted boxes indicate the position of details in B–E. (B–E) Details with superimposed sketches to show the original position of dissolved spicules. Triactinin and Spiculin are co-expressed in thickener cells of triactines (B and C). Spiculin additionally occurs in thickener cells of diactines at the distal end of radial tubes (e.g. arrows in A). Cal1 is expressed in founder cells of both spicule types (B–E). Co-expression of Cal1 and Spiculin marks the transition stage from founder to thickener cell (arrows in D and E). Many Spiculin signals at the distal end of radial tubes are not associated with a Cal1 signal, suggesting that Cal1 expression in diactine founder cells ceases before spicule formation is complete (A). In contrast, Cal1 signal is detected in founder cells of late triactine stages (C). Cal1=Calcarin1, Tria = Triactinin, Spic = Spiculin, rt = radial tube. Scale bar: 100 µm. Images processed with large volume computational image clearing (LVCC).
Figure 3—figure supplement 2
Expression of Cal2 and Cal6.
(A) The radial tube’s distal end shows Cal2 expression in spherical sclerocytes closely associated with the choanoderm. Inset: View that shows the position of Cal2-expressing cells at the basal surface of the choanoderm inside the mesohyl (images processed with large volume computational image clearing [LVCC], channel colors changed to cyan/magenta/yellow as described in Appendix 1). (B–D) Similar expression patterns of Cal2 and Cal6 in distal radial tubes. (E) Expression of Cal6 and Spiculin around the oscular opening. (F) Atrial wall (no diactines) of the same individual lacks Cal6-expressing cells associated with triactine and tetractine thickener cells. AF: autofluorescence detected with the Leica TXR filter (approx. 590–650 nm), included to help distinguish true signal from background autofluorescence observed in the FITC channel (used for Spiculin detection). Cal: calcarin, choa: choanocytes, mes: mesohyl, pin: pinacocyte, rt = radial tube, Spic: Spiculin. Scale bars: 50 µm (A), 20 µm (B–D), 100 µm (E–F).
Figure 3—figure supplement 3
Version of Figure 3 with the original RGB channels of the fluorescent images (A–I and L).
Figure 4
Summary of expression changes of biomineralization genes in sclerocytes (expressing cells in blue).
In initial spicule formation stages, all sclerocytes act as founder cells. Genes with expression patterns described previously (Voigt et al., 2017; Voigt et al., 2014) are shown in gray.
Figure 5
Differential gene expression of 13 calcarins and other confirmed or candidate biomineralization genes.
(A) Osculum region vs sponge wall. (B) Changes in relative expression during whole-body regeneration. Scale bars: 100 µm.
Figure 6
Arrangements of biomineralization genes (dark blue) and related genes (lighter blue).
*Predicted nested genes not shown. (A) Calcarins (Cal) in S. ciliatum. (B) Galaxin (Glx) and Galaxin-like (Glx-l) proteins in the stony coral A. millepora. (C) Membrane-bound carbonic anhydrases (CA) in S. ciliatum.
Appendix 2—figure 1
Expression of skeletal organic matrix (SOM) proteins in cells of young S. pistillata polyps.
(A) Fourteen of the known SOM proteins (Peled et al., 2020) are specifically overexpressed in calicoblast metacells. Graph obtained from https://sebe-lab.shinyapps.io/Stylophora_cell_atlas/. (B) Normalized and scaled expression of 980 calicoblast cells show that several secreted SOM proteins are exclusively expressed by different calicoblast cells, suggesting a spatiotemporal expression regulation as observed in calcareous sponges.
Appendix 2—figure 2
Changes in module eigengene (ME) expression between low spicule formation and high spicule formation transcriptomes.
Each dot represents one RNA-seq library (low spicule formation: n = 17; high spicule formation: n = 13). Boxes indicate the interquartile range (IQR), whiskers extend to 1.5 × IQR, and the horizontal line marks the median. Most known biomineralization effector genes occur in MEmidnightblue.
Appendix 2—figure 3
Enriched biological process GO terms (Treemap from REVIGO) of genes in meta module MEmidnightblue.
Appendix 2—figure 4
Domain structure of the only glass sponge (Vazella pourtalesii) protein with a blast hit for a Galaxin query (Supplementary file 6).
Appendix 2—figure 5
Schematic overview of skeleton formation in stony corals (top) and calcareous sponges (bottom).
In stony corals, the skeleton is an extracellular exoskeleton deposited beneath the calicoblastic cell layer (the aboral epidermis), within a semi-isolated compartment known as the extracellular calcifying medium (ECM). Carbonic anhydrases in the cytosol and ECM catalyze the conversion of CO2 to HCO3⁻, supplying inorganic carbon for calcification. The AE-like SLC4γ transporter, localized to the apical membrane of calicoblastic cells, exports HCO3⁻ into the ECM. Ca2+ reaches the ECM via both paracellular and transcellular pathways. In the paracellular route, Ca2+ diffuses through septate junctions between calicoblastic cells. The transcellular route involves Ca2+ influx channels on the basolateral membrane and plasma membrane Ca2+-ATPases (PMCAs) on the apical membrane, which export Ca2+ into the ECM while simultaneously importing protons (H+). To maintain intracellular pH, H+ is extruded from calicoblastic cells via Na+/H+ exchangers (NHEs). In the ECM, Ca2+ and HCO3⁻ react to form calcium carbonate (CaCO3), the mineral phase of the skeleton. Calicoblastic cells also secrete skeletal organic matrix proteins (SOMPs), such as galaxin and galaxin-like proteins, into the ECM, where they likely modulate crystal nucleation and growth. In calcareous sponges, the skeleton consists of calcite spicules formed by sclerocytes located in the mesohyl. Each spicule develops within an extracellular calcifying space enclosed by at least two sclerocytes (e.g. in diactine formation), which are connected by septate junctions (SJ) that seal the compartment. Inside this space, the growing spicule is surrounded by an organic sheath. Carbonic anhydrases, including mitochondrial (e.g. S. ciliatum CA1) or cytosolic forms, catalyze the conversion of CO2 to HCO3⁻, providing inorganic carbon for calcification. Two sclerocyte-specific SLC4 family HCO3⁻ transporters, AE-like1 and NCBT-like1, mediate HCO3⁻ export into and import from the calcifying space, respectively (note that their apical and basolateral localization as depicted here is speculative). Ca2+ is thought to enter the calcifying space via the paracellular route through junctional spaces between sclerocytes. Components of a transcellular Ca2+ pathway have not yet been characterized. SOMPs, such as calcarins, are secreted into the calcifying space, where they likely influence the biomineralization and get incorporated into the calcite spicule.
Appendix 2—figure 6
Expression of skeletal organic matrix (SOM) proteins in adult S. pistillata corals.
(A) Most calicoblast metacells did not express known SOM proteins (Peled et al., 2020). Graph obtained from https://sebe-lab.shinyapps.io/Stylophora_cell_atlas/. (B) Normalized and scaled expression of the 14 SOM proteins specific to polyp calicoblasts (Appendix 2—figure 1) in 896 calicoblast cells of adult corals.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Sycon ciliatum) | Calcarin 1–17 (Cal1–17) | This study | De novo annotation of GenBank assembly GCA_964019385, available at https://zenodo.org/records/14755899, gene IDs provided in Supplementary file 7 | |
| Gene (Sycon ciliatum) | SciCarbonic anhydrase 1, Triactinin, Spiculin | Voigt et al., 2014; Voigt et al., 2017 | De novo annotation of GenBank assembly GCA_964019385, available at https://zenodo.org/records/14755899, gene IDs provided in Supplementary file 7 | |
| Biological sample (Sycon ciliatum) | DNA, RNA, tissue for in situ hybridization experiments | AWI Biologische Anstalt Helgoland, Germany | Living specimens were shipped to Munich, Germany | |
| Sequence-based reagent | PCR primers for generating probes for CISH | This study | PCR primers | Sequences of gene-specific primers for calcarin 1–8 are provided in Appendix 1—table 4 |
| Sequence-based reagent | HCR-FISH probe sets | Molecular Instruments | Probe sets consist of 20 pairs of probes per gene and were generated for Calcarin 1, Calcarin 2, Calcarin 3, Calcarin 7, Calcarin 8, Triactinin, Spiculin, SciCarbonic, andrase 1 by Molecular Instruments based on the de novo annotation of GenBank assembly GCA_964019385, available at https://zenodo.org/records/14755899, gene IDs provided in Supplementary file 7 | |
| Commercial assay or kit | RNA-Duet extraction kit | Zymo Research | Cat. # D7001 | Extraction of RNA |
| Commercial assay or kit | RNA 6000 Nano Kit | Agilent | Cat. # 5067-1511 | RNA extraction quality control |
| Commercial assay or kit | SENSE mRNA-Seq Library Prep Kit V2 | Lexogen | Cat. # 001.24 | Illumina library preparation |
| Commercial assay or kit | pCR4-TOPO cloning vector | Invitrogen | Cat. # K457502 | Used for probe generation in CISH |
| Commercial assay or kit | T3 polymerase | Promega | Cat. # P208C | Used for probe generation in CISH |
| Commercial assay or kit | T7 polymerase | Promega | Cat. # P207B | Used for probe generation in CISH |
| Commercial assay or kit | DIG RNA Labeling Mix | Roche | Cat. # 11277073910 | Used for generating DIG-labeled RNA probes |
| Commercial assay or kit | Fluorescein RNA Labeling Mix | Roche | Cat. # 11685619910 | Used for generating fluorescein-labeled RNA probes |
| Commercial assay or kit | NuPAGE 4–12% Bis-Tris Gel | Invitrogen | – | Preparation of proteins for mass spectrometry |
| Chemical compound, drug | NBT/BCIP Stock Solution | Roche | Cat. # 11681451001 | Substrate for CISH |
| Chemical compound, drug | FastRed Tablets | Roche | Cat. # 11496549001 | Substrate for CISH |
| Chemical compound, drug | EverBrite Hardset Mounting Medium | Biotum | Cat. # 23004 | Hardset antifade mounting medium with DAPI; used for mounting of tissue sections after HCR-FISH |
| Chemical compound, drug | Lysyl Endopeptidase (Lys-C), Mass Spectrometry Grade | FUJIFILM Wako Pure Chemical Corporation, USA | – | Used for in-gel digestion of proteins |
| Software, algorithm | Geneious | Kearse et al., 2012 | RRID:SCR_010519 | Used for mapping trimmed reads to Sycon transcriptome |
| Software, algorithm | Salmon | Patro et al., 2017 | RRID:SCR_017036, PMID:28263959 | Used for transcript quantification prior to DGE analysis |
| Software, algorithm | DESeq2 | Love et al., 2014 | RRID:SCR_015687, DOI: 10.18 129/B9.bio c.DESeq2 | Version 1.42.1; used for analysis of differential gene expression between body parts and regeneration stages |
| Software, algorithm | WGCNA | Langfelder and Horvath, 2008 | RRID:SCR_003302, PMID:19114008 | Version 1.72.5; WGCNA to identify gene modules associated with spicule formation |
| Software, algorithm | topGO | Alexa and Rahnenfuhrer, 2023 | RRID:SCR_014798, DOI: 10.18129/B9.bioc.topGO | Version 2.54.0; GO-term enrichment analysis for genes overexpressed in osculum region and genes included in the ‘midnightblue’ module (WGCNA result) |
| Software, algorithm | REVIGO | Supek et al., 2011 | RRID:SCR_005825, PMID:21789182 | Summarizing significantly enriched GO terms from GO analyses |
| Software, algorithm | TransPi | Rivera-Vicéns et al., 2022 | PMID:35119207 | Nextflow-based pipeline for transcriptome assembly and annotation; used to reassemble raw reads and predict protein sequences for OrthoFinder analysis |
| Software, algorithm | BLASTp | Camacho et al., 2009 | RRID:SCR_001010, PMID:20003500 | Used for homology search of galaxin-like proteins |
| Software, algorithm | OrthoFinder | Emms and Kelly, 2019 | RRID:SCR_017118, PMID:31727128 | Version 2.5.5; orthogroup identification |
| Software, algorithm | MASCOT | Matrix Science Limited, UK, Creasy et al., 1999 | RRID:SCR_014322, PMID:10612281 | Version 2.6.2; protein identification from LC-MS/MS spectra |
| Software, algorithm | Scaffold | Proteome Software Inc, Portland, USA | Version 5.01 | Available at : https://www.proteomesoftware.com/products/scaffold-5. Used for threshold filtering of identified proteins and visualization |
| Software, algorithm | Seurat | Hao et al., 2024 | RRID:SCR_016341, DOI: 10.32614/ CRAN.package.Seurat | Version 5.1.0 |
| Other | PepMap RSLC C18 | Thermo Scientific | EASY-Spray column | |
| Other | PepMap 100 C18 | Thermo Scientific | Trap columns |
Appendix 1—table 1
Accession numbers or RNA-seq data generated for the body part dataset (BioProject PRJEB78728).
| Body part | Replicate specimen | Sample name | Accession |
|---|---|---|---|
| Osculum region | 1 | GW30948_OSC | ERR13472820 |
| Inner sponge wall | 1 | GW30948_IN | ERR13472821 |
| Outer sponge wall | 1 | GW30948_OUT | ERR13472822 |
| Osculum region | 3 | GW30951_OSC | ERR13472823 |
| Inner sponge wall | 3 | GW30951_IN | ERR13472824 |
| Outer sponge wall | 3 | GW30951_OUT | ERR13472825 |
| Osculum region | 4 | GW30956_OSC | ERR13472826 |
| Inner sponge wall | 4 | GW30956_IN | ERR13472827 |
| Outer sponge wall | 4 | GW30956_OUT | ERR13472828 |
| Osculum region | 2 | GW30957_OSC | ERR13472829 |
| Inner sponge wall | 2 | GW30957_IN | ERR13472830 |
| Outer sponge wall | 2 | GW30957_OUT | ERR13472831 |
| Osculum region | 5 | GW30959_OSC | ERR13472832 |
| Inner sponge wall | 5 | GW30959_IN | ERR13472833 |
| Outer sponge wall | 5 | GW30959_OUT | ERR13472834 |
Appendix 1—table 2
Accession for RNA-seq data from the regeneration experiment by Soubigou et al., 2020.
Set I and set II are two regeneration experiments followed for 24 days. Additional experiments of the study were not used, because they did not include the first spicule-free stages.
| Experiment, time | Accession | Regeneration stage |
|---|---|---|
| Set I, day 1 | SRR11617503 | No spicules |
| Set II, day 1 | SRR11617504 | No spicules |
| Set I, day 2 | SRR11617505 | No spicules |
| Set II, day 2 | SRR11617506 | No spicules |
| Set I, days 3–4 | SRR11617507 | Primmorphs with spicules (diactines) |
| Set II, days 3–4 | SRR11617508 | Primmorphs with spicules (diactines) |
| Set I, days 6–8 | SRR11617513 | Ciliated chambers |
| Set II, days 6–8 | SRR11617514 | Ciliated chambers |
| Set I, days 10–14 | SRR11617519 | Choanoderm, expanding spongocoel, pinacoderm |
| Set II, days 10–14 | SRR11617520 | Choanoderm, expanding spongocoel, pinacoderm |
| Set I, days 16–18 | SRR11617523 | Osculum opens, porocytes form ostia |
| Set II, days 16–18 | SRR11617524 | Osculum opens, porocytes form ostia |
| Set I, days 21–24 | SRR11617526 | Juvenile |
| Set II, days 21–24 | SRR11617527 | Juvenile |
| Dissociated cells, day 0 | SRR11617528 | Adult |
Appendix 1—table 3
Source of the data used in the OrthoFinder analysis.
| Species | Accession (run, sample, study, genome) or other source | Protein predictions from |
|---|---|---|
| Porifera | ||
| Calcarea | ||
| Calacronea | ||
| Grantia compressa | SRR3417193 | transcriptome* |
| Leuconia nivea | SRR3417190 | transcriptome* |
| Leucosolenia complicata | http://compagen.unit.oist.jp/datasets.html | transcriptome* |
| Sycon ciliatum | GCA_964019385.1 | genome† |
| Sycon ciliatum (Bergen) | http://compagen.unit.oist.jp/datasets.html | genome |
| Sycon ciliatum (Helgoland) | ERP163002 (this study) | transcriptome* |
| Calcinea | ||
| Clathrina coriacea | SRR3417192 | transcriptome* |
| Janusya sp. | ERR5279461 | transcriptome* |
| Leucetta chagosensis | SRS8111786 | transcriptome* |
| Homocleromorpha | ||
| Oscarella carmela | http://compagen.unit.oist.jp/datasets.html | genome |
| Demospongiae | ||
| Ephydatia muelleri | https://bitbucket.org/EphydatiaGenome/ephydatiagenome/downloads/ | genome |
| Tethya wilhelma | https://bitbucket.org/molpalmuc/tethya_wilhelma-genome/ | genome |
| Vaceletia sp. | SRR4423080 | transcriptome* |
| Hexactinellida | ||
| Acanthascus vastus | Francis, 2023, genome version Avas v1.29, available at https://github.com/PalMuc/Aphrocallistes_vastus_genome/ | genome |
| Vazella_pourtalesii | https://doi.org/10.6084/m9.figshare.23799351 | |
| Cnidaria | ||
| Hexacorallia | ||
| Acropora millepora | GCF_013753865.1 | genome |
| Acropora digitata | GCF_000222465.1 | genome |
| Stylophora pistillata | GCF_002571385.2 | genome |
| Octocorallia | ||
| Heliopora coerulea | ERP120267 | transcriptome* |
| Pinnigorgia flava | ERP122203 | transcriptome* |
| Tubipora musica | ERR3026435 | transcriptome* |
-
*
Re-assembled with TransPi.
-
†
New gene prediction using BRAKER 3.
Appendix 1—table 4
Gene-specific primer sequences for generating in situ hybridization (ISH) probes.
| Gene | Primer name | Sequence (5'–3') |
|---|---|---|
| Calcarin 1 | SciCal1_fw | CACAACAATCCACGCAGCA |
| SciCal1_rv | TCCACTGCAACAGCTCTCAG | |
| Calcarin 2 | SciCal2_fw | GAACCATTCTGGGGAAAATGCC |
| SciCal2_rv | TGGTTGGTATTGGCAGCTTCTC | |
| Calcarin 3 | SciCal3_fw | AATACAACACGTCCAAACAGCG |
| SciCal3_rv | CAAGACTTGCTTCTTTCCTGCC | |
| Calcarin 4 | SciCal4_fw | GGAGAGTTCTTTTTCCCCGGAT |
| SciCal4_rv | GCTTTGTTGTTGGTGAGACTCC | |
| Calcarin 5 | SciCal5_fw | CTGCAACAACGAACCTATGCAA |
| SciCal5_rv | CATCTGCATACCAGGCATCATG | |
| Calcarin 6 | SciCal6_fw | CGTGGGGAGAATACTTCACCAA |
| SciCal6_rv | GACGCGACATTGTTCAATCCAA | |
| Calcarin 7 | SciCal7_fw | GCGAGAAGGCTAGCTATCATGT |
| SciCal7_rv | CTCTTGGAAAGCGCATACATGG | |
| Calcarin 8 | SciCal8_fw | AGAAGGAGACGCTAGTACTGGT |
| SciCal8_rv | TACGGATTGTAGATGTCGGCAC |
Appendix 1—table 5
Hairpin chain reaction fluorescence in situ hybridization (HCR-FISH) probe sets, each consisting of 20 pairs of gene-specific probes with specific split HCR initiators.
Visualization of co-expressed genes requires each target probe set to have a different HCR initiator.
| Target gene | HCR initiator |
|---|---|
| Triactinin | B1 |
| Spiculin | B3 |
| Calcarin 1 | B2 |
| Calcarin 2 | B1 |
| Calcarin 3 | B1 |
| Calcarin 7 | B1 |
| Calcarin 8 | B1 |
| S. ciliatum carbonic anhydrase 1 | B1 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/106239/elife-106239-mdarchecklist1-v1.docx
-
Supplementary file 1
Biological process GO terms enriched in genes overexpressed in the oscular region of S. ciliatum (representative terms obtained from REVIGO).
- https://cdn.elifesciences.org/articles/106239/elife-106239-supp1-v1.xlsx
-
Supplementary file 2
Proteins identified in the calcareous sponge spicule matrix.
Proteins that are overexpressed in the oscular region (log2-fold change) are in bold, calcarins highlighted by yellow background.
- https://cdn.elifesciences.org/articles/106239/elife-106239-supp2-v1.xlsx
-
Supplementary file 3
Vaceletia sp. skeletal proteins similar to S. ciliatum spicule matrix proteins.
- https://cdn.elifesciences.org/articles/106239/elife-106239-supp3-v1.xlsx
-
Supplementary file 4
Genes overexpressed in the oscular region and included in meta module midnightblue with selected gene regulatory GO annotations.
- https://cdn.elifesciences.org/articles/106239/elife-106239-supp4-v1.xlsx
-
Supplementary file 5
OrthoFinder results for orthogroups that include calcarins and other biomineralization genes.
- https://cdn.elifesciences.org/articles/106239/elife-106239-supp5-v1.xlsx
-
Supplementary file 6
Galaxin BlastP hits in the proteomes used in OrthoFinder analysis and proteins and structures of PANTHER family ‘PTHR34490’.
- https://cdn.elifesciences.org/articles/106239/elife-106239-supp6-v1.xlsx
-
Supplementary file 7
Genomic position of biomineralization genes in S. ciliatum, A. millepora, and S. pistillata.
- https://cdn.elifesciences.org/articles/106239/elife-106239-supp7-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Genetic parallels in biomineralization of the calcareous sponge Sycon ciliatum and stony corals
eLife 14:RP106239.
https://doi.org/10.7554/eLife.106239.3
