Cardiolipin deficiency disrupts electron transport chain and drives steatohepatitis
- Center of Metabolic Health, University of Utah, United States
- Department of Nutrition and Integrative Physiology, University of Utah, United States
- Department of Biochemistry, University of Utah, United States
- Metabolomics Core Research Facility, University of Utah, United States
- Huntsman Cancer Institute, University of Utah, United States
- Division of Transplantation and Advanced Hepatobiliary Surgery, Department of Surgery, University of Utah, United States
- Department of Physical Therapy and Athletic Training, University of Utah, United States
- Novo Nordisk Foundation Center for Basic Metabolic Research, University of Copenhagen, Denmark
- Center for Adipocyte Signaling (ADIPOSIGN), University of Southern Denmark, Denmark
- Laboratory of Fundamental and Applied Bioenergetics, University of Grenoble Alpes, France
- Department of Pathology, University of Utah, United States
- Molecular Medicine Program, University of Utah, United States
- Electron Microscopy Core Facility, University of Utah, United States
- Department of Metabolism and Nutritional Programming, Van Andel Institute, United States
- College of Health and Human Sciences, Colorado State University, United States
- Columbine Health Systems Center for Healthy Aging, Colorado State University, United States
- Department of Cancer Biology, Wake Forest University School of Medicine, Atrium Health Wake Forest Baptist Comprehensive Cancer Center, United States
- Departments of Dermatology and Medicine, Division of Gastroenterology and Hepatology, Indiana University School of Medicine, United States
Figures
Figure 1 with 3 supplements
Hepatic mitochondrial phospholipidome in models of MASLD/MASH.
(A) Schematic for mitochondrial phospholipidomic analyses in human liver samples. (B) Representative H&E staining of healthy or MASH livers. Arrows indicate fibrotic liver tissue. The diagnosis was based on obvious bridging fibrosis and/or regenerative nodules on H&E staining. (C, D) Hepatic mitochondrial CL and PG levels in healthy controls or individuals with MASH (n = 10 and 16 per group). Data are shown as total FA chain length:number of double bonds. We have previously validated the 72:8 peak to be the tetralinoleoyl (18:2_18:2_18:2_18:2) cardiolipin on MS2, but we did not perform MS2 on every sample for the study. (E) Pathway for CL biosynthesis. (F–J) Representative H&E and Masson’s Trichrome staining of livers from mice under various MAFLD conditions: chow vs. Western HFD (16 weeks), wildtype vs. ob/ob (20 weeks), chow vs. GAN diet (30 weeks), and vehicle vs. carbon tetrachloride (6 weeks: 0.7 µl/g BW, twice weekly). (J–M) Western blot of OXPHOS subunits and citrate synthase in liver tissues from the same MAFLD models. (N–Q) Heatmaps of hepatic mitochondrial phospholipidomes from the same MAFLD models. (R) Venn diagram comparing hepatic mitochondrial phospholipidomes across all four MASLD models. (S–V) CLS mRNA levels in livers from the same MAFLD models (n = 4–6 per group). Statistical significance was determined by two-way ANOVA with within-row pairwise comparison (C, D, N–Q) and unpaired, two-sided Student’s t-test (C, D total lipid panels, S–V). All measurements were taken from distinct samples.
-
Figure 1—source data 1
Labeled unedited immunoblots shown in Figure 1J–M.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig1-data1-v1.zip
-
Figure 1—source data 2
Full unedited immunoblots shown in Figure 1J–M.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig1-data2-v1.zip
-
Figure 1—source data 3
Patent demographic information.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig1-data3-v1.zip
Figure 1—figure supplement 1
Human liver sections.
(A) Representative H&E-stained liver sections from a healthy human subject (left) and a patient with MASH (right) at ×20 magnification; red arrows indicated ballooned hepatocytes. Scale bar = 100 μm.
Figure 1—figure supplement 2
Mitochondrial phospholipidome from Figure 1N, O.
(A–H) Abundance of mitochondrial lipids (CL, PC, PE, PI, PS, LPC, PG, and LPE) in livers of mice fed standard chow or HFD for 16 weeks (n = 5 per group). (I–P) Abundance of mitochondrial lipids (CL, PC, PE, PI, PS, LPC, PG, and LPE) in livers of wildtype or leptin-deficient mice, 30 weeks old (n = 6 per group). Statistical significance was determined by two-way ANOVA with within-row pairwise comparison. Data represent mean ± SEM. All measurements were taken from distinct samples.
Figure 1—figure supplement 3
Mitochondrial phospholipidome from Figure 1P, Q.
(A–H) Abundance of mitochondrial lipids (CL, PC, PE, PI, PS, LPC, PG, and LPE) in livers of mice fed standard chow or Gubra-Amylin MASH diet for 30 weeks (n = 6 per group). (I–P) Abundance of mitochondrial lipids (CL, PC, PE, PI, PS, LPC, PG, and LPE) in livers of mice injected with corn oil or carbon tetrachloride for 10 weeks (n = 5–7 per group). Statistical significance was determined by two-way ANOVA with within-row pairwise comparison. Data represent mean ± SEM. All measurements were taken from distinct samples.
Figure 2 with 2 supplements
Hepatocyte-specific deletion of CLS induces MASLD/MASH.
(A) Schematic for hepatocyte-specific deletion of CLS in mice. (B, C) CLS mRNA and mitochondrial CL levels in livers from control or CLS-LKO mice (n = 5–7 per group). (D–G) Body mass, food intake, body composition, and liver mass of control or CLS-LKO mice (n = 6–13 per group). (H, I) Representative H&E and Masson’s Trichrome staining of livers from control or CLS-LKO mice. (J) Liver triglycerides of control or CLS-LKO mice (n = 12 per group). (K) RNAseq-derived heatmap of select genes associated with MASH, liver regeneration, and HCC (n = 5–7 per group). (L, M) Serum AST and ALT levels (n = 6–7 per group). (N) mRNA levels of TNFα, TGFβ, IL-12, and MCP1 in livers from control or CLS-LKO mice (n = 5–7 per group). (O) Representative flow cytometry gating for liver cell populations in control or CLS-LKO mice. (P–U) Quantification of cDC2, F4/80+, Ly6Chi inflammatory monocytes, MHC-II+, neutrophils, and cDC1 cell populations in livers (n = 5–7 per group). All results are from mice fed standard chow. Statistical significance was determined by two-way ANOVA with within-row pairwise comparison (C, N) and unpaired, two-sided Student’s t-test (B, D–G, K [adjusted for FDR], and P–U). Data represent mean ± SEM (B–G, L–N, P–U). All measurements were taken from distinct samples.
Figure 2—figure supplement 1
Mitochondrial phospholipidome from standard chow or high-fat diet fed control and CLS-LKO livers.
(A–G) Abundance of mitochondrial lipids (PC, PE, PI, PS, LPC, PG, and LPE) in livers of control or CLS-LKO mice fed standard chow, 8 weeks old (n = 5–6 per group). (H–O) Abundance of mitochondrial lipids (CL, PC, PE, PI, PS, LPC, PG, and LPE) in livers of control or CLS-LKO mice fed a high-fat diet for 8 weeks (n = 11–12 per group). Statistical significance was determined by two-way ANOVA with within-row pairwise comparison. Data represent mean ± SEM. All measurements were taken from distinct samples.
Figure 2—figure supplement 2
Additional histological and transcriptomic data from control and CLS-LKO mice.
(A) Representative H&E staining of livers from control or CLS-LKO mice fed a high-fat diet (HFD) for 8 weeks. (B) Representative Masson’s Trichrome staining of livers from control or CLS-LKO mice fed a HFD for 8 weeks. (C) Volcano plot of differentially expressed genes in livers from control or CLS-LKO mice fed standard chow (n = 5–7 per group). (D) Pathway analysis of transcriptomic data in livers from control or CLS-LKO mice fed standard chow (n = 5–7 per group). (E) Gating strategy used for flow cytometry experiments in control and CLS-LKO mice. Pathway analysis was performed using the Reactome Pathway Database. All measurements were taken from distinct samples.
Figure 3 with 1 supplement
CLS deletion increases mitochondrial respiratory capacity.
(A, B) Glucose tolerance test (IPGTT) and area under the curve (AUC) for control or CLS-LKO mice fed standard chow (n = 6–7 per group). (C, D) Pyruvate tolerance test (PTT) and AUC (n = 6–8 per group). (E, F) RNAseq-derived heatmaps of genes associated with lipogenesis, VLDL, β-oxidation, and ETS complex structure/function (n = 5–6 per group). (G) Representative electron microscopy images of liver mitochondria from control or CLS-LKO mice. (H) Western blot of whole liver lysate using OXPHOS cocktail and citrate synthase for control or CLS-LKO mice. (I) Mitochondrial-to-nuclear DNA ratio in liver tissue from control or CLS-LKO mice (n = 8 per group). (J) Representative tracing from high-resolution respirometry during maximal respiration using TCA cycle intermediates. JO2 consumption in isolated liver mitochondria from control or CLS-LKO mice in response to malate, pyruvate, ADP, succinate, FCCP (K), or palmitoyl-carnitine, malate, and ADP (L) (n = 6 per group). (M) Western blot of isolated mitochondria from livers of control or CLS-LKO mice using OXPHOS cocktail. All results are from mice fed standard chow. Statistical significance was determined by two-way ANOVA with within-row pairwise comparison (A, C, K, L) and unpaired, two-sided Student’s t-test (B, D–F [adjusted for FDR], and I). Data represent mean ± SEM (A–D, K, L). Data in box-and-whiskers plot (I) represent median with min-to-max. All measurements were taken from distinct samples.
-
Figure 3—source data 1
Labeled unedited immunoblots shown in Figure 3H, M.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig3-data1-v1.zip
-
Figure 3—source data 2
Full unedited immunoblots shown in Figure 3H, M.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig3-data2-v1.zip
Figure 3—figure supplement 1
Additional metabolic and mitochondrial phenotyping data with CLS deletion.
(A) mRNA levels of lipogenic genes in livers from control or CLS-LKO mice fed standard chow (n = 6–7 per group). (B) Serum triglycerides in control or CLS-LKO mice fed standard chow (n = 6–7 per group). JO₂ consumption in isolated liver mitochondria from control or CLS-LKO mice fed a high-fat diet (HFD) for 8 weeks in response to substrates: (C) malate, pyruvate, ADP, succinate, and FCCP (n = 11–12 per group); (D) palmitoyl-carnitine, malate, and ADP (n = 7 per group). Statistical significance was determined by two-way ANOVA with within-row pairwise comparison (A, C, D) and unpaired Student’s t-test (B). Data represent mean ± SEM. All measurements were taken from distinct samples.
Figure 4 with 1 supplement
Stable isotope tracing with [U-13C] palmitate and [U-13C] glucose in hepa1–6 cells with or without CLS deletion.
(A) Schematic of stable isotope tracing with [U-13C] palmitate or [U-13C] glucose, showing key intermediates in β-oxidation and the TCA cycle. (B–D) Levels of labeled succinate, malate, and fumarate from palmitate tracing in hepa1–6 cells without (shSC) or with CLS deletion (shCLS) (n = 6 per group). (E–J) Levels of labeled pyruvate, acetyl-CoA, lactate, succinate, fumarate, and citrate from glucose tracing in hepa1–6 cells without or with CLS deletion (n = 6 per group). Statistical significance was determined by unpaired, two-sided Student’s t-test. Data represent mean ± SEM. All measurements were taken from distinct samples.
Figure 4—figure supplement 1
Additional fluxomic phenotyping data with CLS deletion.
(A–D) Levels of labeled metabolites (glycine, aspartate, 3-phosphoglyceric acid, alanine, and malate) from glucose tracing in Hepa1–6 cells without (shSC) or with CLS deletion (shSLC) (n = 6 per group). Statistical significance was determined by unpaired Student’s t-test. Data represent mean ± SEM. All measurements were taken from distinct samples.
Figure 5 with 1 supplement
CL deficiency promotes mitochondrial electron leak.
(A) Representative electron microscopy images of liver fibrosis in control or CLS-LKO mice (red arrows indicate collagen fiber bands arising from differing section orientations of the collagen/fibrotic matrix). (B) mRNA levels of fibrotic markers (Col1a1 and Desmin) in liver tissues (n = 5–7 per group). (C–F) Levels of cleaved caspase-3, cleaved caspase-7, mitochondrial cytochrome c, and cytosolic cytochrome c in liver tissues (n = 4–7 per group). (G) H2O2 emission in isolated liver mitochondria stimulated with succinate, or succinate with auranofin and BCNU (n = 3–4 per group). (H) Schematic of small unilamellar vesicles (SUVs) containing cardiolipin (CL) or phosphatidylcholine (PC) for mitochondrial enrichment. (I) H2O2 production in liver mitochondria enriched with CL or PC SUVs (n = 4 per group). All results are from mice fed standard chow. Statistical significance was determined by two-way ANOVA with within-row pairwise comparison (B, G, I) and unpaired, two-sided Student’s t-test (C–F). Data represent mean ± SEM. All measurements were taken from distinct samples.
-
Figure 5—source data 1
Labeled unedited immunoblots shown in Figure 5C–F.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig5-data1-v1.zip
-
Figure 5—source data 2
Full unedited immunoblots shown in Figure 5C–F.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig5-data2-v1.zip
Figure 5—figure supplement 1
Additional mitochondrial phenotyping data with CLS deletion.
(A, B) Levels of mitochondrial and cytosolic cytochrome c in livers of control or CLS-LKO mice fed a high-fat diet (HFD) for 8 weeks (n = 6 per group). JH₂O₂ emission and production in isolated liver mitochondria from (C) control or CLS-LKO mice fed a HFD for 8 weeks, stimulated with succinate or succinate plus auranofin and BCNU (n = 9–8 per group), and (D) Hepa1–6 cells without (shSC) or with CLS deletion (shCLS), stimulated with succinate or succinate plus auranofin and BCNU (n = 3 per group). (E) Electron leak of liver mitochondria from control mice fused with SUVs (n = 4 per group). Statistical significance was determined by two-way ANOVA with within-row pairwise comparison (C–E) and unpaired Student’s t-test (A, B). All measurements were taken from distinct samples.
-
Figure 5—figure supplement 1—source data 1
Labeled unedited immunoblots shown in Figure 5—figure supplement 1A, B.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
Full unedited immunoblots shown in Figure 5—figure supplement 1A, B.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig5-figsupp1-data2-v1.zip
Figure 6
Influence of CL deficiency on respiratory supercomplex formation.
(A–J) Representative western blots of respiratory supercomplexes in isolated liver mitochondria from control or CLS-LKO mice, detected using antibodies for supercomplexes, monomers, dimers, or oligomers, GRIM19/complex I (B), NDUFA9/complex I (D), SDHA2/complex II (F), UQCRFS1/complex III (H), MTCO1/complex IV (J), and ATP5A/complex V (L). Complex II is not thought to form respiratory supercomplexes. (C, E, G, I, K, M) Quantification of blots (n = 4 per group). All results are from mice fed standard chow. Statistical significance was determined by two-way ANOVA with within-row pairwise comparison (first panels in C, E, I, K) and unpaired, two-sided Student’s t-test (second panels in C, E, G, I, K, and both panels in M). Data represent mean ± SEM. All measurements were taken from distinct samples.
-
Figure 6—source data 1
Labeled unedited immunoblots shown in Figure 6A, B, D, F, H, J, L.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig6-data1-v1.zip
-
Figure 6—source data 2
Full unedited immunoblots shown in Figure 6A, B, D, F, H, J, L.
- https://cdn.elifesciences.org/articles/106976/elife-106976-fig6-data2-v1.zip
Figure 7 with 1 supplement
CL deficiency disrupts coenzyme Q homeostasis in humans and mice.
(A) Schematic of site-specific electron leak. (B–E) Electron leak at sites IQ, IF, IIF, and IIIQ0 in liver mitochondria from control or CLS-LKO mice (n = 7 per group). (F) Oxidized CoQ (ubiquinone) can be reduced to CoQH2 (ubiquinol). (G, H) Oxidized and reduced CoQ levels in isolated liver mitochondria from control or CLS-LKO mice (n = 7 per group). (I) CoQ levels in liver mitochondria from healthy human controls or patients with advanced steatohepatitis (n = 10 and 16 per group). (J) Pearson correlation of CL and CoQ levels in human liver samples (R² = 0.64). Data in (B–E, G, H) are from mice fed standard chow. Statistical significance was determined by unpaired, two-sided Student’s t-test (B–E, panel of total levels in I) and two-way ANOVA with within-row pairwise comparison (G–I). Data represent mean ± SEM (B–E, G–I). All measurements were taken from distinct samples.
Figure 7—figure supplement 1
Additional data on coenzyme Q (A–C) Total CoQ8, CoQ9, and CoQ10 levels in whole liver tissue from control and CLS-LKO mice (n = 7 per group).
(D–I) Oxidized and reduced CoQ8, CoQ9, and CoQ10 levels in whole liver tissue from control and CLS-LKO mice (n = 7 per group). (J–O) Oxidized and reduced CoQ8, CoQ9, and CoQ10 levels in isolated mitochondria from control and CLS-LKO mice (n = 7 per group). (P–S) Oxidized-to-reduced CoQ ratios in isolated liver mitochondria for CoQ8, CoQ9, CoQ10, and total CoQ calculated from the same samples as in panels J–O. Statistical significance was determined by unpaired Student’s t-test. Data represent mean ± SEM. All measurements were taken from distinct samples.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | GRIM19 (mouse monoclonal) | Abcam | ab110240 | 1:1000 |
| Antibody | SDHA (mouse monoclonal) | Abcam | ab14715 | 1:1000 |
| Antibody | UQCRFS1 (mouse monoclonal) | Abcam | ab14746 | 1:1000 |
| Antibody | MTCO1 (mouse monoclonal) | Abcam | ab14705 | 1:1000 |
| Antibody | ATP5a (mouse monoclonal) | Abcam | Ab14748 | 1:1000 |
| Antibody | NDUFA9 (mouse monoclonal) | Abcam | Ab14713 | 1:1000 |
| Antibody | Total OxPhos Antibody cocktail (mouse monoclonal) | Abcam | MS604-300 | 1:1000 |
| Antibody | Citrate Synthetase (rabbit polyclonal) | Abcam | Ab96600 | 1:1000 |
| Antibody | Cytochrome c (rabbit monoclonal) | Cell Signaling | 11940S | 1:1000 |
| Antibody | Caspase-3 (rabbit polyclonal) | Cell Signaling | 9661S | 1:500 |
| Antibody | Caspase-7 (rabbit polyclonal) | Cell Signaling | 9491S | 1:500 |
| Antibody | CD16/32 (rat monoclonal, clone 93) | BioLegend | 101308 | Flow cytometry |
| Antibody | CD45 (rat monoclonal, clone S18009F) | BioLegend | 157214 | Flow cytometry |
| Antibody | CD11b (rat monoclonal, clone M1/70) | BioLegend | 101235 | Flow cytometry |
| Antibody | F4/80 (rat monoclonal, clone BM8) | BioLegend | 123116 | Flow cytometry |
| Antibody | TIM4 (rat monoclonal, clone RMT4-54) | BioLegend | 130020 | Flow cytometry |
| Antibody | Ly6C (rat monoclonal, clone HK1.4) | BioLegend | 127618 | Flow cytometry |
| Antibody | MHCII (rat monoclonal, clone M5/114.15.2) | BioLegend | 107639 | Flow cytometry |
| Antibody | CD11c (Armenian hamster monoclonal, clone N418) | BioLegend | 117302 | Flow cytometry |
| Antibody | Ly6G (rat monoclonal, clone 1A8) | BioLegend | 164504 | Flow cytometry |
| Antibody | OxPhos Blue Native WB Antibody Cocktail (mouse monoclonal) | Thermo Fisher | 45-7999 | 1:1000 |
| Strain, strain background (Escherichia coli) | NEB Stable Competent E. coli | NEB | C3040H | |
| Chemical compound, drug | Amplex Red Reagent | Thermo Fisher Scientific | A12222 | |
| Chemical compound, drug | Auranofin | Sigma-Aldrich | A6733 | |
| Chemical compound, drug | Carmustine (BCNU) | Sigma-Aldrich | C0400 | |
| Chemical compound, drug | SPLASH Mix | Avanti Polar Lipids | 330707 | |
| Chemical compound, drug | Cardiolipin Mix I | Avanti Polar Lipids | LM6003 | |
| Chemical compound, drug | Bovine Serum Albumin | Sigma-Aldrich | A7030 | |
| Chemical compound, drug | Protease Inhibitor Cocktail | Thermo Scientific | 78446 | |
| Chemical compound, drug | Tamoxifen | Sigma-Aldrich | T5648 | |
| Chemical compound, drug | Sunflower Oil | Sigma-Aldrich | S5007 | |
| Chemical compound, drug | TRIzol | Thermo Scientific | 15596018 | |
| Chemical compound, drug | Mini-PROTEAN TGX Gels | Bio-Rad | 4561086 | |
| Chemical compound, drug | ECL | PerkinElmer | 104001EA | |
| Chemical compound, drug | Malate | Sigma-Aldrich | M7397 | |
| Chemical compound, drug | Pyruvate | Sigma-Aldrich | P2256 | |
| Chemical compound, drug | GDP | Sigma-Aldrich | G7127 | |
| Chemical compound, drug | CL 316,243 hydrate | Sigma-Aldrich | C5976 | |
| Chemical compound, drug | ADP | Sigma-Aldrich | A5285 | |
| Chemical compound, drug | ATP | Sigma-Aldrich | A9187 | |
| Chemical compound, drug | Glutamate | Sigma-Aldrich | G5889 | |
| Chemical compound, drug | Succinate | Sigma-Aldrich | S3674 | |
| Chemical compound, drug | Carnitine | Sigma-Aldrich | 8.40092 | |
| Chemical compound, drug | Palmitoyl-CoA | Sigma-Aldrich | P9716 | |
| Chemical compound, drug | Palmitoyl-L-carnitine | Sigma-Aldrich | P1645 | |
| Chemical compound, drug | SYBR Green | Thermo Scientific | A25776 | |
| Chemical compound, drug | 4% Paraformaldehyde | Thermo | J19943-K2 | |
| Chemical compound, drug | Opti-MEM | Gibco | 31985 | |
| Chemical compound, drug | DMEM | Gibco | 1195-092 | |
| Chemical compound, drug | FBS | Gibco | 10082-147 | |
| Chemical compound, drug | Penicillin-streptomycin | Gibco | 15140122 | |
| Chemical compound, drug | CL for SUVs | Avanti Polar Lipids | 840012 | |
| Chemical compound, drug | PC for SUVs | Avanti Polar Lipids | 850375C | |
| Chemical compound, drug | PAGE 3–12% Bis-Tris Gels | Thermo Scientific | BN1001BOX | |
| Chemical compound, drug | NativePage 20x Cathode Buffer | Invitrogen | BN2002 | |
| Chemical compound, drug | NativePage 5% G-250 Sample additive | Invitrogen | BN2004 | |
| Chemical compound, drug | Nativepage 4x Sample Buffer | Invitrogen | BN2003 | |
| Chemical compound, drug | CoQ Standard | Cambridge Isotope Labs | CIL DLM-10279 | |
| Chemical compound, drug | Palmitic acid (U-13C16) | Cambridge Isotope Labs | CLM-409-0.1 | |
| Chemical compound, drug | D-Glucose (U-13C6) | Cambridge Isotope Labs | CLM-1396-5 | |
| Commercial assay or kit | Pierce BCA Protein Assay Kit | Thermo Scientific | 23227 | |
| Commercial assay or kit | iScript cDNA Synthesis Kit | Bio-Rad | 1708891 | |
| Commercial assay or kit | SDH Detection Assay Kit | Abcam | ab228560 | |
| Commercial assay or kit | Direct-zol RNA Miniprep Plus Kit | Zymo | R2070 | |
| Commercial assay or kit | DNeasy Blood and Tissue Kit | QIAGEN | 69504 | |
| Cell line (Homo sapiens) | HEK293T cells | ATCC | CTRL-3216 | |
| Cell line (Mus musculus) | Hepa 1–6 murine hepatoma cells | ATCC | CRL-1830 | |
| Strain, strain background (Mus musculus) | Mouse: CLS conditional knockout (CLS-cKO) | Sustarsic et al., 2018 | N/A | |
| Strain, strain background (Mus musculus) | Mouse: CLS-LKO | This paper | N/A | |
| Strain, strain background (Mus musculus) | Mouse: Alb-Cre | Jackson Laboratory | 003574 | |
| Sequence-based reagent | RT qPCR Primer Atgl F (CCACTCACATCTACGGAGCC) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Atgl R (TAATGTTGGCACCTGCTTCA) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Dgat1 F (GACGGCTACTGGGATCTGA) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Dgat1 R (TCACAACACACCAATTCAGG) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Fasn F (GGATAGCTGTGTAGTGTAACCAT) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Fasn R (GGTCATCGTGATAACCACACA) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Scd1 F (GCTCTACACCTGCCTCTTCG) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Scd1 R (CAGCCGAGCCTTGTAAGTTC) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Crls1 F (TGACCTATGCAGATCTTATTCCA) | Johnson et al., 2018 | ||
| Sequence-based reagent | RT qPCR Primer Crls1 R (TGGCAGAGTTCGGTATCTGA) | Johnson et al., 2018 | ||
| Sequence-based reagent | RT qPCR Primer Tnfa F (CCACCACGCTCTTCTGTCTAC) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Tnfa R (AGGGTCTGGGCCATAGAACT) | https://www.idtda.com/ | ||
| Sequence-based reagent | RT qPCR Primer Tafazzin F (CCCTCCATGTGAAGTGGCCATTCC) | Johnson et al., 2018 | ||
| Sequence-based reagent | RT qPCR Primer Tafazzin R (TGGTGGTTGGAGACGGTGATAAGG) | Johnson et al., 2018 | ||
| Sequence-based reagent | mtDNA F: (TTAAGACACCTTGCCTAGCCACAC) | Mouse Primer Depot NCI/NIH | ||
| Sequence-based reagent | mtDNA R: (CGGTGGCTGGCACGAAATT) | Mouse Primer Depot NCI/NIH | ||
| Sequence-based reagent | nucDNA F: (ATGACGATATCGCTGCGCTG) | Mouse Primer Depot NCI/NIH | ||
| Sequence-based reagent | nucDNA R: (TCACTTACCTGGTGCCTAGGGC) | Mouse Primer Depot NCI/NIH | ||
| Recombinant DNA reagent | shSc | Addgene | 1864 | |
| Recombinant DNA reagent | shCrls1 | Sigma-Aldrich | TRCN0000123937 | |
| Recombinant DNA reagent | psPAX2 | Addgene | 12260 | |
| Recombinant DNA reagent | pMD2.G | Addgene | 12259 | |
| Software, algorithm | GraphPad Prism 9.0 | GraphPad | N/A |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Cardiolipin deficiency disrupts electron transport chain and drives steatohepatitis
eLife 14:RP106976.
https://doi.org/10.7554/eLife.106976.3
