Gut microbe-derived trimethylamine shapes circadian rhythms through the host receptor TAAR5
- Department of Cancer Biology, Cleveland Clinic, United States
- Center for Microbiome and Human Health, Cleveland Clinic, United States
- Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western Reserve University, United States
- Department of Inflammation and Immunity, Cleveland Clinic, United States
- Rodent Behavior Core, Cleveland Clinic, United States
- Department of Cardiovascular and Metabolic Sciences, Cleveland Clinic, United States
- Microbial Sequencing & Analytics Core Facility, Cleveland Clinic, United States
- Department of Medicine, Medical University of South Carolina, United States
Figures
Figure 1 with 2 supplements
The host trimethylamine receptor TAAR5 shapes tissue-specific circadian oscillations.
Male chow-fed wild-type (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were necropsied at 4-hr intervals to collect tissues including skeletal muscle (A), olfactory bulb (B), liver (C), or gonadal white adipose tissue (D). The relative gene expression for circadian (Bmal1, Clock, Nr1d1, Cry1, and Per2) and metabolism (Prdm16 and Ucp1) related genes was quantified by qPCR using the ΔΔ-CT method. Data shown represent the means ± SEM for n = 3–6 individual mice per group. Group differences were determined using cosinor analyses, and p-values are provided where there were statistically significant differences between Taar5+/+ and Taar5-/- mice. The complete cosinor statistical analysis for circadian data can be found in Supplementary file 1. *Significant differences between Taar5+/+ and Taar5-/- mice by Student’s t-tests within each ZT time point (p < 0.05).
Figure 1—figure supplement 1
Body weights across a 24-hr period in chow-fed male Taar5+/+ and Taar5-/- mice.
Male chow-fed wild-type (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were necropsied at 4-hr intervals, and body weight at necropsy was quantified. Data shown represent the means ± SEM for n = 3–6 individual mice per group. Group differences were tested using cosinor analyses, but no statistically significant differences were detected.
Figure 1—figure supplement 2
The host trimethylamine receptor TAAR5 shapes circadian oscillations in circulating hormones and cytokines.
Male chow-fed wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were necropsied at 4-hr intervals to collect plasma. (A) Plasma levels of metabolites in the metaorganismal trimethylamine N-oxide (TMAO) pathway were quantified using liquid chromatography–tandem mass spectrometry (LC–MS/MS). (B) Plasma metabolic hormones (insulin, C-peptide, glucagon, GLP-1, leptin, ghrelin, and peptide YY) and cytokine/chemokine (MCP-1, IL-6, and TNFα) levels were quantified using MesoScale Discovery multi-plex immunoassays as described in the Materials and methods. Data shown represent the means ± SEM for n = 3–6 individual mice per group. Group differences were determined using cosinor analyses, and p-values are provided where there were statistically significant differences between Taar5+/+ and Taar5-/- mice. The complete cosinor statistical analysis for circadian data can be found in Supplementary file 1. Significant differences between Taar5+/+ and Taar5-/- mice by Student’s t-tests within each ZT time point (*p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0005).
Figure 2 with 6 supplements
Mice lacking the host TMA receptor TAAR5 have altered olfactory and repetitive behaviors only at specific circadian time points.
Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were subjected to the olfactory cookie test (A) or the marble burying test (B). To examine circadian alterations in behavior, these tests were done in either the dark-light phase transition (ZT23–ZT1), mid light cycle (ZT5–ZT7), or early dark cycle (ZT13–ZT15). Data represent the mean ± SEM from n = 10–15 per group when male and female are separated (n = 25–27 when both sexes are combined), and statistically significant difference between Taar5+/+ and Taar5-/- mice are denoted by *p < 0.05 and **p < 0.01.
Figure 2—figure supplement 1
Olfactory discrimination of several odor stimuli is unaltered in Taar5-deficient mice.
Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were subjected to a battery of single stimulus olfactory discrimination tests to determine time to and time at each stimuli including (A) banana, (B) corn oil, (C) almond, (D) water, or (E) social odors as described in the Methods section. Data are shown for the entire cohort combining both sexes or divided into either male or female cohorts to examine sexual dimorphism in phenotype. Data represent the mean ± SEM from n = 10–15 per group when male and female are separated (n = 25–27 when both sexes are combined). No statistically significant alterations were found during this battery of tests.
Figure 2—figure supplement 2
Taar5-deficient mice exhibit specific alterations in social behaviors.
Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/) were subjected to a battery of social behavioral tests including (A) three-chamber preference test, (B) three-chamber social preference test, (C) three-chamber social novelty test, or (D) social interaction with a juvenile as described in the Methods section. Data are shown for the entire cohort combining both sexes or divided into either male or female cohorts to examine sexual dimorphism in phenotype. Data represent the mean ± SEM from n = 10–15 per group when male and female are separated (n = 25–27 when both sexes are combined). Significant differences between Taar5+/+ and Taar5-/- mice were determined by Student’s t-tests (*p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0005).
Figure 2—figure supplement 3
Taar5-deficient mice exhibit specific alterations in innate behavioral responses.
Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/) were subjected to a battery of innate behavioral tests including: (A) startle test, (B) forepaw grip strength, (C) hotplate sensitivity, (D) rotorod, and (E) nesting as described in the Methods section. Data are shown for the entire cohort combining both sexes or divided into either male or female cohorts to examine sexual dimorphism in phenotype. Data represent the mean ± SEM from n = 10–15 per group when male and female are separated (n = 25–27 when both sexes are combined). Significant differences between Taar5+/+ and Taar5-/- mice were determined by Student’s t-tests (*p < 0.05; **p < 0.01; and ***p < 0.001).
Figure 2—figure supplement 4
Impact of Taar5 deficiency on cognitive, depression, and anxiety-like behaviors.
Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/) were subjected to a battery of behavioral tests related to cognition, depression, and anxiety including: (A) cued fear conditioning, (B) elevated plus maze, (C) Y-maze, and (D) open field test as described in the Methods section. Data are shown for the entire cohort combining both sexes or divided into either male or female cohorts to examine sexual dimorphism in phenotype. Data represent the mean ± SEM from n = 9–10 per group when male and female are separated (n = 19–20 when both sexes are combined). Significant differences between Taar5+/+ and Taar5-/- mice were determined by Student’s t-tests (*p < 0.05).
Figure 2—figure supplement 5
Impact of Taar5 deficiency on Morris water maze performance.
Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/) were subjected to the Morris water maze as described in the Methods section. Data are shown for the entire cohort combining both sexes or divided into either male or female cohorts to examine sexual dimorphism in phenotype. Data represent the mean ± SEM from n = 10–15 per group when male and female are separated (n = 25–27 when both sexes are combined). Significant differences between Taar5+/+ and Taar5-/- mice were determined by Student’s t-tests (*p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0005).
Figure 2—figure supplement 6
Impact of Taar5 deficiency on systemic energy metabolism and gene expression in brown adipose tissue (BAT).
(A) Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/) were placed in individual cages for indirect calorimetry measured using the Oxymax CLAMS home cage system. After 2 days of equilibration, mice were maintained at thermoneutrality (30°C), room temperature (22°C), or cold stressed (4°C) over a 24-hr period at each temperature point. Oxygen consumption was quantified throughout these temperature transitions as described in the Methods section. (B) Male or female wild-type mice (Taar5+/+) or mice lacking the TMA receptor (Taar5-/) were necropsied at the beginning of the light cycle (ZT2) or the beginning of the dark cycle (ZT14) and subscapular brown adipose tissue (BAT) was harvested to examine gene. The relative gene expression for circadian genes (Bmal1l, Nr1d1, Cry1, and Per1) was quantified by qPCR using the ΔΔ-CT method. Data represent the mean ± SEM from n = 5–9 per group. Significant differences between Taar5+/+ and Taar5-/- mice were determined by Student’s t-tests within each individual time point (*p < 0.05).
Figure 3 with 2 supplements
The trimethylamine receptor TAAR5 shapes circadian oscillations in the gut microbiome.
Male chow-fed wild-type (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were necropsied at 4-hr intervals to collect cecum for microbiome composition analyses via sequencing the V4 region of the 16S rRNA (genus level changes are shown). (A) Canonical correspondence analysis (CCA) based beta diversity analyses show distinct microbiome compositions in Taar5+/+ and Taar5-/- mice. Statistical significance and beta dispersion were estimated using PERMANOVA. (B) The relative abundance of cecal microbiota in Taar5+/+ and Taar5-/- mice. Significantly altered cecal microbial genera in Taar5+/+ and Taar5-/- mice are shown at ZT2 (C), ZT6 (D), ZT10 (E), ZT14 (F), ZT18 (G), and ZT22 (H). ASVs that were significantly different in abundance (MetagenomeSeq with Benjamini–Hochberg false discovery rate (FDR) multiple test correction, adjusted p < 0.01). Data shown represent the means ± SD for n = 3–6 individual mice per group. Group differences were determined using ANOVA with Benjamini–Hochberg FDR multiple test correction, *adjusted p < 0.01.
Figure 3—figure supplement 1
TAAR5-deficient mice have altered circadian oscillations in the gut microbiome at the phylum level.
Male chow-fed wild-type (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were necropsied at 4-hr intervals to collect cecum for microbiome composition analyses via sequencing the V4 region of the 16S rRNA (phylum level changes are shown). Data shown represent the means ± SD for n = 3–6 individual mice per group. The relative abundance of cecal microbiota at the phylum level is shown, and group differences were determined using cosinor analyses. p-values are provided where there were statistically significant differences between Taar5+/+ and Taar5-/- mice.
Figure 3—figure supplement 2
TAAR5-deficient mice have altered circadian oscillations in the gut microbiome.
Male chow-fed wild-type (Taar5+/+) or mice lacking the TMA receptor (Taar5-/-) were necropsied at 4-hr intervals to collect cecum for microbiome composition analyses via sequencing the V4 region of the 16S rRNA (genus level changes are shown). The relative abundance of cecal microbiota at the genus level is shown, and group differences were determined using cosinor analyses. p-values are provided where there were statistically significant differences between Taar5+/+ and Taar5-/- mice. Data shown represent the means ± SD for n = 3–6 individual mice per group. Group differences were tested using cosinor analyses (key statistics represented here), and the complete cosinor statistical analysis for circadian data can be found in Supplementary file 1. *Significant differences are also shown between Taar5+/+ and Taar5-/- mice by Student’s t-tests within each ZT time point (p < 0.05).
Figure 4 with 2 supplements
Transplanting a defined synthetic microbial community with or without genetically deleted trimethylamine production capacity (ΔcutC) alters host circadian rhythms.
Germ-free C57Bl/6 mice (recipients) were gavaged with the core community (B. caccae, B. ovatus, B. thetaiotaomicron, C. aerofaciens, and E. rectale) with TMA producing wild-type (WT) C. sporogenes (produces TMAO) or C. sporogenes ΔcutC. Gnotobiotic mice were then necropsied at 4-hr intervals to collect tissues including plasma (A, C) and olfactory bulb (B). (A) Plasma levels of TMAO pathway metabolites (choline, L-carnitine, betaine, γ-butyrobetaine, trimethylamine (TMA), and trimethylamine N-oxide (TMAO)) were quantified by liquid chromatography–tandem mass spectrometry (LC–MS/MS). (B) PCR was performed on olfactory bulb to examine key circadian clock regulators. (C) Plasma levels of metabolic hormones (insulin, GLP-1, and leptin) and select cytokines including interleukins (IL-1β, IL-2, and IL-33) were measured as described in the Methods section. Data shown represent the means ± SEM for n = 5–6 individual mice per group. Differences between WT-cutC and ΔcutC groups were determined using cosinor analyses, and p-values are provided where there were statistically significant differences between groups for circadian statistics. The complete cosinor statistical analysis for circadian data can be found in Supplementary file 1. Significant differences between WT-cutC and ΔcutC groups were also analyzed by Student’s t-tests within each ZT time point (*p < 0.05 and **p < 0.01).
Figure 4—figure supplement 1
The oscillatory patterns of the TMAO-defined community are altered when cutC is genetically deleted.
Germ-free C57Bl/6 mice (recipients) were gavaged with the core community (B. caccae, B. ovatus, B. thetaiotaomicron, C. aerofaciens, and E. rectale) with TMA producing wild-type (WT) C. sporogenes (produces TMAO) or C. sporogenes ΔcutC. Gnotobiotic mice were then necropsied at 4-hr intervals to collect cecum for shotgun metagenomic sequencing. The total abundance is shown for each of the five bacteria represented in the defined community over the 24-hr circadian period. Differences between WT-cutC and ΔcutC groups were determined using cosinor analyses, and p-values are provided where there were statistically significant differences between groups for circadian statistics. The complete cosinor statistical analysis for circadian data can be found in Supplementary file 1. Significant differences between WT-cutC and ΔcutC groups were also analyzed by Student’s t-tests within each ZT time point (*p < 0.05 and **p < 0.01). Data shown represent the means ± SEM for n = 5–6 individual mice per group.
Figure 4—figure supplement 2
Mice lacking either gut microbial TMA production or host-driven TMA oxidation have altered circadian rhythms.
(A,B) Female germ-free C57Bl/6 mice (recipients) were gavaged with the core community (B. caccae, B. ovatus, B. thetaiotaomicron, C. aerofaciens, and E. rectale) with TMA producing wild-type (WT) C. sporogenes (produces TMAO) or C. sporogenes ΔcutC. Gnotobiotic mice were then necropsied at 4-hr intervals to collect tissues including subscapular brown adipose tissue (A) and plasma (B). Gene expression was quantified by qPCR and metabolite levels were quantified by LC–MS/MS as described in the Method section. Data for panels A and B were analyzed by cosinor analyses and representative p-values are shown; The complete statistical analysis for cosinor circadian metrics can be found in Supplementary file 1. (C) Female wild-type (Fmo3+/+) or flavin-containing monooxygenase 3 knockout (Fmo3-/-) mice were necropsied at ZT2 or ZT14, and TMAO levels were measured by LC–MS/MS and olfactory bulb circadian gene expression was quantified by qPCR. Data shown represent the means ± SEM for n = 4–6 individual mice per group. Significant differences between by Student’s t-tests within each ZT time point (*p < 0.05 and **p < 0.01).
Figure 5
Summary of findings.
Dietary choline is converted by gut microbial CutC/D into TMA, which signals through the host receptor TAAR5 or is converted to TMAO by hepatic FMO3. Loss of TAAR5 disrupts core circadian gene oscillations (particularly in the olfactory bulb), alters time-of-day regulation of cytokines, hormones, metabolites, and reveals time-dependent changes in innate and repetitive behaviors, alongside dysregulated oscillatory microbiome dynamics. Eliminating microbial cutC similarly rewires circadian oscillations in host immune and metabolic pathways, and microbial strains themselves exhibit altered rhythmicity depending on cutC status. Likewise, Fmo3⁻/⁻ mice display disturbed circadian gene rhythms, together defining a microbial TMA–TAAR5–FMO3 axis as a key regulator of circadian control, inflammation, and metabolic disease-relevant physiology.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background | Bacteroides thetaiotaomicron | ATCC | VPI-5482 | |
| Strain, strain background | Bacteroides caccae | ATCC | ATCC 43185 | |
| Strain, strain background | Bacteroides ovatus | ATCC | ATCC 8483 | |
| Strain, strain background | Collinsella aerofaciens | ATCC | ATCC 25986 | |
| Strain, strain background | Eubacterium rectale | ATCC | ATCC 33656 | |
| Strain, strain background | Clostridium sporogenes | ATCC | ATCC 15579 | |
| Strain, strain background | Clostridium sporogenes ΔcutC | Dr. Michael Fischbach at Stanford University | N/A | Mutant strain |
| Chemical compound, drug | Choline chloride | Sigma | #C7017 | LC/MS standard |
| Chemical compound, drug | Choline chloride (trimethyl-D₉, 98%) | Cambridge Isotope Laboratories, Inc | #DLM-549-MPT-PK | LC/MS standard |
| Chemical compound, drug | Betaine | Sigma | #61962 | LC/MS standard |
| Chemical compound, drug | N-(Carboxymethyl)-N,N,N-trimethyl-d9-ammonium chloride | C/D/N Isotopes Inc | #D-3352 | LC/MS standard |
| Chemical compound, drug | L-Carnitine hydrochloride | Sigma | #94954 | LC/MS standard |
| Chemical compound, drug | L-Carnitine-d3 HCl (N-methyl-d3) | C/D/N Isotopes Inc | #D-5069 | LC/MS standard |
| Chemical compound, drug | (3-Carboxypropyl)trimethylammonium chloride (butyrobetaine) | Sigma | #403245 | LC/MS standard |
| Chemical compound, drug | Butyrobetaine-d9 | Wang et al., 2015 | NA | LC/MS standard |
| Chemical compound, drug | 5-Hydroxyindole-3-acetic acid | Sigma | #H8876 | LC/MS standard |
| Chemical compound, drug | 5-Hydroxyindole-3-acetic-2,2-D2 Acid | CDN Isotopes | #D-1547 | LC/MS standard |
| Chemical compound, drug | Hippuric acid | Sigma | #8206490100 | LC/MS standard |
| Chemical compound, drug | N-Benzoyl-d5-glycine | CDN Isotopes | #D-5588 | LC/MS standard |
| Chemical compound, drug | 4-OH-Hippuric acid | Santa Cruz Biotechnology | #SC-277427 | LC/MS standard |
| Chemical compound, drug | 3-Hydroxyhippuric acid | TRC | #H943125 | LC/MS standard |
| Chemical compound, drug | 2-Hydroxyhippuric acid | Carbosynth | #FH240191601 | LC/MS standard |
| Chemical compound, drug | Indole-3-propionic acid | Alfa Aesar | #L04877 | LC/MS standard |
| Chemical compound, drug | Indole-3-propionic-2,2-D2 acid | CDN Isotopes | #D-7686 | LC/MS standard |
| Chemical compound, drug | Methylindole-3-acetate | Sigma | #I9770 | LC/MS standard |
| Chemical compound, drug | DL-Indole-3-lactic acid | Chem-Impex | #21729 | LC/MS standard |
| Chemical compound, drug | Phenylacetic acid | Aldrich | #P16621 | LC/MS standard |
| Chemical compound, drug | Phenylacetic Acid-1,2-13C2 | Chem Cruz | #SC-236371 | LC/MS standard |
| Chemical compound, drug | DL-p-Hydrophenyllactic acid | Aldrich | #H3253 | LC/MS standard |
| Chemical compound, drug | Indoxyl-glucuronide | Abcam | #Ab146380 | LC/MS standard |
| Chemical compound, drug | L-Tryptophan-2′,4′,5′,6′,7′-d5 (indole-d5) | CDN Isotopes | #D-1522 | LC/MS standard |
| Chemical compound, drug | Serotonin | Sigma | #H-9523 | LC/MS standard |
| Chemical compound, drug | Tryptamine | Aldrich | #193747 | LC/MS standard |
| Chemical compound, drug | Tryptamine-α,α,β,β-D4 HCl | CDN Isotopes | #D-1546 | LC/MS standard |
| Chemical compound, drug | 3-Indoleacetic acid | Aldrich | #I3750 | LC/MS standard |
| Chemical compound, drug | Indole-3-acetic-2,2-D2 acid | CDN Isotopes | #D-1709 | LC/MS standard |
| Chemical compound, drug | Sodium phenyl sulfate | Enamine | #EN300-1704008 | LC/MS standard |
| Chemical compound, drug | TMAO | Sigma | #317594 | LC/MS standard |
| Chemical compound, drug | Trimethylamine N-oxide (D₉, 98%) | Cambridge Isotope Laboratories, Inc | #DLM-4779-1 | LC/MS standard |
| Chemical compound, drug | Phenylacetyl-L-glutamine | Chem-Impex | #16414 | LC/MS standard |
| Chemical compound, drug | N-alpha-(phenyl-d5-acetyl)-L-glutamine | CDN Isotopes | #D-6900 | LC/MS standard |
| Chemical compound, drug | Potassium p-tolyl sulfate P-cresol sulfate K-salt | TCI | #P2091 | LC/MS standard |
| Chemical compound, drug | p-Cresol sulfate, potassium salt (D₇, 98%) | Cambridge Isotope Laboratories, Inc | #DLM-9786 | LC/MS standard |
| Chemical compound, drug | 3-Indoxyl sulfate potassium salt | Chem-Impex | #21710 | LC/MS standard |
| Chemical compound, drug | 3-Indoxyl sulfate-d4 potassium salt | TRC | #I655102 | LC/MS standard |
| Chemical compound, drug | Phenylacetylglycine | Bachem | #4016439 | LC/MS standard |
| Chemical compound, drug | trans-3-Indoleacrylic acid | Aldrich | #I3807 | LC/MS standard |
| Chemical compound, drug | 4-Ethylphenyl sulfate potassium salt | TRC | #E925865 | LC/MS standard |
| Chemical compound, drug | Trimethylamine hydrochloride | Sigma | #41284 | LC/MS standard |
| Chemical compound, drug | Trimethylamine:DCl (D₁₀, 98%) | Cambridge Isotope Laboratories, Inc | #DLM-1817-5 | LC/MS standard |
| Commercial assay, kit | Monarch Total RNA Miniprep Kit | New England BioLabs | #T2010S | |
| Commercial assay, kit | V-Plex Cytokine Panel 1 Mouse Kit | Mesoscale Discovery | #K15245D | |
| Commercial assay, kit | V-Plex Pro-Inflammatory Panel 1 Mouse Kit | Mesoscale Discovery | #K15048D | |
| Commercial assay, kit | U-Plex Metabolic Combo Mouse Kit | Mesoscale Discovery | #K15297K | |
| Commercial assay, kit | Ultra Sensitive Mouse Insulin ELISA | Crystal Chem Inc | #90080 | |
| Commercial assay, kit | DNeasy PowerSoil Pro Kit | QIAGEN | #47014 | |
| Strain, strain background | Germ/free C57BL/6NTac | Taconic | Stock #: B6-GF-F | |
| Strain, strain background | C57BL/6J | Jackson | #00664 | |
| Strain, strain background | C57BL/6J Taar5-/- | This paper | NA | Created from ES cell clone 10675A-A8 and originated on the C57BL/6N background by Regeneron Pharmaceuticals, Inc |
| Strain, strain background | C57BL/6J Fmo3-/- | Massey et al. (Attané et al., 2016) | NA | |
| Sequence-based reagent | LacZ Forward | Sigma | PCR primer | CCAACGTGACCTATCCCATTAC |
| Sequence-based reagent | LacZ Reverse | Sigma | PCR primer | ATCTTCCTGAGGCCGATACT |
| Sequence-based reagent | Bmal1 Forward | Sigma | PCR primer | CCAAGAAAGTATGGACACAGACAAA |
| Sequence-based reagent | Bmal1 Reverse | Sigma | PCR primer | GCATTCTTGATCCTTCCTTGGT |
| Sequence-based reagent | Nr1d1 Forward | Sigma | PCR primer | ATGCCAATCATGCATCAGGT |
| Sequence-based reagent | Nr1d1 Reverse | Sigma | PCR primer | CCCATTGCTGTTAGGTTGGT |
| Sequence-based reagent | Per1 Forward | Sigma | PCR primer | TGTCCTGGTTTCGAAGTGTG |
| Sequence-based reagent | Per1 Reverse | Sigma | PCR primer | TGTGTCAAGCAGGTTCAGG |
| Sequence-based reagent | Per2 Forward | Sigma | PCR primer | GCTGACGCACACAAAGAACT |
| Sequence-based reagent | Per2 Reverse | Sigma | PCR primer | TAGCCTTCACCTGCTTCACG |
| Sequence-based reagent | Clock Forward | Sigma | PCR primer | AGGCACAGACATTATCGG |
| Sequence-based reagent | Clock Reverse | Sigma | PCR primer | ACCGTCTCATCAAGGGAC |
| Sequence-based reagent | Cry1 Forward | Sigma | PCR primer | TACTGGGAAACGCTGAACCC |
| Sequence-based reagent | Cry1 Reverse | Sigma | PCR primer | ACCCCAAGCTTGTTGCCTAA |
| Sequence-based reagent | Cry2 Forward | Sigma | PCR primer | GCTGGAAGCAGCCGAGGAACC |
| Sequence-based reagent | Cry2 Reverse | Sigma | PCR primer | GGGCTTTGCTCACGGAGCGA |
| Sequence-based reagent | Prdm16 Forward | Sigma | PCR primer | CAGCACGGTGAAGCCATTC |
| Sequence-based reagent | Prdm16 Reverse | Sigma | PCR primer | GCGTGCATCCGCTTGTG |
| Sequence-based reagent | Ucp1 Forward | Sigma | PCR primer | ACTGCCACACCTCCAGTCATT |
| Sequence-based reagent | Ucp1 Reverse | Sigma | PCR primer | CTTTGCCTCACTCAGGATTGG |
| Sequence-based reagent | Pemt Forward | Sigma | PCR primer | TGTGCTGTCCAGCTTCTATG |
| Sequence-based reagent | Pemt Reverse | Sigma | PCR primer | GAAGGGAAATGTGGTCACTCT |
| Sequence-based reagent | Pdk4 Forward | Sigma | PCR primer | GTGCTCTCTGGTCCTCTGTG |
| Sequence-based reagent | Pdk4 Reverse | Sigma | PCR primer | AGTCCAACGGACAAAACGGA |
| Sequence-based reagent | Fmo3 Forward | Sigma | PCR primer | CCCACATGCTTTGAGAGGAG |
| Sequence-based reagent | Fmo3 Reverse | Sigma | PCR primer | GGAAGAGTTGGTGAAGACCG |
| Sequence-based reagent | CycloA Forward | Sigma | PCR primer | GCGGCAGGTCCATCTACG |
| Sequence-based reagent | CycloA Reverse | Sigma | PCR primer | GCCATCCAGCCATTCAGTC |
| Sequence-based reagent | Gapdh Forward | Sigma | PCR primer | CCTCGTCCCGTAGACAAAATG |
| Sequence-based reagent | Gapdh Reverse | Sigma | PCR primer | TGAAGGGGTCGTTGATGGC |
| Software, algorithm | GraphPad Prism | https://www.graphpad.com/ | Version 10.4.1 | Statistical analysis/figures |
| Software, algorithm | DADA2 | https://benjjneb.github.io/dada2/ | Version 3.16 | Cosinor analysis |
| Software, algorithm | metagenomeSeq | https://github.com/HCBravoLab/metagenomeSeq; Paulson, 2024 | Version: Release (3.20) | Cosinor analysis |
| Software, algorithm | DAtest | https://github.com/Russel88/DAtest; Russel, 2022 | Version 2.8.0 | Cosinor analysis |
| Software, algorithm | DAtest | https://github.com/Russel88/DAtest | Version 2.8.0 | Cosinor analysis |
| Software, algorithm | ggplot2 | https://cran.r-project.org/web/packages/ggplot2/index.html | Version 3.5.1 | Cosinor analysis |
| Software, algorithm | cosinor | https://cran.r-project.org/web/packages/cosinor/index.html | Version 1.2.3 | Cosinor analysis |
| Software, algorithm | cosinor2 | https://cran.r-project.org/web/packages/cosinor2/index.html | Version 0.2.1 | Cosinor analysis |
| Software, algorithm | EthoVision XT15 (video tracking software) | Noldus | NA | Behavioral testing |
| Other | qScript | QuantaBio | #95048-100 | Realtime PCR |
| Other | Fast SYBR Green Master Mix | Applied Biosystems | #4385612 | Realtime PCR |
| Other | Nutter Butter Cookies | Nabisco | NA | Behavioral testing |
| Other | Marbles | Moon Marble Company | NA | Behavioral testing |
| Other | SR-LAB-Startle Response System | San Diego Instruments | #2325-0400 | Behavioral testing |
| Other | Elevated Plus Maze | Nationwide Plastics | NA | Behavioral testing |
| Other | Y Maze | Nationwide Plastics | NA | Behavioral testing |
| Other | Forepaw Grip Strength Meter | Columbus Instruments | #1027SM | Behavioral testing |
| Other | Rotamex-5 | Columbus Instruments | #0254-8000 | Behavioral testing |
| Other | Fear Conditioning Chambers | Med Associates | #VFC-008 | Behavioral testing |
| Other | Hot Plate | Ugo Basile | #35300 | Behavioral testing |
| Other | OxyMax Clams Home Cage System | Columbus Instruments | NA | Behavioral testing |
Additional files
-
Supplementary file 1
Cosinor analyses for the entire manuscript.
- https://cdn.elifesciences.org/articles/107037/elife-107037-supp1-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/107037/elife-107037-mdarchecklist1-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Gut microbe-derived trimethylamine shapes circadian rhythms through the host receptor TAAR5
eLife 14:RP107037.
https://doi.org/10.7554/eLife.107037.3
