CCDC32 stabilizes clathrin-coated pits and drives their invagination
- NHC Key Laboratory of Birth Defect Research and Prevention, MOE Key Laboratory of Rare Pediatric Diseases, Institute of Cytology and Genetics of School of Basic Medical Sciences & Department of Clinical Laboratory of The First Affiliated Hospital, Hengyang Medical School, University of South China, China
- Department of Biology, University of Pennsylvania, United States
- Fuzhou Institute of Oceanography, College of Geography and Oceanography, Minjiang University, China
- Chan Zuckerberg Biohub, United States
- Department of Cell Biology, University of Texas Southwestern Medical Center, United States
Figures
Figure 1 with 2 supplements
CCDC32 is recruited to clathrin-coated pits.
(A) Representative TIRFM images of ARPE-HPV cells that stably express mRuby-CLCa and eGFP-CCDC32(FL). This dual-channel imaging was conducted without siRNA-mediated knockdown. White arrows point to colocalized CLCa and CCDC32 clusters. White ROI is magnified on the right. Scale bar = 5 µm. (B) Cohort-averaged fluorescence intensity traces of CCPs (marked with mRuby-CLCa) and CCP-enriched eGFP-CCDC32(FL). 51.3±8.2% of analyzed CCPs showed eGFP-CCDC32(FL) recruitment. Number of tracks analyzed: 23699. (C) Lifetime distributions of all CCPs, CCPs with eGFP-CCDC32 recruitment, and CCPs without eGFP-CCDC32 recruitment.
-
Figure 1—source data 1
Numeric data to generate Figure 1.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Western Blot of recombinant cells.
(A) Western blotting indicates similar expression levels of exogenous eGFP-CCDC32(FL), eGFP, eGFP-CCDC32(1-54), and eGFP-CCDC32(∆78–98) in ARPE-HPV mRuby-CLCa cells. (B) siCCDC32 knocked down endogenous CCDC32 but not exogenously introduced eGFP-CCDC32(FL) from ARPE-HPV mRuby-CLCa cells. Note that the anti-CCDC32 antibody does not detect the eGFP-CCDC32(∆78–98) as well as full-length and is unable to detect eGFP-CCDC32(1-54).
-
Figure 1—figure supplement 1—source data 1
PDF file containing original western blots for Figure 1—figure supplement 1, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig1-figsupp1-data2-v1.zip
Figure 1—figure supplement 2
Dual channel TIRFM imaging revealed no eGFP recruitment to CCPs.
(A) Representative TIRFM images of ARPE-HPV cells that stably express mRuby-CLCa and EGFP. White ROI is magnified on the right. Scale bar = 5 µm. (B) Cohort-averaged fluorescence intensity traces of CCPs and CCP-enriched EGFP. Number of tracks analyzed: 46833.
-
Figure 1—figure supplement 2—source data 1
Numeric data to generate Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig1-figsupp2-data1-v1.xlsx
Figure 2 with 4 supplements
CCDC32 depletion inhibits Transferrin Receptor (TfnR) uptake and CCP maturation.
(A) Immunoblotting (IB) shows efficient CCDC32 knockdown in ARPE-HPV cells by siRNA treatment. (B) Quantified knockdown efficiency (~60%) of CCDC32 (n=8). (C) Measurements of the uptake efficiency of TfnR (n=8). % of surface bound = Internalized/Surface bound*100%. Error bars in (B–C) indicate standard deviations. (D–E) Representative single frame images from TIRFM videos (7.5 min/video, 1 frame/s, see Figure 2—videos 1 and 2) and corresponding kymographs from region indicated by yellow lines of ARPE-HPV eGFP-CLCa cells treated with (D) control siRNA or (E) CCDC32 siRNA. Scale bars = 5 µm. (F–H) Effect of CCDC32 knockdown on the initiation rates of (F) all CCSs and (G) bona fide CCPs, as well as (H) the % of bona fide CCPs. Each dot represents a video (n=11). Statistical analysis of the data in (F–H) is the Wilcoxon rank sum test, ***, p≤0.001. (I) Lifetime distribution of bona fide CCPs. Data presented were obtained from a single experiment (n=11 videos for each condition) that is representative of three independent repeats. Number of dynamic tracks analyzed: 125897 for siControl and 105313 for siCCDC32. Shadowed area indicates 95% confidence interval.
-
Figure 2—source data 1
Numeric data to generate Figure 2.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig2-data1-v1.xlsx
-
Figure 2—source data 2
PDF file containing original western blots for Figure 2A, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig2-data2-v1.zip
-
Figure 2—source data 3
Original files for western blot analysis displayed in Figure 2A.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig2-data3-v1.zip
Figure 2—figure supplement 1
siRNA-mediated knockdown of CCDC32 does not affect AP2 expression level.
(A) Representative immunoblotting result of AP2 subunits from n=3 biological repeats. (B) Quantification of results from (A). Error bars indicate standard deviations. Statistical analysis is student’s t-test: ns, not significant.
-
Figure 2—figure supplement 1—source data 1
Numeric data to generate Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig2-figsupp1-data1-v1.xlsx
-
Figure 2—figure supplement 1—source data 2
PDF file containing original western blots for Figure 2—figure supplement 1, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig2-figsupp1-data2-v1.zip
-
Figure 2—figure supplement 1—source data 3
Original files for western blot analysis displayed in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig2-figsupp1-data3-v1.zip
Figure 2—figure supplement 2
Fraction of CCPs in lifetime cohorts.
Data was obtained from ARPE-HPV eGFP-CLCa cells that were treated with siCCDC32. The obtained data was processed with cmeAnalysis.
-
Figure 2—figure supplement 2—source data 1
Numeric data to generate Figure 2—figure supplement 2.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig2-figsupp2-data1-v1.xlsx
Figure 2—video 1
Time-lapse TIRFM imaging of ARPE-HPV eGFP-CLCa cells that were treated with control siRNA.
Images were obtained at 1 frame/s and collected for 7.5 min. Video is accelerated 25-fold.
Figure 2—video 2
Time-lapse TIRFM imaging of ARPE-HPV eGFP-CLCa cells that were treated with CCDC32 siRNA.
Images were obtained at 1 frame/s and collected for 7.5 min. Video is accelerated 25-fold.
Figure 3
CCDC32 depletion inhibits CCP invagination.
(A) Scheme of Epi-TIRF microscopy for measuring the invagination of CCPs using primary/subordinate tracking. denotes the invagination depth of CCPs over time. and denotes the cohort-averaged fluorescence intensity from Epi and TIRF channels, respectively. and are the initial growth rate for the Epi and TIRF channel signals, respectively. is an additive correction factor. ‘*’ indicates the mass center of clathrin coat. =115 nm is the evanescent depth of TIRF field, see more detail in Saffarian and Kirchhausen, 2008; Wang et al., 2020. (B) Representative Epi and TIRF microscopy images. Scale bars = 10 µm. (C) Epi-TIRF microscopy analysis shows that knockdown of CCDC32 strongly inhibited CCP invagination. Top: Cohort-averaged CCP fluorescence intensity traces from Epi and TIRF channels; bottom: calculated curves. Data presented were obtained from n=12 videos for each condition. Number of CCP tracks analyzed to obtain the curves: 5998 for siControl and 4418 for siCCDC32. Shadowed area indicates 95% confidential interval.
-
Figure 3—source data 1
Numerical data to generate Figure 3.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig3-data1-v1.xlsx
Figure 4 with 1 supplement
Flat clathrin lattices accumulate in cells depleted of CCDC32.
(A–B) Representative PREM images of ARPE19 cells treated with (A) control siRNA or (B) CCDC32 siRNA showing flat (blue), dome-shaped (green), and spherical (orange) CCSs. Scale bars = 200 nm. (C–E) Quantification of the clathrin-coated structures (CCSs) by (C) shape category, (D) the CCS projection area, and (E) the CCS occupancy on the plasma membrane (PM). Each dot in (E) represents an individual fragment of the PM; the number of cell membrane fragments analyzed is 38 for siControl cells and 35 for siCCDC32 cells from two independent experiments, n=number of CCS. Statistical tests were performed using Mann-Whitney test (D) or unpaired t-test (E). For the Box and whisker plots in (D) and (E), the box extends from the 25th to 75th percentiles, the line in the middle of the box is plotted at the median, and the ‘+’ indicates the mean.
-
Figure 4—source data 1
Numerical data to generate Figure 4.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
CCDC32 knockdown shifts the shapes of clathrin-coated structures.
(A–B) Representative PREM images of ARPE-HPV cells treated with (A) control siRNA or (B) CCDC32 siRNA. Scale bars = 200 nm. (C–D) Quantification of the (C) CCS shape category and (D) CCS occupancy on PM. Each dot represents an individual fragment of the plasma membrane; the number of plasma membrane fragments analyzed is 38 for siControl and 35 for siCCDC32 from two independent experiments. Statistical tests were performed using either unpaired t-test or Mann-Whitney test depending on normality of distributed values.
-
Figure 4—figure supplement 1—source data 1
Numerical data to generate Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig4-figsupp1-data1-v1.xlsx
Figure 5 with 1 supplement
CCDC32 interacts with AP2 through the α appendage domain.
(A) AP2 structure. AD: appendage domain. (B) Domain structure of a fully-functional α-subunit bearing an internal eGFP tag inserted in the unstructured hinge region. (C) Volcano plot after mass spectrometry analysis of the immunoprecipitation (IP) of eGFP from naive ARPE-HPV cells (control IPs) or ARPE-HPV cells that stably express AP2-α-eGFP (AP2-α-eGFP IPs) using anti-GFP beads. Green: AP2 subunits; orange: known AP2 interactors. Source data for the volcano plot is available as Figure 5—source data 1. (D–F) IP of eGFP from ARPE-HPV cells that stably express eGFP or eGFP-CCDC32(FL) using anti-GFP magnetic beads. (D) The domain structures of eGFP and eGFP-CCDC32(FL). (E) Representative immunoblotting result of n=3 IP samples. (F) Relative AP2 enrichments quantified from immunoblotting results. (G–I) GST pull-down assays. (G) Coomassie blue stained SDS-page gel of purified GST, GST-AP2-α-AD, and GST-AP2-β-AD. (H) Representative western blot result of n=3 GST pull-down assay from ARPE-HPV eGFP-CCDC32(FL) cell lysate using purified GST, GST-AP2-α-AD, or GST-AP2-β-AD. The amount of bait GST-proteins is shown in (G), and the pulled down eGFP-CCDC32 was detected by immunoblotting (IB) of GFP. (I) Quantification of immunoblots of the relative enrichment of CCDC32. Error bars in (F) and (I) are SD (n=3). Two-tailed student’s t-test: ***, p≤0.001.
-
Figure 5—source data 1
Original MassSpec results displayed in 5 C.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig5-data1-v1.xlsx
-
Figure 5—source data 2
Numerical data to generate Figure 5F and I.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig5-data2-v1.xlsx
-
Figure 5—source data 3
PDF file containing original western blots for Figure 5E, G and H, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig5-data3-v1.zip
-
Figure 5—source data 4
Original files for western blot analysis displayed in Figure 5E, G and H.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig5-data4-v1.zip
Figure 5—figure supplement 1
All the four subunits of intact AP2 efficiently co-IP with eGFP-CCDC32(FL).
-
Figure 5—figure supplement 1—source data 1
PDF file containing original western blots for Figure 5—figure supplement 1, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig5-figsupp1-data2-v1.zip
Figure 6 with 1 supplement
A central α-helix in CCDC32 mediates CCDC32-AP2 interactions.
(A–C) IP of eGFP from ARPE-HPV cells that stably express eGFP-CCDC32(FL) or eGFP-CCDC32(∆78–98) using anti-GFP beads. (A) The domain structures of eGFP-CCDC32(FL) and eGFP-CCDC32(∆78–98). (B) Representative immunoblotting result of n=3 IP samples. (C) Relative AP2 enrichments that were quantified from (B). Error bars indicate standard deviations. (D) Representative TIRFM images of ARPE-HPV cells that stably express mRuby-CLCa and eGFP-CCDC32(∆78–98). White ROI is magnified on the right. Scale bar = 5 µm. (E) Cohort-averaged fluorescence intensity traces of CCPs and CCP-enriched eGFP-CCDC32(∆78–98). Number of tracks analyzed: 37892. (F–G) (F) TfnR uptake efficiency and (G) CCP% of ARPE mRb-CLCa cells that stably express eGFP-CCDC32(WT), eGFP, or eGFP-CCDC32(∆78–98), and with siRNA-mediated knockdown of endogenous CCDC32. Each dot in (G) represents a video. Statistical analysis of the data in (F) is two-tailed student’s t-test: ns, not significant; ***, p≤0.001. Statistical analysis of the data in (G) is the Wilcoxon rank sum test, **, p≤0.01.
-
Figure 6—source data 1
Numerical data to generate Figure 6.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig6-data1-v1.xlsx
-
Figure 6—source data 2
PDF file containing original western blots for Figure 6B, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig6-data2-v1.zip
-
Figure 6—source data 3
Original files for western blot analysis displayed in Figure 6B.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig6-data3-v1.zip
Figure 6—figure supplement 1
The sequence and structure of CCDC32.
(A) Amino acid sequence of CCDC32. Blue font: canonical AP2 binding motifs; red font: predicted coiled-coil domain (aa78-98). (B) AlphaFold 3.0 modeling of full-length CCDC32 (Jumper et al., 2021; Varadi et al., 2022). Residues with pLDDT >0.8 are labeled in red. (C) co-IP of eGFP-CCDC32 did not pulldown endogenous CCDC32. Red-cycled area was overexposed on the right. (D–E) AlphaFold 3.0 modeling of CCDC32 interaction with AP2-α (gene: AP2A2). For all panels, CCDC32 is colored by pLDDT and AP2-α is gray. (D) CCDC32-AP2A2 complex. CCDC32 residues with pLDDT >0.7 are labeled in red. (E–F) Close-up view of the CCDC32-AP2A2 complex near CCDC32 residues (E) 12–28, 37–43, and (F) 66–91. Hydrophobic CCDC32 and AP2-α residues at the interface are labeled in red and black, respectively. Two canonical α-AD binding motifs in CCDC32 17DLW19 and 39FSDSF43 can be docked on the AP2 appendage domain with high confidence; aa78-98 docks with high confidence to an alpha helix in the α-subunit encoded by aa418-438. AlphaFold 3.0 modeling was performed using AlphaFold Server (Abramson et al., 2024) and structure images were generated using ChimeraX (Meng et al., 2023).
-
Figure 6—figure supplement 1—source data 1
PDF file containing original western blots for Figure 6—figure supplement 1C, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 6—figure supplement 1C.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig6-figsupp1-data2-v1.zip
Figure 7 with 1 supplement
Disease-causing nonsense mutation in CCDC32 loses AP2 interaction capacity and inhibits CME.
(A–C) IP of eGFP from ARPE-HPV cells that stably express eGFP-CCDC32(FL) or eGFP-CCDC32(1-54) using anti-GFP magnetic beads. (A) The domain structures of eGFP-CCDC32(FL) and eGFP-CCDC32(1-54). (B) Representative immunoblotting result of n=3 IP samples. (C) Relative AP2 enrichments quantified from immunoblotting results. (D) Representative TIRFM images of ARPE-HPV cells that stably express mRuby-CLCa and eGFP-CCDC32(1-54). White ROI is magnified on the right. Scale bar = 5 µm. (E) Cohort-averaged fluorescence intensity traces of CCPs and CCP-enriched eGFP-CCDC32(1-54). Number of tracks analyzed: 28658. (F–G) (F) TfnR uptake efficiency and (G) CCP% of ARPE-HPV cells that stably express eGFP-CCDC32(FL), eGFP, or eGFP-CCDC32(1-54), and with siRNA-mediated knockdown of endogenous CCDC32. Each dot in (G) represents a video. Statistical analysis of the data in (F) is two-tailed student’s t-test: ***, p≤0.001. Statistical analysis of the data in (G) is the Wilcoxon rank sum test, **, p≤0.01.
-
Figure 7—source data 1
Numerical data to generate Figure 7.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig7-data1-v1.xlsx
-
Figure 7—source data 2
PDF file containing original western blots for Figure 7B, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig7-data2-v1.zip
-
Figure 7—source data 3
Original files for western blot analysis displayed in Figure 7B.
- https://cdn.elifesciences.org/articles/107039/elife-107039-fig7-data3-v1.zip
Figure 7—figure supplement 1
A collection of representative TIRFM images from the main text showing cells that stably express the same amount of eGFP-CCDC32(FL), eGFP, eGFP-CCDC32(∆78–98), and eGFP-CCDC32(1-54).
Diffuse PM fluorescence is greatest for eGFP-CCDC32(FL), diminished, but detectable for eGFP-CCDC32(∆78–98), but absent for eGFP-CCDC32(1-54) and control eGFP. Scale bar = 5 µm. Blue dashed line indicates the background PM fluorescence of eGFP.
Figure 8
Cartoon illustration of CCDC32-AP2 interactions that regulate CME.
Interactions between residues 78–98, corresponding to a central α-helix of CCDC32, and AP2 are essential for recruitment of CCDC32 to CCPs. Depleting CCDC32 (∆CCDC32) inhibits CCP stabilization and invagination, resulting in enhanced CCS abortion and accumulated flat clathrin assembly intermediates. As a compensation effect, CCS initiation is enhanced and CCP maturation is faster, resulting in only slightly reduced cargo internalization. EAPs: endocytic accessory proteins.
Tables
Table 1
ID and abundances of key proteins detected in IP samples by Mass Spectroscopy analysis.
#1-#3: 3 independent repeats of control IPs; #4-#6: 3 independent repeats of AP2-α-eGFP IPs.
| Abundance | ||||||
|---|---|---|---|---|---|---|
| Control IPs | AP2-α-eGFP IPs | |||||
| Gene | #1 | #2 | #3 | #4 | #5 | #6 |
| AP2A1 | 2.E+06 | 1.E+06 | 6.E+05 | 1.E+08 | 1.E+08 | 2.E+08 |
| AP2A2 | 4.E+06 | 1.E+06 | 7.E+05 | 3.E+08 | 3.E+08 | 3.E+08 |
| AP2B1 | 7.E+06 | 6.E+06 | 3.E+06 | 7.E+08 | 6.E+08 | 6.E+08 |
| AP2M1 | 1.E+06 | 8.E+05 | 2.E+05 | 2.E+08 | 1.E+08 | 2.E+08 |
| AP2S1 | 1.E+05 | 5.E+04 | 9.E+03 | 2.E+07 | 2.E+07 | 5.E+07 |
| CCDC32 | 0.E+00 | 0.E+00 | 0.E+00 | 3.E+06 | 2.E+06 | 2.E+06 |
| AAK1 | 7.E+04 | 1.E+05 | 3.E+04 | 2.E+07 | 1.E+07 | 2.E+07 |
| EPS15 | 2.E+06 | 3.E+05 | 2.E+05 | 3.E+07 | 3.E+07 | 3.E+07 |
| EPS15L | 3.E+05 | 1.E+04 | 2.E+04 | 1.E+07 | 1.E+07 | 1.E+07 |
| FCHO2 | 4.E+04 | 3.E+04 | 2.E+04 | 1.E+06 | 1.E+06 | 1.E+06 |
| ITSN1 | 1.E+04 | 0.E+00 | 0.E+00 | 1.E+06 | 9.E+05 | 7.E+05 |
| ITSN2 | 0.E+00 | 0.E+00 | 0.E+00 | 0.E+00 | 0.E+00 | 8.E+04 |
| NECAP1 | 9.E+04 | 8.E+04 | 3.E+04 | 9.E+06 | 7.E+06 | 1.E+07 |
| NECAP2 | 1.E+05 | 7.E+03 | 1.E+04 | 2.E+07 | 2.E+07 | 2.E+07 |
| AAGAB | 9.E+00 | 0.E+00 | 0.E+00 | 3.E+06 | 4.E+06 | 7.E+06 |
Table 2
List of primers.
| Mutagenesis | Forward primer | Reverse primer |
|---|---|---|
| eGFP-CCDC32(∆78–98) | GCAGGATTCAGAAGTGTATGACATGC TTCGAACTCTG | CAGAGTTCGAAGCATGTCATACACTT CTGAATCCTGC |
| eGFP-CCDC32(FL)_siResistant | CAGGAAGTGACTTCCAAGGATATGTTACGC ACCCTGGCCCAAGCCAAGAAGGA | TCCTTCTTGGCTTGGGCCAGGGTGCGTAACA TATCCTTGGAAGTCACTTCCTG |
| eGFP-CCDC32(∆78–98)_siResistant | TCCCTTGCAGGATTCAGAAGTGTATGATATGTTACGCA CCCTGGCCCAAGCCAAGAA | TTCTTGGCTTGGGCCAGGGTGCGTAACATAT CATACACTTCTGAATCCTGCAAGGGA |
| Cloning | Forward primer | Reverse primer |
| backbone：pLVx-CMV100 | CGCCGCTAGCGCTAACTAGTATGGTGAGCAA GGGCGAG | GTCGGGCCCTCTAGACTCGAGTTACTGTTCTG CTGCTGCTG |
| insert gene：eGFP-CCDC32(FL) | ||
| backbone：pLVx-CMV100 | CGCCGCTAGCGCTAACTAGTATGGTGAGCAA GGGCGAG | CGGGCCCTCTAGACTCGAGTTACTTGTACAGCTC GTCCATGC |
| insert gene：eGFP | ||
| backbone：pLVx-CMV100 | CGCCGCTAGCGCTAACTAGTATGGTGAGCAA GGGCGAG | TCGGGCCCTCTAGACTCGAGCTACCTCTGGCCTTC ACCTTC |
| insert gene：eGFP-CCDC32(1-54) | ||
| backbone：pLVx-CMV100 | CGCCGCTAGCGCTAACTAGTATGGTGAGCAA GGGCGAG | GTCGGGCCCTCTAGACTCGAGTTACTGTT CTGCTGCTGCTG |
| insert gene：eGFP-CCDC32(∆78–98) |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain (E. coli) | BL21(DE3) | NEB: C2527H | Used for recombinant protein expression. | |
| Cell line (Homo sapiens) | HEK293T | ATCC: CRL-3216 | RRID:CVCL_0063 | Used for lentivirus packaging. |
| Cell line (Homo sapiens) | ARPE-19 | ATCC: CRL-2302 | RRID:CVCL_0145 | Adult Retinal Pigment Epithelial cell line. |
| Cell line (Homo sapiens) | ARPE-19-HPV16 (ARPE-HPV) | ATCC: CRL-2502 | RRID:CVCL_6338 | ARPE-19 cell line immortalized with HPV16. |
| Cell line (Homo sapiens) | ARPE-HPV eGFP-CLCa stable cell line | Chen et al., 2020 | doi:10.1083/jcb.201908189 | ARPE-HPV cells stably expressing eGFP-CLCa, generated in previous study. |
| Cell line (Homo sapiens) | ARPE-HPV AP2-α-eGFP stable cell line | Mino et al., 2020 | doi:10.1111/tra.12755 | ARPE-HPV cells stably expressing a fully functional AP2-α-eGFP (eGFP inserted at aa649). |
| Cell line (Homo sapiens) | ARPE-HPV mRuby-CLCa stable cell line | Srinivasan et al., 2018 | doi:10.1371/journal.pbio.2005377 | Generated by lentiviral infection of ARPE-HPV cells with mRuby-CLCa (from Srinivasan et al., 2018) and FACS sorting. |
| Transfected construct (Homo sapiens) | eGFP-CCDC32(FL) siRNA-resistant | This study | This study | Generated in this study and available from the corresponding author upon request. Generated by site-directed mutagenesis on #110505; retains wild-type amino acid sequence (aa98-102) but has altered nucleotide sequence to confer siRNA resistance. See Table 2 for primers. |
| Transfected construct (Homo sapiens) | pLVx-CMV100- eGFP | This study | This study | Generated in this study and available from the corresponding author upon request. |
| Transfected construct (Homo sapiens) | eGFP-CCDC32(1-54) (disease mimic) | This study | This study | Generated in this study and available from the corresponding author upon request. Our disease mimic construct. Lacks a 9 aa N-terminal peptide (VRGSCLRFQ) and contains an extra 12 aa C-terminal tag compared to the patient mutation described in Harel et al., 2020. |
| Transfected construct (Homo sapiens) | eGFP-CCDC32(Δ78–98) | This study | This study | Generated in this study and available from the corresponding author upon request. Generated by deleting amino acids 78–98 from the siRNA-resistant eGFP-CCDC32(FL) construct. See Table 2 for primers. |
| Recombinant DNA reagent | pLVx-CMV100 | Dean et al., 2016 | doi:10.1016 /j.bpj.2016.01.029 | Backbone vector for cloning eGFP, eGFP-CCDC32(1-54), eGFP-CCDC32(Δ78–98), and eGFP-CCDC32(FL). |
| Recombinant DNA reagent | pGEX-6P-1-GST | Sigma Aldrich | GE28-9546-48 | Vector for expression of GST tag protein. |
| Transfected construct (Homo sapiens) | pLVx-CMV100-eGFP | This study | This study | Generated in this study and available from the corresponding author upon request. |
| Transfected construct (Homo sapiens) | pLVx-CMV100-eGFP-CCDC32(1-54) | This study | This study | Generated in this study and available from the corresponding author upon request. |
| Transfected construct (Homo sapiens) | pLVx-CMV100-eGFP-CCDC32(Δ78–98) | This study | This study | Generated in this study and available from the corresponding author upon request. |
| Transfected construct (Homo sapiens) | pLVx-CMV100-eGFP-CCDC32(FL) | This study | This study | Generated in this study and available from the corresponding author upon request. |
| Transfected construct (Homo sapiens) | pLVx-IRES-puro-mRuby-CLCa | Srinivasan et al., 2018 | doi:10.1371/journal.pbio.2005377 | Generated in a previous study. |
| Recombinant DNA reagent | pGEX-2T-1-AP2-α-AD (aa701-938, mouse) | Kind gift of the late Linton Traub (University of Pittsburgh). GST fusion protein expression vector. | ||
| Recombinant DNA reagent | pGEX-4T-1-AP2-β-AD (aa592-937, rat) | Kind gift of the late Linton Traub (University of Pittsburgh). GST fusion protein expression vector. | ||
| Antibody (Mouse monoclonal) | Anti-GFP (mouse monoclonal) | Proteintech: Cat# 66002–1-Ig | RRID:AB_11182611 | (1:1000) Used for Western Blotting. |
| Antibody (Rabbit polyclonal) | Anti-Vinculin (rabbit polyclonal) | Proteintech: Cat# 26520–1-AP | RRID:AB_2868558 | (1:40,000) Used for Western Blotting (loading control). |
| Antibody (Rabbit polyclonal) | Anti-C15orf57/CCDC32 (rabbit polyclonal) | Invitrogen / Thermo Fisher Scientific: Cat# PA5-98982 | RRID:AB_2813595 | (1:10,000) Used for Western Blotting to detect endogenous CCDC32 and confirm knockdown. |
| Antibody (Mouse monoclonal) | Anti-α-Adaptin 1/2 (C-8) (mouse monoclonal) | Santa Cruz Biotechnology: Cat# sc-17771 | RRID:AB_2274034 | (1:2000) Used in Western Blotting to detect AP2 enrichment after co-IP. |
| Antibody (Mouse monoclonal) | HTR-D65 (anti-TfnR mAb) (mouse monoclonal) | BioXcell | doi:10.1083/jcb.114.5.869 | (1:200) Primary antibody for labeling surface Transferrin Receptor (TfnR). Used at 5 µg/mL. |
| Antibody (Goat polyclonal) | HRP Goat anti-Mouse IgG (H+L) (goat polyclonal) | Bio-Rad: Cat# 1706516 | RRID:AB_2921252 | (1:5000) Secondary antibody for detection in ELISA. |
| Antibody (Rabbit polyclonal) | Anti-GAPDH Rabbit pAb (rabbit polyclonal) | Abclonal: Cat# AC001 | RRID:AB_2619673 | (1:2000) Used for Western Blotting (loading control). |
| Antibody (Rabbit polyclonal) | HRP Goat Anti-Rabbit IgG (H+L) (rabbit polyclonal) | Abclonal: Cat#AS014 | RRID:AB_2769854 | (1:2000) Secondary antibody for detection in WB. |
| Antibody (Mouse polyclonal) | HRP Goat Anti-Mouse IgG (H+L) (mouse polyclonal) | Abclonal: Cat#AS013 | RRID:AB_2768597 | (1:500) Secondary antibody for detection in WB. |
| Antibody (Rabbit polyclonal) | AP2B1 (rabbit polyclonal) | Proteintech: Cat#15690–1-AP | RRID:AB_2056351 | (1:5000) Used in Western Blotting to detect AP2 enrichment after co-IP. |
| Antibody (Rabbit monoclonal) | AP2M1 (rabbit monoclonal) | Aifang biological: Cat# AF300772 | (1:1000) Used in Western Blotting to detect AP2 enrichment after co-IP. | |
| Antibody (Rabbit monoclonal) | AP2S1 (rabbit monoclonal) | Aifang biological: Cat# AF302671 | (1:500) Used in Western Blotting to detect AP2 enrichment after co-IP. | |
| Recombinant DNA reagent | pEGFP-C1-CCDC32(FL, human) cDNA | Addgene: Cat# 110505 | Parental plasmid from which mutants were generated. | |
| Sequence-based reagent | siRNA: siCCDC32 | Thermo Fisher Scientific (Silencer Select): ID#: s228444 | Targets nucleotide sequence encoding aa98-102 of human CCDC32; Used for knockdown. | |
| Sequence-based reagent | siRNA: siControl (negative control) | Thermo Fisher Scientific (Silencer Select): Cat#: 4390843 | Silencer Select Negative Control #1 siRNA. | |
| Commercial assay or kit | NEBuilder HiFi DNA Assembly Master Mix | New England Biolabs: Cat# E2621 | Used for cloning constructs into pLVx-CMV100. | |
| Commercial assay or kit | Anti-GFP Magnetic Beads | Biolinkedin: Cat# L1016 | Used for immunoprecipitation of GFP-tagged proteins. | |
| Commercial assay or kit | BCA Protein Assay Kit | Thermo Fisher: Cat# 23225 | Used to determine protein concentration in lysates. | |
| Commercial assay or kit | GSTrap HP Column | Cytiva: Cat# 17528201 | Used for affinity purification of GST-fusion proteins. | |
| Commercial assay or kit | Anti-GST Beads | Biolinkedin: Cat# L-2004 | Used for GST pull-down assays. | |
| Chemical compound, drug | Triton X-100 | BBI: Cat# A600198-0500 | Used at 0.5% in lysis buffer. | |
| Chemical compound, drug | Phalloidin | Sigma-Aldrich: Cat# P2141 | Used in PEM buffer at 2 µM for cytoskeleton stabilization during unroofing. | |
| Chemical compound, drug | Taxol (Paclitaxel) | Sigma-Aldrich: Cat# T7402 | Used in PEM buffer at 10 µM for microtubule stabilization during unroofing. | |
| Software, algorithm | Proteome Discoverer (v2.4) | Thermo Fisher Scientific | RRID:SCR_014477 | Used for raw MS data analysis. |
| Software, algorithm | cmeAnalysis | Aguet et al., 2013; Jaqaman et al., 2008 | GitHub: DanuserLab/cmeAnalysis | Used for tracking clathrin-coated structures. |
| Software, algorithm | DASC | Wang et al., 2020 | GitHub: DanuserLab/cmeAnalysis | Used for unbiased classification of CCPs vs. abortive coats. |
| Software, algorithm | ImageJ / Fiji | NIH | RRID:SCR_003070 | Used for measuring CCS area and calculating membrane occupancy. |
| Other | Opti-MEM | Thermo Fisher Scientific: Cat# 31985070 | Reduced-serum medium Used for siRNA transfection. | |
| Other | Protease Inhibitor Cocktail | APE ×BIO: Cat# K1015 | Added to lysis buffer. | |
| Other | µ-Dish 35 mm, high Glass Bottom (gelatin-coated) | Ibidi: Cat# 81218–800 | Used for live-cell imaging. |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
CCDC32 stabilizes clathrin-coated pits and drives their invagination
eLife 14:RP107039.
https://doi.org/10.7554/eLife.107039.3
