A quantitative in vivo CRISPR-imaging platform identifies regulators of hyperplastic and hypertrophic adipose morphology in zebrafish
- Institute for Neuroscience and Cardiovascular Research, Edinburgh BioQuarter, College of Medicine and Veterinary Medicine, University of Edinburgh, United Kingdom
Figures
Figure 1 with 2 supplements
Experimental workflow.
(1) Identification of candidate morphology genes from bulk RNA-Seq of human subcutaneous adipose tissue (SAT), comparing genes enriched in small versus large adipocytes (Honecker et al.). (2) Filtering for expression in adipose stem and progenitor cells using sn/scRNA-Seq of 16 white adipose tissue (WAT) cell types (Emont et al.). (3) Gene Ontology (GO) term enrichment analysis to focus on genes involved in development and differentiation processes. (4) Prioritisation of candidate genes based on protein conservation to zebrafish and expression dynamics during adipocyte progenitor differentiation. (5) In vivo F0 CRISPR screen in zebrafish using multiple guide RNAs (gRNAs) per gene to quantify lipid droplet morphology (hyperplastic versus hypertrophic).
Figure 1—figure supplement 1
Expression clustering of candidate adipose morphology genes across human white adipose tissue (WAT) cell types.
Heatmap showing relative expression (log-normalised counts) of 2980 candidate morphology-associated genes across 16 human WAT cell types from Emont et al., 2022. Genes without annotations or detectable expression in the single-cell dataset were excluded. Hierarchical clustering of genes (rows) and cell types (columns) was performed using average linkage with Pearson correlation distance. Cell types are colour-coded and labelled below: adipocytes, mesothelial cells, endothelial cells (including lymphatic endothelial cells [LECs]), adipose stem and progenitor cells (ASPCs), smooth muscle cells (SMCs) and pericytes, endometrium, mast cells, dendritic cells, monocytes and macrophages, T and natural killer (NK) cells, B cells, and neutrophils. Coloured dots (right) correspond to cell-type identity in the dendrogram (top).
Figure 1—figure supplement 2
Integrative analysis of adipose morphology genes across cardiometabolic traits, genome-wide association study (GWAS) loci, Gene Ontology (GO) terms, and single-cell expression profiles.
The 102 candidate morphology genes enriched in adipose stem and progenitor cells (ASPCs) were characterised across multiple data sources. Left panel: Heatmap of β coefficients from linear regression of gene expression in human subcutaneous adipose tissue (SAT) against 23 cardiometabolic traits from the METSIM cohort (Civelek et al., 2017). Blue indicates negative and red indicates positive associations. Genes and traits are hierarchically clustered. Traits include measures of body composition and adiposity (body mass index [BMI], waist circumference, waist-to-hip ratio [WHR], hip circumference, FM), lipids (HDL-C, LDL-C, cholesterol, TAG, total FAs, FFA), glycaemia and insulin sensitivity (HbA1c, glucose, insulin, proinsulin, HOMA-B, Muscle Insulin Sensitivity Index [MISI]), inflammation (CRP, IL-1R antag.), blood pressure (SBP, DBP), renal function (GFR), and adipokines (adiponectin). Centre columns (left to right): Adipocyte size association – brown and orange bars indicate genes enriched in large or small adipocytes, respectively (Honecker et al., 2022). GWAS overlap – teal boxes indicate genes at genome-wide significant loci for BMI or WHR-adjusted BMI. GO biological process – colour-coded boxes indicate membership in enriched GO terms as shown in the legend: cell differentiation (GO:0030154), cell development (GO:0048869), negative regulation of cellular process (GO:0048523), tissue development (GO:0009888), developmental process (GO:0032502), and negative regulation of biological process (GO:0048519). Right panel: Dot plots showing expression of each gene across human WAT single-cell clusters (Emont et al., 2022; Yang Loureiro et al., 2023). Dot size represents percentage of cells expressing; colour intensity represents scaled mean expression. Cell populations shown are: human ASPC subclusters (hASPCs1-6), MGP+, ADIPOQ+ non-induced progenitors, and others.
Figure 2
Prioritisation of candidate adipose morphology genes based on conservation to zebrafish and expression dynamics during progenitor differentiation.
(a) Gene Ontology (GO) term enrichment analysis of the 102 candidate morphology genes enriched in adipose stem and progenitor cells. Four GO terms related to development and differentiation were significantly enriched, encompassing 54 genes. (b) Venn diagram showing gene overlap between the enriched GO terms. Cell differentiation (GO:0030154) and cellular developmental process (GO:0048869) had 100% overlap. (c) Protein conservation and expression during adipocyte progenitor differentiation for each candidate gene. Grey bars denote percentage protein similarity between human and zebrafish orthologues. Dot plots show scaled mean expression (colour) and percentage of cells expressing each gene (dot size) across four cell populations identified during in vitro progenitor differentiation: non-induced progenitors, MGP+ SWAT cells, ADIPOQ+ adipogenic cells and others (Yang Loureiro et al., 2023). Genes are ordered by protein similarity. (d) PCA projection of single cells coloured by cluster designation from Yang Loureiro et al., 2023. (e) Expression of selected candidate morphology genes projected onto the PCA embedding, illustrating enrichment during specific stages of adipocyte differentiation.
Figure 3
Spatial dynamics of subcutaneous adipose growth in zebrafish.
(a) Nile Red-stained zebrafish at 11.6 mm standard length (SL). Black signal denotes Nile Red-positive neutral lipid within adipose tissue. Magenta dashed box indicates the region shown in (b). (b) Higher magnification of the subcutaneous adipose depot. Magenta outlines highlight segmented lipid droplets (LDs). Dashed line indicates the operculum. (c) Zoomed view of individual subcutaneous adipose LDs. White dots are melanosome pigment granules. (d) LD segmentation masks (magenta outlines) corresponding to (c). (e) Segmented subcutaneous adipose LDs from four representative zebrafish of increasing body size, colour-coded by LD diameter. Fish sizes are shown in mm SL. Dashed lines demarcate strata defined at 200 μm intervals from the most anterior LD. (f) Number of LDs per stratum as a function of zebrafish body size. Fish were grouped into five SL categories (colour-coded). Lines represent fitted curves; dots represent individual fish. (g) Mean LD diameter per stratum as a function of zebrafish body size (n=107 fish). Lines and colour coding as in (f).
Figure 4 with 1 supplement
Derivation of the adipose morphology value from the relationship between lipid droplet size and adipose depot size.
(a) Diameter of subcutaneous adipose lipid droplets (LDs) plotted against total depot area. Light grey dots represent individual LDs; dark grey dots represent the mean LD diameter per fish. Black line was fitted using a generalised additive model (GAM; R2=0.85, n=194 fish). (b) Distribution of morphology values, calculated as the residual deviation of each fish’s mean LD diameter from the GAM fit in (a). Positive values indicate larger LDs than expected (hypertrophic); negative values indicate smaller LDs than expected (hyperplastic). Black line shows a normal density fit. (c) Morphology value plotted against number of LDs per fish, showing an inverse relationship (linear model, p=3.9 × 10–6, n=194 fish). Fish with hypertrophic morphology tend to have fewer, larger LDs, while fish with hyperplastic morphology have more numerous, smaller LDs.
Figure 4—figure supplement 1
Image-based adipose morphology profiling detects hypertrophic lipid droplet (LD) expansion in gh1 CRISPR mutants.
(a) Nile Red fluorescence images showing adiposity in a representative Cas9-only control (top) and gh1 F0 CRISPR mutant (bottom) at ~1 month of age. Black signal denotes Nile Red-positive neutral lipid. Dotted line indicates operculum. (b) High-magnification images of subcutaneous adipose tissue (SAT) from Cas9-only control and gh1 CRISPant zebrafish. Cyan outlines show automated segmentation of individual LDs. Scale bar is 200 µm. (c) Kernel density plot of morphology values for gh1 mutants (n=9, cyan) compared to baseline wild-type fish (n=194, grey). Morphology values were significantly increased in gh1 mutants (Kolmogorov-Smirnov test, p=0.04), indicating a shift towards hypertrophic morphology.
Figure 5
A targeted CRISPR screen in zebrafish identifies genes regulating hypertrophic or hyperplastic adipose morphology.
(a) Overview of CRISPR screen structure. In total, 1371 fish were screened (738 Cas9-only controls and 633 mutants) across 25 candidate genes. Two genes (phb and rerea) were lethal before 5 days post fertilisation (dpf). Of the remaining genes, zero altered standard length, one (kazna) significantly increased total adiposity, and three (txnipa, mmp14b and foxp1b) produced significant hypertrophic subcutaneous adipose morphology. (b) Sample sizes per gene. Grey bars indicate Cas9-only controls; blue bars indicate mutants. aspa had the smallest and prrx1b the largest sample size. (c) Left panel: number of experimental replicates per gene. The majority of targets had two replicates: aspa had one replicate, and nav3, prrx1b, tbx15, and txnipa had three. Right panel: replicate consistency scores, representing agreement in effect direction and magnitude across replicates. Genes are ordered by consistency score. (d–f) Forest plots showing effect sizes (% change from Cas9-only controls) for standard length (d, magenta), total adiposity (e, green), and morphology value (f, blue). Small grey dots represent individual mutant fish; medium grey circles represent experiment means; coloured diamonds represent gene-level estimates from linear mixed models (LMMs) with experiment as a random effect. Morphology value represents the deviation in lipid droplet (LD) Feret diameter from that expected given total depot area, with positive values indicating hypertrophy and negative values indicating hyperplasia. Asterisks denote BH-adjusted p<0.05. (g) Scatter plot of depot (subcutaneous adipose tissue [SAT]) lipid area (% change from controls) versus morphology value (LMM estimate, % change from controls) for each gene. Point size reflects sample size. Quadrants indicate the combination of depot size and cell morphology phenotype (e.g. bigger depot with hypertrophic cells). (h) Probability density functions (left) and cumulative distribution functions (right) of morphology values for foxp1b, txnipa, mmp14b, and kazna F0 mutants (blue) compared with matched Cas9-only controls (grey). Dashed lines indicate group means. (i) Representative Nile Red images of foxp1b, txnipa, mmp14b, and kazna F0 mutants showing total adiposity. e, eye. Scale bar: 1 mm. (j) Segmented subcutaneous adipose LDs from representative mutant fish, colour-coded by LD diameter. Scale bar: 200 μm.
Figure 6 with 6 supplements
Stable foxp1b zebrafish mutants have hypertrophic adipose but undergo severely reduced hypertrophic remodelling in response to a high-fat diet (HFD).
(a) Phylogenetic tree showing relatedness of zebrafish Foxp1a and Foxp1b amino acid sequences to human, mouse, opossum, and coelacanth Foxp1. Scale bar indicates substitutions per site. (b) Overview of human FOXP1 domain structure showing polyglutamine (polyQ), coiled-coil, and forkhead domains. Zoomed view of the DNA-binding forkhead domain showing structural features, including helices (helices 1–5) and beta-strands (s1–s3). Amino acids involved in DNA binding are highlighted in blue; residues at the FOXP domain-swapped dimer interface are highlighted in orange. Wild-type zebrafish Foxp1a and Foxp1b sequences are aligned to human FOXP1, along with the ed116 (foxp1a) and ed125 (foxp1b) mutant alleles. Grey boxes indicate the addition of nonsense peptide sequence followed by a premature stop codon. (c) Western blot showing reduction of Foxp1 protein in foxp1a;foxp1b double mutants compared to wild-type. β-Actin serves as a loading control. Asterisk indicates the Foxp1 band. (d) Nile Red fluorescence images showing adipose lipid distribution (black signal) in wild-type, foxp1aed116, foxp1bed125, and double foxp1aed116;foxp1bed125 zebrafish mutants. e, eye. Asterisk indicates lipid accumulation within the liver in double mutants. Scale bar is 1 mm. (e) Violin plots of fish size (standard length, mm) in foxp1aed116, foxp1bed125, and double foxp1aed116;foxp1bed125 mutants compared to wild-type siblings. (f) Violin plots of normalised adipose area in the same genotypes. (g) Violin plots of average lipid droplet (LD) diameter in the same genotypes. (h) Schematic of the HFD feeding experiment. Zebrafish were Nile Red-imaged at 35 days post fertilisation (dpf) to establish baseline adipose measurements, then subjected to a 14-day HFD (2 hr daily immersion in 5% chicken egg yolk) or control diet (2 hr daily immersion in system water), in addition to normal feeding. Post-diet Nile Red imaging was performed at 49 dpf. Subcutaneous adipose tissue was divided into anterior-posterior strata for spatial analysis. 200 μm strata are numbered anterior (1) to posterior. (i) Segmented subcutaneous adipose LDs from representative wild-type, foxp1a, and foxp1b fish on control diet (left) and after HFD (right), colour-coded by LD diameter. Strata boundaries (200 μm) are indicated by dashed lines. (j) Average LD diameter per stratum for wild-type and foxp1b fish on control diet (grey or salmon) and HFD (black or pink). Thin lines represent individual fish; thick lines represent group means. (k) HFD effect on LD diameter per stratum (HFD minus control diet) for wild-type (black) and foxp1b (pink). Filled circles indicate strata where the HFD effect is significant (BH-adjusted p<0.05). (l) As in (J), comparing wild-type and foxp1a. (m) As in (k), comparing wild-type (black) and foxp1a (teal). Statistical tests in (e–g) were one-way ANOVA followed by Tukey’s HSD post hoc test. **p<0.01, ***p<0.001, ns = not significant.
-
Figure 6—source data 1
Original western blot to verify Foxp1 knockdown in double foxp1aed116 and foxp1bed125 mutants.
Note, ‘ed16’ and ‘ed25’ in the blot correspond to the foxp1aed116 and foxp1bed125 alleles in the manuscript. The red box highlights the section of the blot shown in Figure 6c.
- https://cdn.elifesciences.org/articles/107327/elife-107327-fig6-data1-v1.zip
-
Figure 6—source data 2
Original western blot with bands highlighted to verify Foxp1 knockdown in double foxp1aed116 and foxp1bed125 mutants.
- https://cdn.elifesciences.org/articles/107327/elife-107327-fig6-data2-v1.zip
Figure 6—figure supplement 1
Stable foxp1a and foxp1b mutant alleles lead to reduced transcript and protein expression.
(a) qRT-PCR showing significantly reduced foxp1a mRNA expression in homozygous foxp1aed116 mutants compared to heterozygotes and wild-type siblings. (b) Expression of other foxp1 family genes in foxp1aed116 mutants shows no evidence of compensatory upregulation. (c) Western blot of Foxp1 protein in foxp1a wild-type (+/+) and foxp1aed116 mutant caudal fin lysates. Foxp1 protein is markedly reduced in mutants. β-Actin serves as a loading control. (d) qRT-PCR showing significantly reduced foxp1b mRNA in foxp1bed125 mutants compared to heterozygotes and wild-type siblings. (e) Expression of other foxp family genes (foxp1a, foxp2, foxp3a, foxp3b, foxp4) in foxp1bed125 mutants. foxp3a and foxp3b are significantly downregulated in heterozygotes; however, this likely reflects defective amplification in those samples, as homozygous mutants show no change. (f) Western blot of Foxp1 protein in foxp1b wild-type (+/+) and foxp1bed125 caudal fin lysates, showing reduced Foxp1 protein in mutants. β-Actin was used as a loading control. Error bars represent standard error of the mean (SEM). ***p<0.001, by unpaired two-tailed t-test.
-
Figure 6—figure supplement 1—source data 1
Original western blot to verify Foxp1 knockdown in foxp1aed116 mutants.
Note, ‘ed16’ in the blot corresponds to the foxp1aed116 allele in the manuscript. ‘ed23’ in the blot corresponds to an allele not included and not relevant to this article. The red box highlights the section of the blot shown in Figure 6—figure supplement 1c.
- https://cdn.elifesciences.org/articles/107327/elife-107327-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Original western blot to verify Foxp1 knockdown in foxp1bed125 mutants.
Note, these are mutants for foxp1bed125 and an additional foxp1a allele not included in this article. In the blot, genotypes are separated by a colon with the foxp1a allele first, and foxp1bed125 second (e.g. foxp1a allele;ed125). So, +/+; –/– corresponds to a foxp1a wild-type and foxp1bed125 homozygous mutant genotype. The red boxes highlight the lanes shown in Figure 6—figure supplement 1f.
- https://cdn.elifesciences.org/articles/107327/elife-107327-fig6-figsupp1-data2-v1.zip
Figure 6—figure supplement 2
Metabolic phenotypes of foxp1a, foxp1b, and foxp1a;foxp1b mutant zebrafish following dietary challenge.
(a) Plasma glucose, triglyceride (TAG), and cholesterol levels in foxp1aed116 mutants and wild-type siblings under control diet (CD) or high-fat diet (HFD) conditions. HFD induced a significant increase in TAG across genotypes (two-way ANOVA: F1,19 = 26.07, p<0.0001). No significant genotype or diet effects were observed for glucose or cholesterol. (b) Plasma glucose, TAG, and cholesterol in foxp1bed125 mutants and wild-type controls under CD and HFD. TAG levels were modestly influenced by diet (two-way ANOVA: F1,16=0.88, p=0.0468), with no significant effects detected for glucose or cholesterol. (c) Circulating glucose, TAG, and cholesterol levels in foxp1aed116;foxp1bed125 double mutants. Double mutants exhibited significantly elevated glucose levels (p<0.05, unpaired t-test), while TAG and cholesterol levels were unchanged. (d) Quantification of liver lipid accumulation in foxp1aed116;foxp1bed125 double mutants revealed significantly increased hepatic lipid deposition compared to controls (p<0.001, unpaired t-test). Error bars represent standard deviation (SD). ns = not significant.
Figure 6—figure supplement 3
Adiposity in adult foxp1aed116;foxp1bed125 zebrafish mutants.
(a) Representative Nile Red-stained images of adult male wild-type and foxp1aed116;foxp1bed125 double mutant zebrafish. Lipid-rich adipose tissue appears as a dark black signal. Scale bar = 1 mm. (b) Total adipose area plotted against standard length (SL, μm) in adult wild-type (grey) and foxp1a;foxp1b mutants (orange). A regression line is fitted for each group, showing reduced adiposity in mutants relative to controls (μm2). (c) Comparison of adiposity in foxp1a;foxp1b mutants relative to wild-type siblings at juvenile and adult stages. While adiposity was markedly reduced in juveniles, it recovered to ~80% of wild-type levels by adulthood.
Figure 6—figure supplement 4
Impaired adipose expansion in all foxp1 mutant genotypes following high-fat diet (HFD).
Violin plots showing change in subcutaneous adipose area (Δ adipose area) after 2 weeks of HFD exposure in wild-type and foxp1aed116, foxp1bed125, and double mutant foxp1aed116;foxp1bed125 zebrafish. All three mutant genotypes exhibited significantly reduced adipose expansion compared to wild-type controls, indicating impaired capacity to remodel adipose in response to nutritional excess. Sample sizes are shown at right. Asterisks indicate statistically significant differences (*p<0.05), by one-way ANOVA followed by Tukey’s HSD post hoc test.
Figure 6—figure supplement 5
Spatial analysis of lipid droplet (LD) size along the anterior-posterior axis in foxp1a and foxp1b mutants following high-fat diet (HFD) challenge.
(a) Representative Nile Red fluorescence montages of the subcutaneous adipose depot in wild-type and foxp1aed116 fish under control diet (CD) and HFD conditions. (b) Representative Nile Red montages of wild-type and foxp1bed125 fish under CD and HFD conditions. (c) Mean LD diameter (µm) per 200 µm stratum along the anterior-posterior axis for wild-type (grey) and foxp1aed116 mutants (teal) under CD (light) and HFD (dark). Lines represent LOESS fits with shaded 95% confidence intervals; dots represent individual stratum means per fish. Strata are numbered from anterior (1) to posterior (15). (d) Individual fish traces for each group in the foxp1a experiment. Thin lines represent individual fish; thick lines with shading represent group means. Sample sizes are indicated. (e) Mean LD diameter per stratum for wild-type (grey) and foxp1bed125 mutants (pink/red) under CD and HFD, plotted as in (c). (f) Individual fish traces for each group in the foxp1b experiment, plotted as in (d).
Figure 6—figure supplement 6
Decomposition of diet and genotype effects on lipid droplet (LD) size across the anterior-posterior axis in foxp1a and foxp1b mutants.
Effect on mean LD diameter (µm) is plotted per 200 µm stratum for foxp1aed116 (left) and foxp1bed125 (right) experiments. Four contrasts are shown: (a) diet effect (high-fat diet [HFD] minus control) in wild-type siblings (black); (b) diet effect in mutants (dark grey); (c) genotype effect (mutant minus wild-type) under control diet (medium grey); (d) genotype effect under HFD (light grey). Dashed horizontal line indicates zero effect. Filled circles denote strata where the effect was statistically significant (Benjamini-Hochberg adjusted p<0.05).
Tables
Table 1
Zebrafish gene targets and adipose morphology statistics.
Adjusted p-values after Benjamini-Hochberg false discovery rate (FDR) correction for 21 statistical tests. KS = Kolmogorov-Smirnov test. LMM = linear mixed model with experiment as random effect. Values in bold indicate statistical significance. Gene names in bold indicate robust phenotypes (significant in both stratified KS and LMM). Stratified KS tests were performed within each experiment and combined using Fisher’s method. Genes with only one replicate (aspa, lamb2) or which showed lethality (phb, rerea) are not included in this table.
| Gene | Reps | n (ctrl/mut) | KS test | LMM | Direction | Power (d=0.8) | |||
|---|---|---|---|---|---|---|---|---|---|
| Effect (μm) | Pooled (FDR adj. p value) | Stratified (FDR adj. p value) | Effect (%) | FDR adj. p value | |||||
| txnipa | 3 | 45/30 | +4.6 | 0.066 | 1.41e-04 | +19.9% | 1.63e-04 | Hypertrophic | 92% |
| mmp14b | 2 | 34/30 | +5.4 | 0.002 | 0.005 | +15.8% | 1.93e-04 | Hypertrophic | 88% |
| foxp1b | 2 | 42/45 | +8.8 | 0.064 | 0.019 | +17.0% | 0.049 | Hypertrophic | 96% |
| ptprdb | 2 | 35/24 | +4.0 | 0.080 | 0.057 | +18.5% | 0.087 | Hypertrophic | 84% |
| cxcl14 | 2 | 27/24 | –4.4 | 0.522 | 0.077 | –8.7% | 0.348 | Hyperplastic | 80% |
| prrx1b | 3 | 65/60 | –3.5 | 0.178 | 0.077 | –5.9% | 0.358 | Hyperplastic | 99% |
| ptenb | 2 | 27/25 | –4.7 | 0.054 | 0.077 | –7.9% | 0.411 | Hyperplastic | 81% |
| pid1 | 2 | 27/26 | –2.7 | 0.869 | 0.204 | –6.5% | 0.565 | Hyperplastic | 81% |
| nav3 | 3 | 49/42 | –2.4 | 0.194 | 0.562 | –6.1% | 0.650 | Hyperplastic | 96% |
| sdk1a | 2 | 29/25 | +0.6 | 0.869 | 0.482 | +7.6% | 0.694 | Hypertrophic | 82% |
| runx1t1 | 2 | 29/22 | +1.1 | 0.706 | 0.795 | +7.6% | 0.736 | Hypertrophic | 79% |
| sparc | 2 | 24/23 | –2.1 | 0.286 | 0.553 | –7.1% | 0.736 | Hyperplastic | 77% |
| kazna | 2 | 36/23 | –3.1 | 0.706 | 0.148 | –4.7% | 0.759 | Hyperplastic | 84% |
| tmem115 | 2 | 27/29 | –3.1 | 0.488 | 0.019 | –3.8% | 0.759 | Hyperplastic | 84% |
| cd81a | 2 | 24/26 | +0.0 | 0.862 | 0.064 | –5.0% | 0.759 | Hypertrophic | 79% |
| lrmda | 2 | 27/22 | –0.4 | 0.527 | 0.077 | –2.7% | 0.778 | Hyperplastic | 78% |
| tbx15 | 3 | 37/26 | +3.4 | 0.706 | 0.019 | +3.7% | 0.778 | Hypertrophic | 87% |
| cacnb4a | 2 | 29/27 | +0.9 | 0.706 | 0.852 | +2.6% | 0.804 | Hypertrophic | 84% |
| pard3ab | 2 | 36/32 | –1.5 | 0.869 | 0.750 | +2.1% | 0.804 | Hypertrophic | 90% |
| ptprga | 2 | 35/35 | –1.4 | 0.269 | 0.077 | –1.6% | 0.804 | Hyperplastic | 91% |
| srpx | 2 | 36/20 | –5.7 | 0.155 | 0.204 | –0.9% | 0.836 | Hyperplastic | 80% |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Danio rerio, juvenile fish prior to overt sex differentiation) | WIK | Rauch et al., 1997 | ZFIN: ZDB-GENO-010531-2 | |
| Genetic reagent (Danio rerio) | foxp1a | This manuscript | ed116 | New zebrafish foxp1a mutant – 13 bp indel in forkhead domain |
| Genetic reagent (Danio rerio) | foxp1b | This manuscript | ed125 | New zebrafish foxp1b mutant – 4 bp indel in forkhead domain |
| Sequence-based reagent | foxp1a | IDT | CRISPR gRNA | GACGAGTGGAGAATGTGAAG |
| Sequence-based reagent | foxp1b | IDT | CRISPR gRNA | GATAACGAAGCATACGTGAA |
| Commercial assay or kit | KASP on demand genotyping assays | LGC Biosearch Technologies | foxp1aed116 and foxp1bed125 specific assays | |
| Commercial assay or kit | Glucose assay | Biovision | K606-100 | |
| Commercial assay or kit | Triacylglyceride assay | Biovision | K622-100 | |
| Commercial assay or kit | Cholesterol assay | Biovision | K623-100 | |
| Commercial assay or kit | Luna Universal qPCR Master Mix | NEB | Cat #: M3003L | |
| Sequence-based reagent | foxp1a | IDT | PCR primers for T7E1 assay (ed116) | Forward primer – GCCAGATTGGACTGGATGTT |
| Sequence-based reagent | foxp1a | IDT | PCR primers for T7E1 assay (ed116) | Reverse primer – TTATTTCCAGGCCATTCTGG |
| Sequence-based reagent | foxp1b | IDT | PCR primers for T7E1 assay (ed125) | Forward primer – TTCAGTTTCAGCTCCTTCCTTC |
| Sequence-based reagent | foxp1b | IDT | PCR primers for T7E1 assay (ed125) | Reverse primer – TGGAAGTCAAGCTACCAGCA |
| Antibody | Anti-FOXP1 polyclonal antibody (rabbit) | Thermo Fisher | Cat #: PA5-26848 | 1:1000 dilution |
| Antibody | Anti-β-Actin (ACTB) antibody (mouse) | Sigma-Aldrich | Cat #: A2228 | 1:25,000 dilution |
| Chemical compound, drug | Nile Red | Sigma-Aldrich | Cat #: 19123 | |
| Peptide, recombinant protein | Cas9 | New England Biolabs | Cat #: M0646T | |
| Peptide, recombinant protein | T7 Endonuclease I | New England Biolabs | Cat #: M0302S | |
| Software, algorithm | GProfiler | Kolberg et al., 2023 | RRID:SCR_006809 | |
| Software, algorithm | Single Cell Portal | Tarhan et al., 2023 | RRID:SCR_014816 | |
| Software, algorithm | Morpheus | Gould, 2022 | RRID:SCR_014975 | |
| Software, algorithm | Heatmapper | Babicki et al., 2016 | RRID:SCR_016974 | |
| Software, algorithm | GWAS Catalog | Cerezo et al., 2025 | https://www.ebi.ac.uk/gwas/ | |
| Software, algorithm | DIOPT | Hu et al., 2011 | https://www.flyrnai.org/diopt | |
| Software, algorithm | UCSC Genome Browser | Casper et al., 2026 | RRID:SCR_005780 | |
| Software, algorithm | CHOPCHOP | Labun et al., 2019 | RRID:SCR_015723 | |
| Software, algorithm | Cellpose | Stringer et al., 2021 | RRID:SCR_022332 | |
| Software, algorithm | Fiji/ImageJ | Schindelin et al., 2012 | RRID:SCR_002285 | |
| Software, algorithm | Napari | Sofroniew et al., 2026 | RRID:SCR_022765 | |
| Software, algorithm | R Statistical software v. 4.5.1 | R Project for Statistical Computing | RRID:SCR_001905 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/107327/elife-107327-mdarchecklist1-v1.docx
-
Supplementary file 1
Differentially expressed genes from Honecker et al., 2022.
- https://cdn.elifesciences.org/articles/107327/elife-107327-supp1-v1.xlsx
-
Supplementary file 2
The 102 candidate adipose morphology genes from this study.
- https://cdn.elifesciences.org/articles/107327/elife-107327-supp2-v1.xlsx
-
Supplementary file 3
GO term enrichment analysis to prioritise candidate adipose morphology genes.
- https://cdn.elifesciences.org/articles/107327/elife-107327-supp3-v1.xlsx
-
Supplementary file 4
Guide RNA sequences used for the F0 CRISPR screen.
- https://cdn.elifesciences.org/articles/107327/elife-107327-supp4-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A quantitative in vivo CRISPR-imaging platform identifies regulators of hyperplastic and hypertrophic adipose morphology in zebrafish
eLife 14:RP107327.
https://doi.org/10.7554/eLife.107327.3
