Conduction pathway for potassium through the Escherichia coli pump KdpFABC
- Department of Biochemistry and Molecular Pharmacology, NYU School of Medicine, United States
- Department of Molecular Biology and Genetics, Aarhus University, Denmark
Figures
Figure 1 with 3 supplements
Cryo-EM structure of KdpFABC in nanodiscs.
(A) Overview of the density map with subunits rendered in conventional colors corresponding to those in panel (B). The Post-Albers reaction scheme is shown in the inset. (B) Diagram illustrating the transmembrane topology of KdpFABC. (C) Rendering of the unsharpened map at a lower density threshold illustrates the presence of the membrane scaffolding protein surrounding the nanodisc. (D) Detail of the nucleotide binding site of KdpB showing ADP associated with two Mg2+ ions and the phosphorylated catalytic residue: Asp307. (E) Detail of the newly resolved N-terminus of KdpB revealing a potential interaction between Glu161, Arg3, Asp552, and Lys557. Panels (A), (C), and (E) show the unsharpened map at thresholds of 7, 3, and 4 σ, respectively; panel (D) shows the sharpened map at 3.9 σ.
Figure 1—figure supplement 1
Biochemical preparation of KdpFABC.
(A) Polyacrylamide gel of nanodisc sample used for cryo-EM showing the presence of KdpA, KdpB, KdpC, and the membrane scaffolding protein, spNW25. KdpF is not visible due to its small size (3 kD); typically, it stains poorly and runs very near the dye front of the gel. (B) Elution profile from size-exclusion column of the sample used for making cryo-EM grids; the main peak is composed of nanodiscs containing KdpFABC and the smaller peak contains empty nanodiscs. Slight asymmetry of the main peak is consistent with a subpopulation of nanodiscs containing two KdpFABC complexes (Figure 1—figure supplement 2). (C, D) Multi-angle light scattering analysis of the HPLC-SEC elution profile from nanodiscs reconstituted with POPC/DOPA lipids and E. coli polar lipids, respectively. This analysis indicates DOPC/DOPA lipids produce smaller nanodiscs containing ~1 KdpFABC molecule (C), whereas E. coli polar lipids produce larger, more heterogeneous nanodiscs (D). (E) ATPase activity is preserved after nanodisc reconstitution, though at a reduced rate attributable to the lipid environment. Data represents 3–6 technical replicates with SEM. (F) Transport current measured by solid supported membrane electrophysiology showing K+ dependence of WT KdpFABC. One trace for each K+ concentration is shown. (G) Mg2+ dependence of ATPase activity indicates a Hill coefficient (n) of ~1.8, which is consistent with the two Mg2+ ions associated with ADP in the structure. Data represents three technical replicates with SEM. (H) Inductively coupled plasma mass spectrometry analysis of stock solutions used for ATPase assay indicates substantial K+ contamination from ATP and MgCl2 solutions. Data from mass spectrometry represent the mean and std. dev. of triplicate measurements.
-
Figure 1—figure supplement 1—source data 1
Source data for Figure 1—figure supplement 1B–H, which includes all individual data points used for these plots.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig1-figsupp1-data1-v1.xlsx
-
Figure 1—figure supplement 1—source data 2
Uncropped gel shown in Figure 1—figure supplement 1a.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig1-figsupp1-data2-v1.zip
-
Figure 1—figure supplement 1—source data 3
Uncropped gel shown in Figure 1—figure supplement 1a with annotations.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig1-figsupp1-data3-v1.zip
Figure 1—figure supplement 2
Cryo-EM processing pipeline.
Four grids from a single sample were imaged to produce a total of ~50,000 micrographs. These were divided into ten groups of 2000–6000 micrographs for initial processing. After motion correction and determination of defocus parameters, particles were picked using TOPAZ and extracted with a box size of 335 Å and threefold binning. Multiple rounds of 2D classification (a few examples of 2D classes are shown) and ab initio reconstruction were used to remove false positive picks and empty nanodiscs. A subset of these particles was further classified to generate four main classes representing nanodiscs with a single copy of KdpFABC in either E1 or E2 conformations, nanodiscs with two copies of KdpFABC (double) which were mainly E1 conformation, and junk. These low-resolution structures were used as references for hetero-refinement of particles partitioned in seven groups. Particles conforming to each conformation were combined and used for masked 3D classification, where the mask encompassed the cytoplasmic domains of KdpB. Particles representing the E1~P·ADP conformation, which represented the largest class, were combined for a final non-uniform refinement job.
-
Figure 1—figure supplement 2—source data 1
Source data for the Fourier shell coefficient plot in Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig1-figsupp2-data1-v1.xlsx
Figure 1—figure supplement 3
Cryo-EM densities.
Correlation between map densities and model for individual transmembrane helices from KdpA as well as transmembrane helices and cytoplasmic domains of KdpB. The sharpened map was used for helices and the P-domain with a threshold of 5.7 σ, whereas the unsharpened map was used for the more flexible A- and N-domains at 2.5 σ.
Figure 2 with 4 supplements
Selectivity filter of KdpA.
(A) The map reveals densities at all sites (S1–S4) of the selectivity filter. Because the density at the S3 site is the highest in the entire map (Figure 2—figure supplement 1A), it has been assigned as a K+ ion (purple sphere). Gray mesh corresponds to the sharpened map at 6.5 σ. (B, C) ATPase and transport assays (respectively) illustrate that Q116R and G232D mutations lower the apparent affinity of the pump (Km values in mM shown in the legend). Background activity is consistently observed for the WT, which is likely due to K+ contamination in stock solutions (Figure 1—figure supplement 1H). The location of Gln116 is shown in panel (A), G232 is out of the plane in this image, but can be seen in Figure 2—figure supplement 1B. (D) Mapping of electrostatic charge indicates that the entrance to the selectivity filter of the WT pump is strongly negative, which would help attract positively charged ions. A K+ ion is visible in the selectivity filter as a purple sphere. (E, F) Substitution of Glu116 has differing effects that reflect changes in net charge at the entrance to the selectivity filter. (G–I) Transport assays with various monovalent cations show that the strong selectivity of the WT pump is compromised by the G232D mutation but not by the Q116R mutation. Table 2 shows measurements from transport assays that are broadly consistent with these ATPase data. Data are derived from 3–8 technical replicates as reflected in the source data and the error bars represent SEM. Raw data for the transport assays are shown in Figure 2—figure supplements 2–4.
-
Figure 2—source data 1
Source data for Figure 2B, C, E–I, which includes all individual data points used for these plots.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Selectivity filter of KdpA.
(A) Distribution of raw densities for the entire sharpened map. The arrow indicates the threshold used for rendering the map in Figure 2 (0.5 which corresponds to 6.5 σ). The inset shows the extreme tail in the density distribution; the highest four densities (circled at >50 σ) correspond to the K+ ion modeled at the S3 site. (B) Coordination of densities in the selectivity filter in the refined model. The regular network of bonds at the S3 site suggests that this is the high-affinity binding site for K+, whereas less regular coordination at other sites is consistent with water.
-
Figure 2—figure supplement 1—source data 1
Source data for the histogram in Figure 2—figure supplement 1A.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig2-figsupp1-data1-v1.xlsx
Figure 2—figure supplement 2
Current traces for WT KdpFABC.
Raw data from replicate SSME titrations using WT KdpFABC are shown. The ions used for each titration are shown along the left margin. Each panel represents a single titration with ion concentrations indicated in the legend. Four replicate titrations from two different sensors were recorded for each ion. Sharp spikes in some of the traces are generally due to air bubbles in the microfluidic system and were not included in the analysis.
-
Figure 2—figure supplement 2—source data 1
Source data for Figure 2—figure supplement 2 includes all the raw data from WT for the traces shown in this figure.
Each tab in the file contains data for one panel with the ion concentration indicated in the first row in mM and the time listed in the first column in seconds.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig2-figsupp2-data1-v1.xlsx
Figure 2—figure supplement 3
Current traces for Q116R.
Raw data from replicate SSME titrations using the Q116R mutant in KdpA are shown. The ions used for each titration are shown along the left margin. Each panel represents a single titration with ion concentrations indicated in the legend. Four replicate titrations from two different sensors were recorded for each ion. Transient peaks seen for Rb+ and NH4+ are likely due to pre-steady state binding events and not to sustained transport of these ions. As a result, data for analysis were taken at 1.25 s, which is after this pre-steady state signal has decayed. Sharp spikes in some of the traces are generally due to air bubbles in the microfluidic system and were not included in the analysis.
-
Figure 2—figure supplement 3—source data 1
Source data for Figure 2—figure supplement 3 includes all the raw data from the Q116R mutant for the traces shown in this figure.
Each tab in the file contains data for one panel with the ion concentration indicated in the first row in mM and the time listed in the first column in seconds.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig2-figsupp3-data1-v1.xlsx
Figure 2—figure supplement 4
Current traces for G232D.
Raw data from replicate SSME titrations using the G232D mutant in KdpA are shown. The ions used for each titration are shown along the left margin. Each panel represents a single titration with ion concentrations indicated in the legend. Four replicate titrations from two different sensors were recorded for each ion. Sharp spikes in some of the traces are generally due to air bubbles in the microfluidic system and were not included in the analysis.
-
Figure 2—figure supplement 4—source data 1
Source data for Figure 2—figure supplement 3 includes all the raw data from the G232D mutant for the traces shown in this figure.
Each tab in the file contains data for one panel with the ion concentration indicated in the first row in mM and the time listed in the first column in seconds.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig2-figsupp4-data1-v1.xlsx
Figure 3
Vestibule of KdpA.
(A) The map reveals numerous spherical densities immediately below the selectivity filter and leading into the tunnel that connects KdpA with KdpB. Glu370 and Arg493 are the only charged residues in the transmembrane domain of KdpA and reside on either side of this vestibule. Gray mesh corresponds to the sharpened map at 6.5 σ. (B) Slice through a surface rendering of the model for KdpFABC showing location of the vestibule pictured in panel (A). (C) ATPase assays of E370Q and E370H show that neutralization of charge on Glu370 reduces the apparent affinity without affecting Vmax, but that reversing the charge with E370K almost completely abolishes activity. The double mutant E370K/R493E partially restores activity, but with much lower apparent affinity and Vmax. (D) ATPase assays show that mutation of Arg493 has relatively modest effects on apparent affinity without affecting Vmax. Note that the axis with Km is logarithmic. Table 3 shows measurements from transport assays that are broadly consistent with these ATPase data. Data in panels (C) and (D) were derived from three technical replicates plotted with SEM; statistical significance was evaluated by one-way ANOVA analysis: **p<0.01, ***p<0.001 and ns indicates ‘not significant’.
-
Figure 3—source data 1
Source data for Figure 3C and D, which includes all individual data points used for these plots.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig3-data1-v1.xlsx
Figure 4 with 1 supplement
Tunnel connecting KdpA and KdpB.
(A) The inter-subunit tunnel is shown as a transparent blue surface running from the selectivity filter on the right (S3) to the canonical binding site on the left (near Asn624). Non-protein densities within the tunnel have been modeled as water molecules (small spheres). Asp370, Arg493 in the vestibule and Phe232 at the subunit interface are shown as space-filling models and K+ as large purple spheres. As in other figures, KdpA helices are green and KdpB helices are brown; KdpF is cyan. (B) The distribution of water molecules within the tunnel shows that the vestibule is well populated, whereas the subunit interface is quite hydrophobic. Values along the x-axis correspond to the contour length along the tunnel. (C) Tunnel profiles for the experimentally determined model (WT) and predicted models for the Val496 mutants. The horizontal dotted line at a radius of 1.4 Å represents the conventional limit for passage of water or K+ ions. Note that both V496R and V496W constrict the tunnel. SF and CBS indicate locations of the selectivity filter and canonical binding site, respectively. (D) ATPase assays of the Val496 mutants in 150 mM K+ showing that introduction of positive charge (V496R) abolishes activity. Data was derived from six technical replicates and plotted with SEM. Raw data for the transport assays are shown in Figure 4—figure supplement 1.
-
Figure 4—source data 1
Source data for Figure 4B–D, which includes individual data points used for these plots.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Transport activity of Val496 mutants.
(A) Comparison of ATPase and transport activities from reconstituted proteoliposomes of WT and Val496 mutants. A small amount of detergent (1 mg/ml DM) was added to proteoliposomes to prevent buildup of electrochemical gradients during the ATPase assays, whereas transport was measured from intact proteoliposomes by SSME. Effects of the mutations are comparable to those seen prior to reconstitution (Figure 4) and indicate that energy coupling is not affected. Data were derived from 3 to 6 technical replicates as reflected in the source data and the error bars represent SEM. (B–G) Raw data from SSME recordings (top) as well as gel filtration profiles (bottom) are shown for WT and Val496 mutants. SSME traces represent six replicates recorded in 100 mM K+ taken from two individual sensors. Note that the V496R mutant displays a highly transient peak consistent with a pre-steady state binding event, with very little sustained transport current. The gel filtration profiles characterize the final step of purification with all mutants producing a relatively symmetric peak at a consistent elution volume, thus indicating that Val496 mutation does not affect stability or homogeneity of the preparation.
-
Figure 4—figure supplement 1—source data 1
Source data for Figure 4—figure supplement 1 includes all the data shown in this figure.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig4-figsupp1-data1-v1.xlsx
Figure 5 with 3 supplements
Canonical binding site in KdpB.
(A) Several non-protein densities are visible at the canonical binding site, the most prominent of which occupies the conserved Na2/Ca2 site from Na,K-ATPase and SERCA (Figure 5—figure supplement 1). This site has the highest density in KdpB (Figure 5—figure supplement 2B) and thus has been modeled as K+ (purple sphere), whereas the others are modeled as water (red spheres). Gray mesh corresponds to the sharpened map at 5.8 σ. (B) Asp583 and Lys586 are the only charged residues in the transmembrane domain of KdpB. ATPase and transport assays in 150 mM K+ show that mutation of these residues is generally not tolerated, except for the D583A mutation that generates an uncoupled phenotype (ATPase activity without transport). Data was derived from 3 to 8 technical replicates as reflected in the source data and error bars represent SEM. Raw data for the transport assays are shown in Figure 5—figure supplement 3. (C) Slice through a surface rendering of the model for KdpFABC showing location of the CBS pictured in panel (A).
-
Figure 5—source data 1
Source data for Figure 5B, which includes all individual data points used for this plot.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Canonical binding sites of P-type ATPases.
The primary K+ binding site in KdpB is structurally conserved with ion binding sites for Na+ in Na,K-ATPase and Ca2+ in SERCA. Whereas multiple ions are transported in each cycle by these related P-type ATPases, only a single ion appears to bind to KdpB at a position equivalent to the Na2 and Ca2 sites. Like those sites, the K+ in KdpB is coordinated by carbonyl oxygens exposed by the unwinding of the M4 helix near a conserved proline (Figure 5—figure supplement 2). Additional ions bind in a pocket between M4, M5, and M6 in Na,K-ATPase and SERCA, which is occupied by weaker densities in KdpB that are modeled as water.
Figure 5—figure supplement 2
Properties of the canonical binding site in KdpB.
(A) Coordination network involving K+ and water molecules in the canonical binding site. (B) Distribution of raw densities for KdpB portion of the sharpened map, with the inset highlighting the highest two densities (>30 σ), both of which correspond to the K+ ion modeled at the canonical binding site (CBS). The arrow indicates the density threshold used for rendering the map in Figure 5 (0.45 which corresponds to 5.8 σ). (C) ATPase activity of the KdpB-D583A mutant showing uncoupled activity at low K+ that is inhibited at higher K+ concentrations. Data were derived from three technical replicates, and the error bars represent SEM.
-
Figure 5—figure supplement 2—source data 1
Source data for Figure 5—figure supplement 1 includes all the data shown in panels B and C.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig5-figsupp2-data1-v1.xlsx
Figure 5—figure supplement 3
Current traces from CBS mutants.
Raw data from replicate SSME titrations in 100 mM K+ using mutants in the CBS of KdpB. WT protein is included as a positive control. Each panel shows six replicates taken from two individual sensors and indicates very little transport activity from these mutants.
-
Figure 5—figure supplement 3—source data 1
Source data for Figure 5—figure supplement 3 includes all the raw data traces shown in this figure.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig5-figsupp3-data1-v1.xlsx
Figure 6 with 2 supplements
Exit site from KdpB.
(A) The map shows a water-filled cavity next to Thr75 that leads to the cytoplasm (sharpened map at 6.5 σ). (B) Slice through a surface rendering of the model for KdpFABC showing location of the exit site pictured in panel (A). (C, D) pH dependence of the T75D mutant is shifted relative to WT, consistent with the idea that high pH generates negative charge in this cavity and inhibits K+ release. (E) The T75K substitution not only interferes with transport, but also produces an uncoupled phenotype in which ATPase activity is not dependent on K+. At high pH, there is a small recovery of transport activity as well as K+-dependence of ATPase activity, suggesting that these effects result from the positive charge from the lysine substitution. Data was derived from six technical replicates and plotted with SEM. Raw data for the transport assays are shown in Figure 6—figure supplement 2.
-
Figure 6—source data 1
Source data for Figure 6C–E, which includes all individual data points used for these plots.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Exit site for K+ from KdpB.
(A) Comparison of the canonical binding site from E1~P (this study) and E2·Pi determined previously by Sweet et al., 2021 (PDB code 7BGY). In particular, movements of M5 cause Lys586 to swing into the canonical binding site in E2·Pi, thus displacing the K+. (B) Comparison of the exit site from wild-type E1~P model with a predicted model for the T75K mutant. In this predicted structure, the lysine side chain occupies the canonical binding site, thus potentially acting as a built-in ion to stimulate ATPase activity in the absence of K+. (C) pH dependence of both ATPase activity and transport from the KdpB-L72D mutant. Like the T75D mutant, the pH dependence of activity is shifted towards low pH. Although the rates are lower than WT and T75D, the K+ dependence of ATPase activity indicates that energy coupling is intact. Data were derived from six technical replicates and the error bars represent SEM.
-
Figure 6—figure supplement 1—source data 1
Source data for Figure 6—figure supplement 1 includes all the raw data shown in panel C.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig6-figsupp1-data1-v1.xlsx
Figure 6—figure supplement 2
Current traces from exit site mutants.
Raw data from replicate SSME pH titrations using mutants in the exit site of KdpB. WT protein is included as a control. Each panel shows six replicates taken from two individual sensors at the pH indicated across the top border. Sharp spikes in the traces are generally due to air bubbles in the microfluidic system. These spikes appear amplified for T75K due to the compressed current range of this largely inactive mutant; such spikes were not included in the analysis.
-
Figure 6—figure supplement 2—source data 1
Source data for Figure 6—figure supplement 2 includes all the raw data traces shown in this figure.
- https://cdn.elifesciences.org/articles/107397/elife-107397-fig6-figsupp2-data1-v1.xlsx
Figure 7
Conduction pathway of KdpFABC.
Diagram illustrating features of the conduction pathway seen in the E1~P·ADP map together with residues that have been mutated in this study. Ions (purple spheres) are attracted from the periplasm to the mouth of the selectivity filter of KdpA by negative surface potential. Selectivity and affinity of the pump is governed by tight coordination of the ion at the S3 site. Ions become rehydrated upon release into a vestibule filled with water (red spheres) next to charged residues Glu370 and Arg493. Val496 resides in the widest part of the tunnel where introduction of positive charge abolishes transport. Phe232 resides at the subunit interface where there is a hydrophobic barrier that is essential to ion occlusion. K+ binding to the canonical binding site next to Pro264 on M4 in KdpB triggers phosphorylation of Asp307 followed by allosteric movements of M5 that drive Lys586 to displace the ion into the exit site next to Thr75. A general lack of ligands in this exit site is consistent with low affinity, thus promoting K+ release to the cytoplasm against the electrochemical gradient.
Tables
Table 1
Structure determination of KdpFABC.
| Deposition | |
|---|---|
| PDB | 9OC4 |
| EMDB | EMD-70308 |
| Data collection and processing | |
| Magnification | 130kx |
| Voltage (kV) | 300 |
| Electron exposure (e–/Å2) | 50 |
| Defocus range (μm) | 1.0–3.0 |
| Pixel size (Å) | 0.93 |
| Symmetry imposed | C1 |
| Initial particle images (no.) | 10,382,000 |
| Final particle images (no.) | 672,405 |
| Map resolution | 2.09 |
| Fourier shell correlation threshold (Å) | 0.143 |
| B factor (Å2) | 59.2 |
| Resolution range (Å) | 2–3.5 |
| Model refinement | |
| Model composition | |
| Non-hydrogen atoms | 11,068 |
| Protein residues | 1455 |
| Ligands | 7 |
| Root mean square deviations | |
| Bond lengths (Å) | 0.005 |
| Bond angles (°) | 1.026 |
| Validation | |
| MolProbity score | 1.45 |
| Clashscore | 5.91 |
| Rotamer outliers (%) | 1.23 |
| CaBLAM outliers (%) | 1.46 |
| Rama-Z score | 0.63 |
| Ramachandran plot | |
| Favored (%) | 97.71 |
| Allowed (%) | 2.29 |
| Disallowed (%) | 0.00 |
| Model vs. data CC (mask) | 0.86 |
Table 2
Summary of apparent affinities of the selectivity filter mutations measured by ATPase and transport assays.
| mutants | ATPase*Km (mM) | transport†Km (mM) |
|---|---|---|
| WT | ||
| K+ | 0.04±0.01 | 0.23±0.10 |
| Rb+ | 30.71±13.45 | 38.88±22.45 |
| NH4+ | - ‡ | - ‡ |
| Na+ | - ‡ | - ‡ |
| G232D | ||
| K+ | 21.17±2.66 | 3.76±0.58 |
| Rb+ | - § | 3.22±1.06 |
| NH4+ | - § | 10.17±4.16 |
| Na+ | - ‡ | - ‡ |
| Q116R | 21.45±2.66 | 5.19±0.12 |
| Q116E | 0.09±0.02 | 0.11±0.46 |
-
*
Average of N=3 independent measurements with SEM.
-
†
Average of N=4 independent measurements with SEM.
-
‡
Little activity above baseline prevented Km determination.
-
§
Protein instability in detergent solution interfered with accurate Km determination.
Table 3
Summary of apparent affinities of the vestibule mutations measured by ATPase transport assays.
| mutants | ATPase*Km (mM) | transport†Km (mM) |
|---|---|---|
| WT | 0.023±0.01 | 0.23±0.10 |
| E370Q | 0.76±0.24 | 1.32±0.58 |
| E370H | 0.53±0.11 | 0.35±0.12 |
| E370K | 74.95±25.8 | - ‡ |
| E370K_R493E | 3.63±0.74 | 0.43±0.08 |
| R493E | 0.14±0.04 | 0.50±0.23 |
| R493Q | 0.32±0.06 | 1.52±0.68 |
| R493M | 0.61±0.13 | 0.47±0.08 |
-
*
Average of N=3 independent measurements with SEM.
-
†
Average of N=4 independent measurements with SEM.
-
‡
Little activity above baseline prevents Km determination.
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Escherichia coli) | KdpFABC | Huang et al., 2017 | Uniprot IDs: kdpA: P03959 kdpC: P03961 kdpB: P03960 kdpF: P36937 | |
| Strain, strain background (Escherichia coli) | TK2281 | Wolfgang Epstein | Protein expression strain: thi, rha, lacZ, nagA, trkA405, trkD1, Δ(kdpFABCDE)81 | 10.1016/0076-6879(88)57113-6 |
| Strain, strain background (Escherichia coli) | BL21 STAR (DE3) | Invitrogen, Carlsbad, CA | Protein expression strain | |
| Recombinant DNA reagent | pBAD | Invitrogen, Carlsbad, CA | Empty vector (plasmid) | |
| Recombinant DNA reagent | pET28a-spNW25 | Addgene ID: 173484 | Plasmid for expression of nanodisc scaffolding protein | Zhang et al., 2021 |
| Sequence-based reagent | G232D_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCTCGGTACTAACGACGGTGGCTTCTTTAAT |
| Sequence-based reagent | G232D_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | ATTAAAGAAGCCACCGTCGTTAGTACCGAGC |
| Sequence-based reagent | Q116E_For | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CACCAATACCAACTGGGAATCTTATAGCGGTGAAACCACGTTG |
| Sequence-based reagent | Q116E_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CTATAAGATTCCCAGTTGGTATTGGTGACAAAGCTGAC |
| Sequence-based reagent | Q116H_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CAATACCAACTGGCACTCTTATAGCGGTGAAACCACGTTG |
| Sequence-based reagent | Q116H_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCTATAAGAGTGCCAGTTGGTATTGGTGACAAAG |
| Sequence-based reagent | R493M_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GTTTGTCGGTATGTTCGGGGTGATTATCCCGG |
| Sequence-based reagent | R493M_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CCCGAACATACCGACAAACATGCAGAAC |
| Sequence-based reagent | R493E_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GTTTGTCGGTGAGTTCGGGGTGATTATCCCGGTG |
| Sequence-based reagent | R493E_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CCCGAACTCACCGACAAACATGCAGAACGC |
| Sequence-based reagent | R493Q_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GTTTGTCGGTCAGTTCGGGGTGATTATCCCGGTG |
| Sequence-based reagent | R493Q_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CCCGAACTGACCGACAAACATGCAGAACG |
| Sequence-based reagent | E370Q_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CAAATTGGTCAAGTGGTGTTCGGCGG |
| Sequence-based reagent | E370Q_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GAACACCACTTGACCAATTTGCATCAGCCACATCAGCCACATCG |
| Sequence-based reagent | E370K_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CAAATTGGTAAAGTGGTGTTCGGCGG |
| Sequence-based reagent | E370K_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CGAACACCACTTTACCAATTTGCATCAGCCAC |
| Sequence-based reagent | E370H_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CAAATTGGTCACGTGGTGTTCGGCGGTGTC |
| Sequence-based reagent | E370H_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GAACACCACGTGACCAATTTGCATCAGCCACATCG |
| Sequence-based reagent | V496M_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCTTCGGGATGATTATCCCGGTGATGGCAATTG |
| Sequence-based reagent | V496M_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GGGATAATCATCCCGAAGCGACCGACAAAC |
| Sequence-based reagent | V496E_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCTTCGGGGAGATTATCCCGGTGATGGCAATTG |
| Sequence-based reagent | V496E_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GGGATAATCTCCCCGAAGCGACCGACAAAC |
| Sequence-based reagent | V496R_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCTTCGGGCGGATTATCCCGGTGATGGCAATTG |
| Sequence-based reagent | V496R_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GGGATAATCCGCCCGAAGCGACCGACAAAC |
| Sequence-based reagent | V496H_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCTTCGGGCACATTATCCCGGTGATGGCAATTGC |
| Sequence-based reagent | V496H_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GGGATAATGTGCCCGAAGCGACCGACAAAC |
| Sequence-based reagent | V496W_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CTTCGGGTGGATTATCCCGGTGATGGC |
| Sequence-based reagent | V496W_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GGGATAATCCACCCGAAGCGACCGA |
| Sequence-based reagent | D583A_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CAGCATTGCCAACGCTGTGGCGAAATACTTCG |
| Sequence-based reagent | D583A_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CGAAGTATTTCGCCACAGCGTTGGCAATGCTG |
| Sequence-based reagent | D583N_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CATTGCCAACAATGTGGCGAAATACTTCGCCAT |
| Sequence-based reagent | D583N_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CGCCACATTGTTGGCAATGCTGAAGGTGGTC |
| Sequence-based reagent | D583K_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CATTGCCAACAAGGTGGCGAAATACTTCGCCATTATTC |
| Sequence-based reagent | D583K_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CGCCACCTTGTTGGCAATGCTGAAGGTGGTCAG |
| Sequence-based reagent | K586A_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CCAACGATGTGGCGGCATACTTCGCCATTATTC |
| Sequence-based reagent | K586A_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CCAACGATGTGGCGGCATACTTCGCCATTATTC |
| Sequence-based reagent | K586H_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GATGTGGCGCATTACTTCGCCATTATTCCGGCG |
| Sequence-based reagent | K586H-R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GATGTGGCGCATTACTTCGCCATTATTCCGGCG |
| Sequence-based reagent | K586Q_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GATGTGGCGCAATACTTCGCCATTATTCCGGCG |
| Sequence-based reagent | K586Q_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCGAAGTATTGCGCCACATCGTTGGCAATG |
| Sequence-based reagent | K586E_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GATGTGGCGGAATACTTCGCCATTATTCCGGCG |
| Sequence-based reagent | K586E_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCGAAGTATTCCGCCACATCGTTGGCAATG |
| Sequence-based reagent | T75D_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GTGGATCGACGTACTGTTCGCTAATTTCGC |
| Sequence-based reagent | T75D_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GAACAGTACGTCGATCCACAGCCAACCGC |
| Sequence-based reagent | T75K_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GTGGATCAAGGTACTGTTCGCTAATTTCGCCG |
| Sequence-based reagent | T75K_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GCGAACAGTACCTTGATCCACAGCCAACCGCT |
| Sequence-based reagent | L72D_F | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | CGGTTGGGACTGGATCACCGTACTGTTCG |
| Sequence-based reagent | L72D_R | Primer was ordered from Integrated DNA Technologies (IDT) | PCR primer | GTGATCCAGTCCCAACCGCTAATGGCC |
| Peptide, recombinant protein | spNW25 MSP protein | This study. Protein was expressed and purified as described in the ‘Materials and methods’ section | Nanodisc scaffolding protein | Zhang et al., 2021 |
| Chemical compound, drug | 1-palmitoyl-2-oleoyl-glycero- 3-phosphocholine (POPC) | Avanti Polar Lipids, Alabaster, AL | Lipid | |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero- 3-phosphate (DOPA) | Avanti Polar Lipids, Alabaster, AL | Lipid | |
| Chemical compound, drug | 1,2-diphytanoyl-sn- glycero-3-phosphocholine | Avanti Polar Lipids, Alabaster, AL | Lipid | |
| Chemical compound, drug | n-Decyl-β-D-Maltopyranoside | anatrace | Detergent | |
| Software, algorithm | cryoSPARC | Structura Biotechnology | RRID:SCR_016501 | |
| Software, algorithm | RELION | Scheres, 2012 | 5.0 | https://www3.mrc-lmb.cam.ac.uk/relion/index.php/Main_Page |
| Software, algorithm | Chimera | Pettersen et al., 2004 | RRID:SCR_004097 | |
| Software, algorithm | ChimeraX | Meng et al., 2023 | RRID:SCR_015872 | |
| Software, algorithm | PyMOL | Schrodinger | RRID: SCR_000305 | |
| Software, algorithm | PHENIX | Adams et al., 2010 | RRID:SCR_014224 | |
| Software, algorithm | COOT | Emsley et al., 2010 | RRID:SCR_014222 | |
| Software, algorithm | PRISM | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | CAVER | https://caver.cz/ | Caver Analyst 2.0 | |
| Software, algorithm | cavervolume.py | This study | Python script | 10.5281/zenodo.16928540 |
| Software, algorithm | water_profile.py | This study | Python script | 10.5281/zenodo.16928540 |
| Software, algorithm | ASTRA 5.3.4.20 | Wyatt Technology | MALS analysis software | |
| Others | SURFE2R N1 sensors 3 mm | Nanion Technologies, Livingston, NJ | SSME measurement instrument | |
| Others | C-Flat 1.2/1.3-4Cu-50 grids | Protochips, Inc | Cryo-EM grids |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Conduction pathway for potassium through the Escherichia coli pump KdpFABC
eLife 14:RP107397.
https://doi.org/10.7554/eLife.107397.4
