The horizontally-acquired response regulator SsrB drives a Salmonella lifestyle switch by relieving biofilm silencing
- National University of Singapore, Singapore
- Nanyang Technological University, Singapore
- University of Illinois-Chicago, United States
Figures
Figure 1 with 3 supplements
Loss of ssrB but not ssrA decreases Salmonella Typhimuirum biofilms.
(A) The defect in formation of biofilms in the ssrB null was complemented by the overexpression of SsrBc from plasmid pKF104 in trans as measured by crystal violet staining. (B) The typical rdar …
-
Figure 1—source data 1
Source data for crystal violet staining in Figure 1A,F and G.
- https://doi.org/10.7554/eLife.10747.004
Figure 1—figure supplement 1
The ssrB mutant is not defective in growth compared to the wild type strain.
Number of colonies formed by the wild type, ssrA, ssrB and D56A strains were the same order of magnitude across all the time points tested. Source data file: Figure 1—figure supplement 1—source data …
-
Figure 1—figure supplement 1—source data 1
Growth curves of wild type, ssrA, ssrB and D56A strains.
- https://doi.org/10.7554/eLife.10747.006
Figure 1—figure supplement 2
The planktonic sub-population of the ssrB strain was higher by two orders of magnitude compared to the wild type, ssrA and D56A strains at 2 days.
n = 2, Mean ± SD, p < 0.05. Source data file: Figure 1—figure supplement 2—source data 1.
-
Figure 1—figure supplement 2—source data 1
Number of cells in the planktonic sub-population of each strain.
- https://doi.org/10.7554/eLife.10747.008
Figure 1—figure supplement 3
Total wet weight of the adherent sub-population was decreased by at least 50% in the ssrB strain compared to the wild type, ssrA and D56A strains at 2 days.
n = 2, Mean ± SD, p < 0.05 for the ssrB strain versus ssrA/D56A strains and p = 0.08 for the ssrB strain versus wild type. Source data file: Figure 1—figure supplement 3—source data 1.
-
Figure 1—figure supplement 3—source data 1
Total wet weight of the adherent sub-population of each strain.
- https://doi.org/10.7554/eLife.10747.010
Figure 2
Phosphorylation of SsrB is not required for biofilm formation.
Amount of biofilms formed as measured by crystal violet staining for (A) Strains ssrAH1, ssrAD, ssrAH2, ssrAH1AcP, ssrADAcP, ssrAH2AcP and (B) D56A SsrB shows similar levels to that of the wild …
-
Figure 2—source data 1
Source data for crystal violet staining in Figure 2A and B.
- https://doi.org/10.7554/eLife.10747.012
-
Figure 2—source data 2
Source data for the measurement of beta-galactosidase activity in Figure 2C.
- https://doi.org/10.7554/eLife.10747.013
Figure 3
SsrB regulates biofilms by a CsgD-dependent mechanism.
(A) The SPI-2 needle, ssaC and ssaJ mutant strains were not affected in biofilm formation. (B) Over-expression of csgD from a plasmid (pBR328::csgD) in trans rescued biofilm formation in the ssrB …
-
Figure 3—source data 1
Source data for crystal violet staining in Figure 3A and B.
- https://doi.org/10.7554/eLife.10747.015
-
Figure 3—source data 2
Source data for Real-time qRT-PCR in Figure 3C.
- https://doi.org/10.7554/eLife.10747.016
Figure 4
hns deletion rescues biofilm formation in the ssrB mutant as shown by Crystal violet staining.
(A) The amount of biofilms formed is higher in the wild type, hns and ssrB hns strains compared to the ssrB null, n = 3, Mean ± SD, p < 0.0001. Source data file: Figure 4—source data 1. Macrocolony …
-
Figure 4—source data 1
Source data for crystal violet staining in Figure 4A.
- https://doi.org/10.7554/eLife.10747.018
-
Figure 4—source data 2
Source data for Real-time qRT-PCR in Figure 4D.
- https://doi.org/10.7554/eLife.10747.019
Figure 5 with 3 supplements
SsrB binds upstream of csgD.
(A) AFM images of the 755 bp csgD regulatory region (csgD755). (B) At 120 nM SsrB, distinct areas of SsrB binding were visualized as sharp bends (yellow arrows). (C) At 300 nM SsrB, areas of …
Figure 5—figure supplement 1
AFM images of the 755 bp csgD regulatory region (csgD755) (A) with 120 nM D56ASsrB and (B) SsrBc.
Distinct areas of binding were visualized as sharp bends (yellow arrows) and as areas of condensation (pink arrows) at 300 nM D56A SsrB (C) and SsrBc (D); Scale bar = 200 nm as in Figure 5A.
Figure 5—figure supplement 2
Bending angle of the naked csgD755 fragment.
https://doi.org/10.7554/eLife.10747.022
Figure 5—figure supplement 3
Electrophoretic mobility shift assay with the 122 bp csgD regulatory region, csgD122, showing a DNA-protein complex in the presence of SsrB.
The K179A SsrB mutant did not bind to csgD122. Addition of competitor unlabelled csgD122 fragment decreased the SsrB-DNA complex as apparent by an increase in free, labelled csgD122.
Figure 6 with 4 supplements
SsrB condenses H-NS bound csgD DNA.
(A) (i) AFM imaging in the presence of 600 nM H-NS shows a straight and rigid filament on csgD755. (ii) Addition of 600 nM SsrB to the H-NS bound csgD DNA resulted in areas of condensation (pink …
Figure 6—figure supplement 1
Liquid AFM imaging of (A) the 755 bp csgD regulatory region.
(B) In the presence of 600 nM H-NS, a straight and rigid filament was observed (yellow line). (C) In the presence of 300 nM SsrB, areas of condensation were evident (pink arrow). (D) Addition of 600 …
Figure 6—figure supplement 2
SsrB D56A and SsrBc condense H-NS-bound csgD DNA.
AFM imaging in the presence of H-NS shows areas of condensation upon addition of (A) 600 nM D56ASsrB and (B) 600 nM SsrBc; Scale bar = 200 nm as in Figure 5A.
Figure 6—figure supplement 3
SsrB and H-NS form a complex on csgD.
Electrophoretic mobility shift assay with the 122 bp csgD regulatory region, csgD122 (left to right); in the presence of SsrB and H-NS, the DNA-protein complex (*) is super-shifted in the presence …
Figure 6—figure supplement 4
The sequence of the 755 bp csgD regulatory region indicating the H-NS binding region according to Gerstel et al. (2003); and the SsrB binding motif as found by Feng et al. (2004).
https://doi.org/10.7554/eLife.10747.028
Figure 7
DNA tracing and bending angle measurement.
(A) The original AFM image as processed with the Gwyddion software. (B) A Matlab code was used to trace the DNA in the AFM images. The digitized binary line represents the DNA backbone (red line), …
Tables
Table 1
List of Bacterial strains and plasmids.
| Strain | Description/Nomenclature | Reference |
|---|---|---|
| wild type | Salmonella enterica serovar Typhimurium strain 14028s | Lab strain collection |
| ssrA | ssrA::TetRA derivative of 14028s | This work |
| ssrB | DW85 | Don Walthers (originally from Stephen Libby) |
| ssaC | ssaC::TetRA derivative of 14028s | Chakraborty et al. (2015) |
| ssaJ | ssaJ::TetRA derivative of 14028s | Hideaki Mizusaki unpublished |
| D56A | D56A SsrB derivative of 14028s | This work |
| ssrAH1 | DW748 | Don Walthers unpublished |
| ssrAD | DW749 | Don Walthers unpublished |
| ssrAH2 | DW750 | This work |
| ssrAH1 sifA-LacZ | Made by transducing sifA-lacZ from DW636 to DW748 | This work |
| ssrAD sifA-lacZ | Made by transducing sifA-lacZ from DW636 to DW749 | This work |
| ssrAH2 sifA-lacZ | Made by transducing sifA-lacZ from DW636 to DW750 | Don Walthers; Lab strain collection |
| DW636 | sifA-lacZ at attP site in 14028s | Don Walthers; Lab strain collection |
| DW637 | ssrB::Km derivative of DW636 | This work/Don Walthers (lab strain collection) |
| ssrAH1 AcP | ackA-pta::Km (from DW142) transduced in DW748 | This work/Don Walthers (lab strain collection) |
| ssrAD AcP | ackA-pta::Km (from DW142) transduced in DW749 | This work/Don Walthers (lab strain collection) |
| ssrAH2 AcP | ackA-pta::Km (from DW142) transduced in DW750 | This work/Don Walthers (lab strain collection) |
| hns | hns::TetRA derivative of DW636 | This work/Don Walthers (lab strain collection) |
| hns ssrB | hns::TetRA derivative of DW637 | This work/Don Walthers (lab strain collection) |
| Plasmid pKF46 | D56A His-SsrB pMpM-A5Ω construct | Feng et al. (2004) |
| Plasmid pKF43 | His-SsrB pMpM-A5Ω construct | Feng et al. (2004) |
| Transformant DW160 | DH5α harboring His-HNS (S. typhimurium) in pMpM-A5Ω | Walthers et al. (2011) |
| Plasmid pKF104 | His-SsrBc pMpM-A5Ω construct | Feng et al. (2004) |
| pBR328::csgD | csgD construct | Prof Iñigo Lasa’s group |
| Plasmid pRC24 | K179A His-SsrB pMpM-A5Ω construct | Carroll et al. (2009) |
Table 2
List of oligonucleotides.
| Purpose/name | Sequence (5’-3’) |
|---|---|
| Digf (forward 755bp csgD regulatory region) | tgatgaaactccacttttttta |
| Digr (reverse 755bp csgD regulatory region) | tgctgtcaccctggacctggtc |
| ssrA knockout (forward) | atgaatttgctcaatctcaagaatacgctgcaaacatctt ttaagacccactttcacatt |
| ssrA knockout (reverse) | agccgatacggcattttcaatatcagccagcaagaggtcc ctaagcacttgtctcctg |
| csg1 (forward csgD internal) | ggaagatatctcggccggttgc |
| csg2 (reverse csgD internal) | tcagcctagggataatcgtcag |
| rrsA1 (forward rrsA internal) | gcaccggctaactccgtgcc |
| rrsA2 (reverse rrsA internal) | gcagttcccaggttgagcccg |
| PSsrBF (forward for pKF46) | atgaaagaatataagatcttat |
| PSsrBTR (hybrid reverse for pKF46) | ttaatactctaattaacctcattcttcgggcacagttaagtctaagcacttgtctcctg |
| TSsrBF (forward TetRA-ssrB) | acttaactgtgcccgaagaatgaggttaatagagtattaattaagacccactttcacatt |
| TSsrBR (reverse TetRA- after ssrB stop) | catcaaaatatgaccaatgcttaataccatcggacgcccctggctaagcacttgtctcctg |
| Digb (Forward for EMSA) | Biotin- tgatgaaactccacttttttta |
| CsgDigRS (Reverse for EMSA) | aatatttttctctttctggata |
| hns knockout (forward) | gctcaacaaaccaccccaatataagtttggattactacattaagacccactttcacatt |
| hns knockout (reverse) | atcccgccagcggcgggattttaagcatccaggaagtaaactaagcacttgtctcctg |
