The insulin/IGF axis is critically important for controlling gene transcription in the podocyte
- Bristol Renal, University of Bristol, United Kingdom
- Vital-IT Systems Biology Division, SIB Swiss Institute of Bioinformatics, Switzerland
- Cluster of Excellence on Cellular Stress Responses in Aging-associated Diseases (CECAD), University of Cologne, Germany
- Center of Excellence in Nephrology, University Hospitals Aachen, Cologne, Dusseldorf, University of Cologne, Germany
- Department II of Internal Medicine and Center for Molecular Medicine Cologne, Faculty of Medicine and University Hospital Cologne, University Hospital Cologne, Germany
- INEM, Paris Cité University, France
- Biosciences, Faculty of Health and Life Sciences, University of Exeter, United Kingdom
- Department of Clinical and Biomedical Sciences, Medical School, University of Exeter, United Kingdom
Figures
Figure 1 with 1 supplement
podDKD mice develop a renal phenotype by 24 weeks.
(A, B) Body weight (A) and blood glucose (B) are not significantly different in podDKD mice at 24 weeks compared with littermate controls (n=7–8 each group). (C) Urinary albumin-to-creatinine ratio (uACR) is significantly increased in podDKD mice at 24 weeks. Unpaired t-test, **p<0.01 (n=7–8 mice per group). (D) Images and quantification of periodic acid-Schiff (PAS) staining show tubular protein casts (indicated by arrows) and glomerulosclerosis in podDKD mice (lower two panels) compared to littermate controls (upper panels). Scale bar = 25 μm. Unpaired t-test *p<0.05. (E) Masson’s trichrome staining shows increased fibrosis (blue staining) in podDKD mice at 24 weeks. Scale bar = 25 μm. (F) Transmission electron microscopy (TEM) images of glomerular filtration barrier (GFB) (scale bar: left panels = 5 μm, right panels = 500 nm) show ultrastructural damage to the GFB in podDKD mice with significantly increased foot process width. Unpaired t-test **p<0.01. (G) Immunofluorescent staining and quantification of WT1 in podDKD and control mice at 24 weeks of age shows significant reduction in % podocytes per glomerulus in podDKD mice. Nuclei counterstained with DAPI. Scale bar = 100 μm. Unpaired t-test ****p<0.0001, ≥8 glomeruli analysed per mouse, 3 mice per group. Scale bar = 100 μm.
Figure 1—figure supplement 1
Generation of podDKO mice.
(A) Breeding scheme used to generate podDKD mice. (B) Progression of albuminuria in podDKD mice, showing that urinary albumin-to-creatinine ratio (uACR) becomes significantly increased by 24 weeks. Unpaired t-test, **p<0.005. (C) Western blot of primary podocytes derived from podDKD and Cre negative littermate control mice showing approximately 50% loss of both receptors. (D) Top panels – constitutive podocin Cre mouse (heterozygous) crossed with mTR/mGFP reporter. Cre expression causes green fluorescent protein (GFP) to be switched on (>80% excision). Bottom panels – inducible podocin RtTA-tet-o-Cre after 14 days doxycycline (approximately 50% excision). Scale bar either 250 µm (high magnification) or 50 µm (low magnification). (E) No difference in uACR between Cre negative podDKD littermate controls, Cre negative and pod2.Cre expressing mice at 6 months. uACR is significantly increased in podDKD mice. t-test, **p<0.01, n=5–8 mice per group. (F) Graph showing serum creatinine levels in subset of control and podDKD mice age (n=5 each group).
-
Figure 1—figure supplement 1—source data 1
Uncropped western blots for Figure 1—figure supplement 1C – ACTIN, insulin-like growth factor receptor 1 (IGF1R), and insulin receptor (IR).
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Uncropped western blots for Figure 1—figure supplement 1C – ACTIN, insulin-like growth factor receptor 1 (IGF1R), and insulin receptor (IR), showing relevant bands.
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig1-figsupp1-data2-v1.zip
Figure 2 with 1 supplement
Simultaneous knockout of podocyte insulin receptor (IR) and insulin-like growth factor receptor 1 (IGF1R) in vitro is highly detrimental.
(A) Western blot shows >80% reduction of IR and IGF1R protein in ciDKD cells. t-test, ****p<0.00001, n=18. (B) Phosphorylation of AKT and p44/42MAPK in response to acute insulin stimulation at 10 nM and 100 nM for 10 min was significantly reduced in ciDKD podocytes. One-way ANOVA, **p<0.01, *p<0.05, n=3. (C) Phosphorylation of AKT and p44/42MAPK in response to acute IGF1 stimulation at 10 and 100 ng/ml for 10 min was reduced in ciDKD podocytes. One-way ANOVA, *p<0.05, n=3. (D) Fewer than 50% of ciDKD cells survive 7 days after gene excision. t-test, ****p<0.0001, n=3–4 independent experiments.
-
Figure 2—source data 1
Uncropped western blots for Figure 2A–C.
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig2-data1-v1.zip
-
Figure 2—source data 2
Uncropped western blots for Figure 2A–C, showing relevant bands.
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig2-data2-v1.zip
Figure 2—figure supplement 1
Generation of receptor knockout conditionally immortalised podocytes and survival analysis of DKO cells.
(A) Development of ciDKD, ciIRKD, and ciIGF1RKD podocytes. Primary culture podocytes (homozygous floxed) isolated from transgenic mouse. Conditional immortalisation with temperature-sensitive SV40 construct and then excision of insulin receptor (IR) and/or insulin-like growth factor receptor 1 (IGF1R) using lentiviral delivered Cre recombinase. (B) Survival rate of wild-type and IR/IGF1R floxed podocytes 3 days and 7 days after lentiviral Cre recombinase-induced gene knockdown. t-test, ***p<0.001, ****p<0.0001 (n=3 each group).
Figure 3 with 1 supplement
Proteomic analysis of ciDKD podocytes reveals downregulation of spliceosomal proteins.
(A) Schematic outlining workflow for proteomic analysis. (B) Heat map showing hierarchical clustering of ciDKD vs wild-type podocyte proteomes (decreased protein expression in green, increased expression in red) and the Gene Ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) terms enriched in four major clusters. (C, D) KEGG enriched terms in Search Tool for the Retrieval of Interacting Genes/Proteins (STRING). Downregulated pathways (green) are associated with higher enrichment scores in comparison to upregulated pathways (red). Enrichment scores are computed by STRING using the Kolmogorov-Smirnoff test. KEGG term ‘Spliceosome’ (in black) is associated with a high enrichment score and the highest false discovery rate across all terms. (E) Western blots show significantly reduced levels of EIF4A, SF3B4, and PTBP2 in ciDKD podocytes compared with wild-type cells. Unpaired t-test, ***p<0.001, **p<0.01, *p<0.05, n=3 independent experiments. (F) Representative immunohistochemistry and quantification using an antibody to SF3B4 shows reduced expression in the glomeruli of podDKD mice compared to littermate controls. t-test ****p<0.0001. Scale bar = 25 µm.
-
Figure 3—source data 1
Uncropped western blots for Figure 3E – ACTIN, EI4A3, PTBP2, SF3B4.
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig3-data1-v1.zip
-
Figure 3—source data 2
Uncropped western blots for Figure 3E – ACTIN, EI4A3, PTBP2, SF3B4, showing relevant bands.
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig3-data2-v1.zip
Figure 3—figure supplement 1
Proteomic analysis of ciDKD podocytes.
(A) Heat map of sample clustering. (B) Plot of principal component analysis. (C) Volcano plot showing changes in the proteome of ciDKD podocytes relative to wild-type control cells; log2 fold change (FC) vs –log10 p-value of the scaled abundances. Shaded areas indicate proteins with FC < and > 2.
Figure 4
Exposure of cultured podocytes, but not glomerular endothelial cells, to the spliceosome inhibitor pladienolide B results in dose-dependent cell death.
(A) Schematic overview of the spliceosome pathway showing multiple spliceosome proteins are significantly downregulated (green) in ciDKD podocytes. (B–D) Pladienolide B exposure for 48 hr in HeLa cells (B), glomerular endothelial cells (GenC) (C), and podocytes (D). One-way ANOVA, ****p<0.0001, **p<0.01, *p<0.05, n=3 independent experiments. (E) Bright-field images of wild-type podocytes exposed to the indicated concentrations of pladienolide B. Scale bar = 100 μm.
Figure 5 with 1 supplement
Loss of podocyte insulin receptor (IR) and insulin-like growth factor receptor 1 (IGF1R) is associated with increases in intron retention and unproductive transcript expression.
(A) Schematic outlining long-read RNA sequencing workflow. (B) An overview of the alternative splicing events quantified by full-length alternative isoform analysis of RNA (FLAIR). Boxes represent exons (blue = constitutive exons; yellow = alternative exons), lines represent introns. (C) Boxplot showing the fraction of transcripts with intron retention events in ciDKD and wild-type podocytes. t-test, **p<0.01, n=4 for each experimental condition. (D) Box plot of the fraction of productivity events in the ciDKD and wild-type transcriptomes shows a higher proportion of unproductive transcripts in ciDKD podocytes. Includes no start codon; start codon but no stop codon; productive transcripts; premature termination codon, i.e., unproductive transcript. t-test, ***p<0.001, **p<0.01, *p<0.05, n=4 for each experimental condition. (E) Proportional stacked bar graph of productivity events in the ciDKD and wild-type transcriptomes.
Figure 5—figure supplement 1
Long-read RNA sequencing analysis of ciDKD podocytes.
(A) Plot indicating the number of reads sequenced. (B) Plot of variance transformed data to normalise for library size. (C) Plot of principal component analysis shows clustering of experimental groups. (D–F) Kyoto Encyclopaedia of Genes and Genomes (KEGG) enriched terms in ciDKD podocytes genes with intron retention (D), cassette exon splicing (E), and alternative 5’ splicing (F).
Figure 6
Compound knockdown of the insulin receptor (IR) and insulin-like growth factor receptor 1 (IGF1R) alters the podocyte transcriptome.
(A) UCSC genome browser tracks of transcripts annotated to Fn1. Red lines indicate the number of reads in each sample containing the EDA and EDB exons (n=4 each group). (B) Boxplot showing differential expression of an Fn1 transcript containing EDA/EDB exons in ciDKD podocytes. (C) Exon/intron structure of Fn1 transcript differentially expressed in ciDKD vs wild-type podocytes. Expression of an EDA and EDB exon-containing transcript (not normally expressed in mature podocytes and associated with fibrosis) is increased in ciDKD podocytes. (D) Quantitative PCR (qPCR) shows decreased expression of Hcfc1r1 mRNA in ciDKD podocytes. t-test, ****p<0.00001, n=4 independent experiments. (E) qPCR using primers specific to the Fn1 EDB exon shows an increase in the expression of fibrosis-associated EDB exon-containing transcripts in ciDKD podocytes. t-test, **p<0.001, n=4 independent experiments.
Figure 7 with 1 supplement
Multiple spliceosomal protein post-translational modifications (PTMs) occur in response to insulin and IGF1 stimulation.
(A) Heat map showing differential phosphorylation at the indicated phosphosites of spliceosome-related proteins in ciDKD podocytes and control cells stimulated with 10 nM insulin or 10 ng/ml IGF1 for 10 min (decreased phosphorylation in green, increased phosphorylation in red). Those phosphorylation events that also occurred in Turewicz et al., 2025, study highlighted in yellow boxes. (B) Differentially phosphorylated proteins identified in (A) occur throughout the spliceosome cycle (red boxes). (C) Heat map showing differential phosphorylation at the indicated phosphosites of serine/arginine repetitive matrix 2 (SRRM2) in ciDKD podocytes and control cells stimulated with 10 nM insulin or 10 ng/ml IGF1 for 10 min (decreased phosphorylation in green, increased phosphorylation in red).
Figure 7—figure supplement 1
Spliceosomal protein-related kinase post-translational modifications (PTMs) occurring in response to insulin and IGF1 stimulation.
Graphs showing the relative expression of CDK11B s578 (A), SRPK1 s311 (B), and PACSIN3 s383 (C) in wild-type and ciDKD podocytes stimulated with 10 nM insulin or 10 ng/ml IGF1. Unpaired t-test *p<0.05. **p<0.005, n=3.
Figure 8 with 1 supplement
Relative contributions of the insulin receptor (IR) and insulin-like growth factor receptor 1 (IGF1R) to spliceosomal modulation.
(A) Heat map of hierarchical clustering of ciDKD vs ciIGF1RKD vs ciIRKD vs wild-type podocytes (n=9) proteomes (high relative expression in red, low relative expression in green, equal expression in black). Top of the heat map contains most significantly enriched groups, with enrichment intensity decreasing further down. The spliceosomal targets SF3B4, EIF4A3, and PTBP2 were mapped onto the proteomic heat map comparing wild-type podocytes to cells with knockdown of the IR and/or the IGF1R. SF3B4 expression is reduced in all three knockdown cell lines. (B) Schematic showing signalling pathways uniquely enriched in ciDKD podocytes, including the downregulation of spliceosomal tri-snRNP complex assembly. (C) Heat map showing differential phosphorylation events in ciIGF1RKD, ciDKD, ciIRKD, and wild-type podocytes (decreased phosphorylation in green, increased phosphorylation in red).
Figure 8—figure supplement 1
Proteomic analysis of ciIRKD, ciIGF1RKD, and ciDKD podocytes.
(A) Western blot shows >95% reduction of insulin receptor (IR) expression in ciIRKO podocytes, t-test. ****p<0.0001. (B) Western blot shows >95% reduction of insulin-like growth factor receptor 1 (IGF1R) expression in ciIGF1RKD podocytes, t-test. ****p<0.0001. (C–E) Principal component analysis (PCA). ciDKD and ciIGF1RKD groups are significantly different to each other and the ciIRKD and wild-type (WT) groups (C). IRKD and WT groups show a moderate degree of overlap but do have a clear degree of difference. (D). 2D PCA using third most significant component (Component 3), which demonstrates that along Components 2 and 3, all four groups distinctly cluster separate to one another (E).
-
Figure 8—figure supplement 1—source data 1
Uncropped western blots for Figure 8—figure supplement 1A and B.
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig8-figsupp1-data1-v1.zip
-
Figure 8—figure supplement 1—source data 2
Uncropped western blots for Figure 8—figure supplement 1A and B, showing relevant bands.
- https://cdn.elifesciences.org/articles/107791/elife-107791-fig8-figsupp1-data2-v1.zip
Tables
Table 1
Top 10 most significantly expressed genes detected by transcript in ciDKD v WT podocytes.
| Gene name | Transcript ID | Log FC | Value | adj.P.Va1 | Transcript type |
|---|---|---|---|---|---|
| D130062J10Rik | ENSMUST00000223763.2 | –3.8196361 | 0.0000000 | 0.0000085 | IncRNA |
| Fn1 | ENSMUST00000186879.2 | –6.9625749 | 0.0000000 | 0.0000010 | Retained intron |
| Fn1 | ENSMUST00000055226.13 | 1.1097711 | 0.0060383 | 0.0509845 | Protein coding |
| Fn1 | ENSMUST00000189821.7 | –0.8737398 | 0.0359924 | 0.1538286 | Protein coding |
| Fn1 | ENSMUST00000185408.7 | 2.6214948 | 0.1620950 | 0.3828405 | Retained intron |
| Fn1 | ENSMUST00000190780.7 | –0.4741740 | 0.2093201 | 0.4430398 | Protein coding |
| Fn1 | ENSMUST00000187938.7 | 0.3681171 | 0.3633759 | 0.6025781 | Protein coding |
| Fn1 | ENSMUST00000186129.7 | –0.1591273 | 0.5248095 | 0.7369268 | Protein coding |
| Fn1 | ENSMUST00000189160.2 | 0.1149073 | 0.7523422 | 0.8668309 | Retained intron |
| Fn1 | ENSMUST00000188894.7 | 0.0545639 | 0.8697479 | 0.9320835 | Protein coding |
| Gm13196 | ENSMUST00000118297.2 | 7.0682661 | 0.0000000 | 0.0000043 | Processed pseudogene |
| Gm43461 | ENSMUST00000202351.2 | –2.5532991 | 0.0000000 | 0.0000127 | TEC |
| Gsta4 | ENSMUST00000034903.7 | 2.8474040 | 0.0000000 | 0.0000079 | Protein coding |
| Gsta4 | ENSMUST00000213215.2 | 0.2810244 | 0.6215751 | 0.7841542 | Protein coding |
| Hcfc1r1 | ENSMUST00000179928.2 | –7.5317703 | 0.0000000 | 0.0000079 | Protein coding |
| Hcfc1r1 | ENSMUST00000180140.8 | 1.7727865 | 0.0098495 | 0.0692495 | Protein coding |
| Hcfc1r1 | ENSMUST00000024697.5 | 0.4134073 | 0.0171869 | 0.0973040 | Protein coding |
| Id3 | ENSMUST00000008016.3 | 2.6838864 | 0.0000000 | 0.0000079 | Protein coding |
| Lamtor3-ps | ENSMUST00000164408.8 | 6.7070388 | 0.0000000 | 0.0000098 | Protein coding |
| Marcks | ENSMUST000000092584.6 | 5.8763865 | 0.0000000 | 0.0000001 | Protein coding |
| Rpl15-ps2 | ENSMUST000000184247.2 | 13.8135821 | 0.0000000 | 0.0000001 | Processed pseudogene |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Insr | GenBank | ID: 16337 | |
| Gene (M. musculus) | Igf1r | GenBank | ID: 16001 | |
| Cell line (M. musculus) | Wild-type podocyte | Keir et al., 2015 | ||
| Cell line (M. musculus) | Insrfl/fl/Igf1rfl/fl | This paper | Generation of this cell line is described in the Methods section of this paper. | |
| Cell line (M. musculus) | Insrfl/fl | This paper | Generation of this cell line is described in the Methods section of this paper. | |
| Cell line (M. musculus) | Igf1rfl/fl | This paper | Generation of this cell line is described in the Methods section of this paper. | |
| Antibody | Anti WT1 (rabbit monoclonal) | Abcam | Cat# ab89901; RRID:AB_2043201 | IF(1:100) |
| Antibody | Anti SF3B4 (mouse monoclonal) | Novus Biologicals | Cat# NBP-9269255 | WB (1:1000) IHC (1:100) |
| Antibody | Anti IR β (rabbit monoclonal) | Cell Signaling | Cat# 3025; RRID:AB_2280448 | WB (1:1000) |
| Antibody | Anti IGF1R β (rabbit monoclonal) | Cell Signalling | Cat# 9750; RRID:AB_10950969 | WB (1:1000) |
| Antibody | Anti phospho AKT (Ser 473) (rabbit monoclonal) | Cell Signaling | Cat# 4060; RRID:AB_2315049 | WB (1:1000) |
| Antibody | Anti AKT (rabbit monoclonal) | Cell Signaling | Cat# 2920; RRID:AB_1147620 | WB (1:1000) |
| Antibody | Anti phospho P44/42 MAPK (rabbit monoclonal) | Cell Signaling | Cat# 4370; RRID:AB_2315112 | WB (1:1000) |
| Antibody | Anti P44/42 MAPK (rabbit monoclonal) | Cell Signaling | Cat# 9102; RRID:AB_330744 | WB (1:1000) |
| Antibody | Anti PTBP2 (rabbit polyclonal) | Proteintech | Cat# 55186-1-AP; RRID:AB_10837230 | WB (1:1000) |
| Antibody | Anti beta actin (mouse monoclonal) | Sigma-Aldrich | Clone AC-74 Cat# A5316; RRID:AB_476743 | WB (1:10,000) |
| Antibody | Anti GAPDH (mouse monoclonal) | Sigma-Aldrich | Cat# G8795; RRID:AB_1078991 | WB (1:10,000) |
| Antibody | Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A11008; RRID:AB_143165 | IF (1:200) |
| Antibody | Goat anti-Guinea-pig IgG (H+L) Cross-Adsorbed Secondary Antibody Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A11075; RRID:AB_2534119 | IF (1:200) |
| Antibody | Anti-rabbit IgG peroxidase secondary antibody | Sigma-Aldrich | Cat# A6667; RRID:AB_258307 | WB (1:10,000) |
| Antibody | Anti-mouse IgG peroxidase secondary antibody | Sigma-Aldrich | Cat# A9044; RRID:AB_258431 | WB (1:10,000) |
| Sequence-based reagent | Fibronectin forward primer | Thermo Fisher Scientific | PCR primers | CCCAGCTCACTGACCTAAGC |
| Sequence-based reagent | Fibronectin reverse primer | Thermo Fisher Scientific | PCR primers | GGAAGAGTTTAGCGGGGTCC |
| Sequence-based reagent | Hcfc1r1 forward primer | Thermo Fisher Scientific | PCR primers | GCCACCACTGGGGT AACTC |
| Sequence-based reagent | Hcfc1r1 reverse primer | Thermo Fisher Scientific | PCR primers | CTTCGGGAAAAGTCACAGGG |
| Sequence-based reagent | Beta actin forward primer | Thermo Fisher Scientific | PCR primers | GACAGGATGCAGAAGGAGATTACT |
| Sequence-based reagent | Beta actin reverse primer | Thermo Fisher Scientific | PCR primers | TGATCCACATCTGCTGGAAGGT |
| Peptide, recombinant protein | Insulin | Biotechne | Cat# 3435 | |
| Peptide, recombinant protein | Recombinant mouse IGF1 | Novus | Cat# NBP2-35081 | |
| Commercial assay or kit | Bethyl mouse albumin ELISA quantitation | Universal Biologicals | Cat# E90-134 | |
| Commercial assay or kit | The Creatinine Companion | Exocell | Cat# 1012 | |
| Commercial assay or kit | Periodic Acid Schiff staining kit | Sigma | Cat# 395B | |
| Commercial assay or kit | Trichrome Staining Kit | Sigma | Cat# HT15 | |
| Chemical compound, drug | Hexadimethrine bromide | Merck | Cat# H9268 | |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | |
| Software, algorithm | Leica Application Suite X software | Leica Microsystems | RRID:SCR_013673 | |
| Software, algorithm | GraphPad Prism | GraphPad Software, San Diego, CA, USA | Version 9.4.0 RRID:SCR_002798 | |
| Software, algorithm | IN Cell Investigator | GE Healthcare | ||
| Software, algorithm | Proteome Discoverer 2.1 | Thermo Fisher Scientific | RRID:SCR_014477 | |
| Software, algorithm | Microsoft Office Excel | RRID:SCR_016137 | ||
| Software, algorithm | Perseus software | MaxQuant | RRID:SCR_015753 | |
| Software, algorithm | STRING | http://string.embl.de/ | RRID:SCR_005223 | |
| Software, algorithm | KEGG | http://www.kegg.jp/ | RRID:SCR_012773 | |
| Software, algorithm | UniProt | http://www.uniprot.org/ | RRID:SCR_002380 | |
| Software, algorithm | edgeR | http://bioconductor.org/packages/edgeR/ | RRID:SCR_012802 | |
| Software, algorithm | diffSplice | http://www.netlab.uky.edu/p/bioinfo/DiffSplice | RRID:SCR_013215 | |
| Software, algorithm | ProteomeXchange | http://www.proteomexchange.org | RRID:SCR_004055 | |
| Other | Hoechst 33342 | Thermo Fisher Scientific | Cat# H3570 | Fluorescent DNA dye. |
| Other | Protease inhibitor cocktail | Merck | Cat# P8340 | Supplement for cell lysis buffer. |
| Other | Phosphatase inhibitor cocktail 2 | Merck | Cat# P5726 | Supplement for cell lysis buffer. |
| Other | Phosphatase inhibitor cocktail 3 | Merck | Cat# P0044 | Supplement for cell lysis buffer. |
| Other | Hematoxylin Solution, Gill No. 1 | Sigma | Cat# GHS132 | Histological stain. |
| Other | RIPA buffer | Fisher | Cat# 10017003 | Cell lysis buffer, described in the Methods section. |
| Other | Clarity Western ECL substrate | Bio-Rad | Cat# 1705061 | Reagent for visualisation of western blot bands. |
| Other | SignalStain Boost IHC detection reagent (HRP rabbit) | Cell Signaling | Cat# 8114 | Secondary antibody used for IHC. |
| Other | SignalStain DAB substrate kit | Cell Signaling | Cat# 8059 | Reagent for visualisation of IHC staining. |
| Other | VectaMount | Vector Laboratories | Cat# H-5000 | Histological mounting medium. |
| Other | DPX mount for histology | Sigma | Cat# 06522 | Histological mounting medium. |
Additional files
-
Supplementary file 1
List of genes with significantly increased intron retention splicing in ciDKD podocytes.
- https://cdn.elifesciences.org/articles/107791/elife-107791-supp1-v1.xlsx
-
Supplementary file 2
List of genes with significantly increased alternative 5’ splicing in ciDKD podocytes.
- https://cdn.elifesciences.org/articles/107791/elife-107791-supp2-v1.xlsx
-
Supplementary file 3
List of genes with significantly increased alternative 3’ splicing in ciDKD podocytes.
- https://cdn.elifesciences.org/articles/107791/elife-107791-supp3-v1.xlsx
-
Supplementary file 4
List of genes with significantly increased cassette exon splicing in ciDKD podocytes.
- https://cdn.elifesciences.org/articles/107791/elife-107791-supp4-v1.xlsx
-
Supplementary file 5
List of mouse splicing proteins identified from R-MMU-72203 reactome pathway database (mouse processing of capped intron-containing pre-mRNA).
- https://cdn.elifesciences.org/articles/107791/elife-107791-supp5-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/107791/elife-107791-mdarchecklist1-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The insulin/IGF axis is critically important for controlling gene transcription in the podocyte
eLife 14:RP107791.
https://doi.org/10.7554/eLife.107791.5
