Dynamic assembly of malate dehydrogenase–citrate synthase multienzyme complex in the mitochondria
Figures
MDH1–CIT1 interaction under respiration, fermentation, and mixed-respiration conditions.
Yeast cells were grown in the minimum media containing acetate (SD-Acet), glucose (SD-Gluc), and raffinose (SD-Raff) to the exponential growth phase. (A) Luciferase signal indicating MDH1–CIT1 complex interaction (N = 20). (B) Cellular oxygen consumption rate (N = 3). (C) MDH1 and CIT1 protein levels detected by western blotting. Numbers on the left indicate the position of the molecular weight markers. DLD1 is a loading control of mitochondrial protein. . In A and B, data are presented as mean ± SEM, and the differences between conditions were tested by Student’s t-test. Asterisks indicate significant differences (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant).
-
Figure 1—source data 1
PDF file containing the original western blotting images showing MDH1 and CIT1 protein abundance in Figure 1C.
- https://cdn.elifesciences.org/articles/107953/elife-107953-fig1-data1-v1.pdf
-
Figure 1—source data 2
Original files for western blot analysis displayed in Figure 1C.
- https://cdn.elifesciences.org/articles/107953/elife-107953-fig1-data2-v1.zip
Growth rate and enzyme activity of NanoBiT reporter strain.
(A) Extractable cellular MDH and CS enzyme activities in the wildtype (black) and NanoBiT reporter strain (Split-luc line, red). (B) Growth of cells in SD-raff media monitored as culture OD600. Data is presented as mean ± s.d. Statistical differences against the wildtype samples were assessed by Student’s t-test at each time point. n.s., not significant (p > 0.05).
MDH1–CIT1 complex association, mitochondrial microenvironments, and cellular metabolite levels during Crabtree effect induction.
Cells were cultured in fresh SD-Raff media in the control condition (black). The Crabtree effect was induced by the 2% glucose application to the SD-Raff-grown cells at 0 min (red). (A) NanoBiT signal indicating MDH1–CIT1 interaction. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals to the average signals during three pre-treatment time points. SD-Raff-grown cells were also co-treated with 2% glucose and a fermentation inhibitor, 100 mM phosphate, at 0 min (gray). (B) Mitochondrial matrix pH. (C) Mitochondrial matrix redox states as GSH/GSSG equivalent (mV). (D) Mitochondrial matrix ATP level indicated by the ratio between 560 and 510 nm emission signals. All data in A–D are presented as mean ± s.d. (N = 4). (E) Cellular metabolite levels at 80 min. The boxes, lines, error bars, and points indicate interquartile range, median, minimum, and maximum values, and outliers, respectively (N = 7). Statistical differences against the control samples were assessed using the Student’s t-test at each time point. Asterisks indicate significant differences (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant).
MDH1–CIT1 interaction and protein abundance following the application of glucose.
(A) Co-immunoprecipitation of CIT1 with MDH1. In the Split-luc line, MDH1-LgBiT and CIT1-SmBiT harbor cMyc and HA tags in the linker sequence. Proteins were extracted from the Split-luc line grown in SD-faff media at 1.5 and 2.5 hr following 2% glucose application. MDH1 was precipitated with anti-cMyc agarose and co-precipitated CIT1 was detected by anti-HA antibody following SDS–PAGE separation. (B) MDH1 protein levels monitored by the luminescence of MDH1 fused with full-length NanoLUC luciferase. (C) Western blot analysis of MDH1 and CIT1 protein levels after 0, 30, 60, and 90 min of Crabtree induction. Phosphoglycerate kinase (PGK) was detected as a loading control. (D) NanoBiT signal indicating MDH1–CIT1 interaction in a repeated glucose supplementation experiment. SD-Raff-grown cells were treated with 2% glucose at 0 min (blue). (E) MDH1 protein levels monitored by the luminescence of MDH1 fused with full-length NanoLUC luciferase in the repeated experiment. (F) MDH1 protein levels monitored by the luminescence of CIT1 fused with full-length NanoLUC luciferase in the repeated experiment. Relative luminescence was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. Statistical differences against the control samples were assessed by Student’s t-test at each time point (N = 4). Asterisks indicate significant differences (*p < 0.05; ****p < 0.0001; ns, not significant). (G) Interaction index calculated by normalizing NanoBiT signal by those of MDH1-NanoLUC and CIT1-NanoLUC. Asterisks indicate time points with statistically significant differences (p < 0.05) between control and glucose conditions (N = 4).
-
Figure 2—figure supplement 1—source data 1
PDF file containing the original western blotting images in Figure 2—figure supplement 1A, C.
- https://cdn.elifesciences.org/articles/107953/elife-107953-fig2-figsupp1-data1-v1.pdf
-
Figure 2—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 2—figure supplement 1A, C.
- https://cdn.elifesciences.org/articles/107953/elife-107953-fig2-figsupp1-data2-v1.zip
Effects of sugars on MDH1–CIT1 complex assembly and oxygen consumption rate.
(A–D) NanoBiT signal indicating effect of galactose, sucrose, fructose, and glucose on MDH1–CIT1 interaction. Cells were cultured in fresh SD-Raff media in the control condition (black). The cells are treated with 2% sugar application to the SD-Raff-grown cells at 0 min (red). Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. (E) Effects of glucose and inorganic phosphate (fermentation inhibitor) on oxygen consumption rate. Basal O2 consumption rate of SD-Raff grown cells was measured. Glucose and inorganic phosphate were added and O2 consumption rate was measured for 5 min. All data in A–E are presented as mean ± s.d. Statistical differences against the control samples were assessed by Student’s t-test at each time point (N = 4). Asterisks indicate significant differences with p < 0.05.
Repeated experiments investigating the effects of sugars on MDH1–CIT1 complex assembly and MDH1 and CIT1 protein abundance following the addition of galactose (green), sucrose (magenta), and fructose (cyan).
NanoBiT signal indicating the effect of galactose (A), sucrose (B), and fructose (C) on MDH1–CIT1 interaction. Cells were cultured in fresh SD-Raff media in the control condition (black). The cells are treated with 2% sugar application to the SD-Raff-grown cells at 0 min. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. (D–F) MDH1 protein levels monitored by the luminescence of MDH1 fused with full-length NanoLUC luciferase. (G–I) CIT1 protein levels monitored by the luminescence of CIT1 fused with full-length NanoLUC luciferase. Relative luminescence was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. Statistical differences against the control samples were assessed by Student’s t-test at each time point (N = 4). Asterisks indicate significant differences (*p < 0.05; **p < 0.01; ****p < 0.0001). (J–L) Interaction index calculated by normalizing NanoBiT signal by those of MDH1-NanoLUC and CIT1-NanoLUC.
Biosensors indicate mitochondria microenvironments.
(A–D) Subcellular localizations of fluorescent biosensors. The yeast strains expressing Mito-roGFP1 (upper panels), pHluorin (middle panels), and Mito-GoAteam2 (lower panels) were observed by fluorescent microscopy in the SD-Raff media. The cells were stained with Mitotracker orange prior to the analysis. (A) Bright field image. (B) Mito tracker signal. (C) Biosensor signals. (D) Merged images of A–C. (E) Effect of raffinose addition on MDH1–CIT1 interaction. Cells were cultured in SD-Raff media in the control condition (black). The cells are applied with 2% raffinose to the SD-Raff-grown cells at 0 min (red). Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. (F) Mitochondrial matrix pH in control cells (black) and cells applied with additional raffinose (red). (G) Mitochondrial matrix redox state reported as redox potential of roGFP1 (mV). (H) Mitochondrial matrix ATP level indicated by the ratio between 560 and 510 nm emission signals of mito-GoATeam2 sensor. Data in E–H are presented as mean ± s.d. (N = 4). No statistical difference was detected between the control and raffinose cells.
MDH1–CIT1 complex association, mitochondrial matrix microenvironments, and cellular metabolite levels following tricarboxylic acid (TCA) cycle activation and inhibition.
Cells were cultured in SD-Raff media in the control condition (black). The TCA cycle activator (acetate, dark red) and inhibitors (arsenite, blue, and aminooxyacetate (AOA), pink) were applied at 0 min. (A–C) NanoBiT signal indicating MDH1–CIT1 interaction. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. (D–F) Mitochondrial matrix pH in control cells (black) and cells treated with acetate (dark red), arsenite (blue), and AOA (pink). (G–I) Mitochondrial matrix redox states as GSH/GSSG equivalent (mV). (D, H, L) Mitochondrial matrix ATP level indicated by the ratio between 560 and 510 nm emission signals of mito-GoATeam2 sensor. All data in A-L are presented as mean ± s.d. (N = 4). (M) Cellular metabolite levels after 80 min of treatment. The boxes, lines, error bars, and points indicate interquartile range, median, minimum, and maximum values, and outliers, respectively (N = 7). Statistical differences against the control samples were assessed using the Student’s t-test at each time point. Asterisks indicate significant differences (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant).
MDH1–CIT1 complex association and MDH1 and CIT1 protein levels following tricarboxylic acid (TCA) cycle activation and inhibition (repeated experiment).
Cells were cultured in SD-Raff media in the control condition (black). The TCA cycle activator (acetate, dark red; ethanol, light yellow) and inhibitors (arsenite, dark yellow; aminooxyacetate, AOA, pink) were applied at 0 min. (A–D) NanoBiT signal indicating the MDH1–CIT1 interaction. (E–H) MDH1 protein levels monitored by the luminescence of MDH1 fused with full-length NanoLUC luciferase. (I–L) CIT1 protein levels monitored by the luminescence of CIT1 fused with full-length NanoLUC luciferase. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. Statistical differences against the control samples were assessed by Student's t-test at each time point (N = 4). Asterisks indicate significant differences (**p < 0.01; ***p < 0.001). (M–P) Interaction index calculated by normalizing NanoBiT signal by those of MDH1-NanoLUC and CIT1-NanoLUC. Asterisks indicate time points with statistically significant differences (p < 0.05) between control and treatment conditions (N = 4).
MDH1–CIT1 complex association, mitochondria microenvironments, and cellular metabolite levels following mitochondrial electron transport chain (ETC) inhibition.
Cells were cultured in SD-Raff media in the control condition (black). The ETC inhibitors for complex II (malonate, purple, A–D), complex IV (cyanide, green, E–H), and complex III (antimycin, orange, I–L) were applied at 0 min. (A, E, I) NanoBiT signal indicating MDH1–CIT1 interaction. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. (B, F, J) Mitochondrial matrix pH. (C, G, K) Mitochondrial matrix redox states as GSH/GSSG equivalent (mV). (D, H, L) Mitochondrial matrix ATP level indicated by the ratio between 560 and 510 nm emission signals of mito-GoATeam2 sensor. All data in A-L are presented as mean ± s.d. (M) Cellular metabolite levels after 30 min for malonate and cyanide and after 80 min for antimycin treatment. The boxes, lines, error bars, and points indicate interquartile range, median, minimum, and maximum values, and outliers, respectively. Statistical differences against the control samples were assessed using the Student’s t-test at each time point. Asterisks indicate significant differences with p < 0.05.
Effect of electron transport chain (ETC) inhibitors on O2 consumption rate.
Basal O2 consumption rate was measured, then inhibitor was added and O2 consumption rate was measured for 5 min. Data is presented as mean ± s.d. (N = 4), statistical differences against the control samples were assessed by Student's t-test. Asterisks indicate significant differences with p < 0.05.
Effect of electron transport chain (ETC) inhibitors on MDH1–CIT1 complex association and MDH1 and CIT1 protein levels (repeated experiment).
Cells were cultured in SD-Raff media in the control condition (black). The ETC inhibitors (malonate, light blue; cyanide, cyan; antimycin, light purple) were applied at 0 min. (A–C) NanoBiT signal indicating MDH1–CIT1 interaction. (D–F) MDH1 protein levels monitored by the luminescence of MDH1 fused with full-length NanoLUC luciferase. (G–I) CIT1 protein levels monitored by the luminescence of CIT1 fused with full-length NanoLUC luciferase. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. Statistical differences against the control samples were assessed by Student's t-test at each time point (N = 4). Asterisks indicate significant differences (*p < 0.05; **p < 0.01; ****p < 0.0001). (J–L) Relative luminescence of the NanoBiT signal normalized by those of MDH1-NanoLUC and CIT1-NanoLUC. Asterisks indicate the time points with statistical significance (p <0.05) between control and treatment conditions.
Effects of complex V inhibition on MDH1–CIT1 complex association, mitochondrial microenvironments, and cellular metabolite levels.
Cells were cultured in SD-Raff media in the control condition (black). Oligomycin was applied at 0 min (red). (A) NanoBiT signal indicating MDH1–CIT1 interaction. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. (B) Mitochondrial matrix pH. (C) Mitochondrial matrix redox states as GSH/GSSG equivalent (mV). (D) Mitochondrial matrix ATP level indicated by the ratio between 560 and 510 nm emission signals of mito-GoATeam2 sensor. All data in A–D are presented as mean ± s.d. (N = 4). (E) Cellular metabolite levels after 80 min of oligomycin treatment. The boxes, lines, error bars, and points indicate interquartile range, median, minimum, and maximum values, and outliers, respectively. Statistical differences against the control samples were assessed by Student’s t-test (N = 3). No statistical difference was detected between control and oligomycin-treated cells.
MDH1–CIT1 complex association and MDH1 and CIT1 protein levels following oxidative phosphorylation uncoupler (carbonyl cyanide 3-chlorophenylhydrazone; CCCP) application.
Cells were cultured in SD-Raff media in the control condition (black). CCCP (dark red) was applied at 0 min. (A) NanoBiT signal indicating MDH1–CIT1 interaction. (B) MDH1 protein levels monitored by the luminescence of MDH1 fused with full-length NanoLUC luciferase. (C) CIT1 protein levels monitored by the luminescence of CIT1 fused with full-length NanoLUC luciferase. Relative luminescence unit (RLU) was calculated by normalizing the luciferase signals by the average signals during three pre-treatment time points. Statistical differences against the control samples were assessed by Student’s t-test at each time point (N = 4). Asterisks indicate significant differences (**p < 0.01; ****p < 0.0001). (D) Interaction index calculated by normalizing NanoBiT signal by those of MDH1-NanoLUC and CIT1-NanoLUC. Asterisks indicate time points with statistically significant differences (p < 0.05) between control and CCCP conditions (N = 4).
Effects of pH and metabolites on the yeast MDH1–CIT1 multienzyme complex affinity.
The affinity of the MDH–CS multienzyme complex was analyzed by microscale thermophoresis (MST) using fluorescently labeled MDH1 as the target and CIT1 as the ligand. Curves represent the response (fraction bound) against CIT1 concentration. Data is presented as mean ± s.d. (N = 3). (A) Effects of pH. The MDH1–CIT1 interaction was determined in the buffer with pH 7.2 (pink), 6.8 (orange), 6.4 (olive green), 6.0 (green), and 5.8 (blue). (B) Effects of 10 mM malate (red), α-ketoglutarate (green), succinate (brown), citrate (blue), aspartate (purple), glutamate (pink), and fumarate (orange). The Kd values of MDH1–CIT1 interaction were shown next to the legend.
The affinity of the MDH1–CIT1 multienzyme complex was analyzed by microscale thermophoresis (MST) using fluorescently labeled MDH1 as the target and CIT1 as the ligand.
Curves represent the response (fraction bound) against CIT1 concentration. Points represent the means of fraction bound, and the error bars represent the standard deviations of three measurements (N = 3). (A) Effects of metabolites. The MDH1–CIT1 interaction was determined in the buffer (control; black) with 10 mM α-ketoglutarate (green), 10 mM succinate (blue), 10 mM glutamate (pink), and 10 mM aspartate (dark red). (B) Effects of 1.25 mM (brown), 2.5 mM (green), and 5 mM (pink) ATP. The Kd values of MDH1–CIT1 interaction were shown next to the legend.
Relationship between the respiratory metabolism and the MDH1–CIT1 metabolon association.
(A) Summary of the effects of metabolic treatments on MDH1–CIT1 complex association, mitochondrial matrix parameters (pH, redox state, and ATP levels), and cellular metabolite levels. Each row corresponds to a specific metabolic perturbation. Blue and red labels indicate treatments that decrease or increase the complex association, respectively. Upward and downward arrows indicate increases and decreases in each parameter, respectively. Bold arrows denote changes that are consistent with the observed in vivo alterations in MDH1–CIT1 interaction. The color of the parameter and metabolite indicates its effect on MDH1–CIT1 interaction in vitro (blue, inhibitory; red, promotive). αKG, α-ketoglutarate; fum, fumarate; succ, succinate. (B) A diagram depicting the proposed regulatory mechanism of the MDH1–CIT1 metabolon association. In conditions with low respiratory flux, the MDH1–CIT1 multienzyme complex dissociates, and the tricarboxylic acid (TCA) cycle flux reduces. Reduced electron transport chain (ETC) flux results in higher mitochondrial matrix pH, which reduces MDH1–CIT1 affinity. When the respiratory flux and the TCA cycle flux are high, MDH1–CIT1 metabolon associates and likely channels the intermediate oxaloacetate (OXA). High ETC flux lowers mitochondrial matrix pH and enhances the MDH1–CIT1 interaction. The TCA cycle intermediates affect MDH1–CIT1 metabolon formation; fumarate and malate enhance (red arrows with dotted lines), and citrate inhibits (blue arrows with dotted lines) the interaction. The arrow thickness represents the metabolic fluxes.
Schematics of vector construction and genomic integration procedures.
Colored texts indicate the overhang sequences of the BsaI digestion sites. The ‘tag’ indicates the integrated tag-coding sequences, namely large nanoBiT subunit, small nanoBiT subunit, and nanoLUC luciferase. GOI, gene of interest; CDS, coding sequence; gDS, genomic downstream sequence; Genome, genomic sequence.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (S. cerevisiae) | CIT1 | SGD | SGD:S000005284 | YNR001C |
| Gene (S. cerevisiae) | MDH1 | SGD | SGD:S000001568 | YKL085W |
| Strain, strain background (S. cerevisiae) | BY4741 | SGD | MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | Background strain |
| Genetic reagent (S. cerevisiae) | MDH1/CIT1-BiT | This paper | MDH1-SmBiT-cMyc and CIT1-LgBiT-HA | |
| Genetic reagent (S. cerevisiae) | MDH1-nLUC | This paper | MDH1 fused C-terminally to full-length NanoLUC-HA | |
| Genetic reagent (S. cerevisiae) | CIT1-nLUC strain | This paper | CIT1 fused C-terminally to full-length NanoLUC-HA | |
| Genetic reagent (S. cerevisiae) | MDH1/CIT1-BiT + mito GO ATeam | This paper | MDH1/CIT1 reporter with mitochondrial ATP sensor | |
| Genetic reagent (S. cerevisiae) | MDH1/CIT1-BiT + mito roGFP | This paper | MDH1/CIT1 reporter with mitochondrial redox sensor | |
| Genetic reagent (S. cerevisiae) | MDH1/CIT1-BiT + pHluorin | This paper | MDH1/CIT1 reporter with mitochondrial pH sensor | |
| Antibody | anti-cMyc (mouse monoclonal) | Thermo Scientific | RRID:AB_55847 | WB (1:10,000) |
| Antibody | anti-cMyc (mouse monoclonal) | Thermo Scientific | RRID:AB_2533049 | WB (1:5000) |
| Antibody | anti-PGK1 (mouse monoclonal) | Thermo Scientific | RRID:AB_2532235 | WB (1:5000) |
| Antibody | anti-DLD1 (rabbit polyclonal) | Baile et al., 2013 | WB (1:5000) | |
| Recombinant DNA reagent | pDGB2Ω2 vector | Sarrion-Perdigones et al., 2013 | Golden Braid vector | |
| Recombinant DNA reagent | pGDBα1 vector | Sarrion-Perdigones et al., 2013 | Golden Braid vector | |
| Recombinant DNA reagent | pGDB2Ω2-1; pGDB2Ω2-2; pGDB2Ω2-3 | This paper | Modified cloning-site vectors | |
| Recombinant DNA reagent | pGDB2Ω2-5′LgBiT; pGDB2Ω2-3′LgBiT; pGDB2Ω2-5′SmBiT; pGDB2Ω2-3′SmBiT; pGDB2Ω2-5′nLUC; pGDB2Ω2-3′nLUC; pGDB2Ω2-URA3 | This paper | Intermediate Golden Braid vectors | |
| Recombinant DNA reagent | pGDBα1-LgBiT; pGDBα1-SmBiT; pGDBα1-nLUC | This paper | Integration-cassette plasmids | |
| Recombinant DNA reagent | nLUC-HA; LgBiT-HA; SmBiT-cMyc | This paper | Genewiz | Synthetic DNA fragments |
| Recombinant DNA reagent | pET21b | Novagen | 69741-3 (Millipore Sigma) | E. coli expression plasmid |
| Recombinant DNA reagent | pET-cit1; pET-mdh1 | This paper | Vectors for recombinant MDH1 and CIT1 expression | |
| Recombinant DNA reagent | p415-GPDpro-mito GO ATeam; p416-GPDpro-mito roGFP | Vevea et al., 2013 | Mitochondrial ATP and redox biosensor plasmids | |
| Recombinant DNA reagent | nLUC-HA; pAG416-COX4-pHluorin | Ayer et al., 2013 | Mitochondrial matrix pH biosensor plasmid | |
| Sequence-based reagent | 40 PCR and sequencing primers | Millipore Sigma | Full nucleotide sequences are provided in Appendix 1 | |
| Commercial assay or kit | Nano-Glo Luciferase Assay System | Promega | N1110 | Furimazine substrate for NanoBiT/NanoLUC luminescence assays |
| Commercial assay or kit | Protein Labeling Kit RED-NHS 2nd Generation | NanoTemper | MO-L011 | Labeling kit for microscale thermophoresis assay |
| Software, algorithm | MassHunter Software suites | Agilent | RRID:SCR_016657; RRID:SCR_015040; RRID:SCR_019081 | GC–MS data acquisition and analysis |
Primers used in this study.
Fw and Rv indicate forward and reverse primers, respectively. Bold letters indicate the 4-base overhang in the BsaI digestion sites. Underlined sequences indicate plasmid-annealing sequences.
| Primer name | Primer sequence |
|---|---|
| pGDB2Ω2-1Fw | TCATGATATCGGTCTCAGGAGCACAGCTTGTCTGTAAGCG |
| pGDB2Ω2-1Rv | CATTGATATCGGTCTCAAGGACAGCTGGCACGACAGGTTTC |
| pGDB2Ω2-2Fw | GATATCTCCTAGAGACCCACAGCTTGTCTGTAAGCGG |
| pGDB2Ω2-2Rv | CATTGATATCGACGAGAGACCCAGCTGGCACGACAGGTTTC |
| pGDB2Ω2-3Fw | CATTGATATCGGTCTCACGTCCACAGCTTGTCTGTAAGCGG |
| pGDB2Ω2-3Rv | CATTGATATCGGTCTCAAGCGCAGCTGGCACGACAGGTTTC |
| pDGB2Ω2-LgBiT5′Fw | CATTCATTGGTCTCAGGAGCAGCTTGTAAGATCCCAAACG |
| pDGB2Ω2-LgBiT5′Rv | GTTGTATTGGGTCTCAAGGAGTAACACCATCAATAACTAAAGTACCA |
| pDGB2Ω2-UraFw | GGTGTTACTCCTTGAGACCCAATACAACAGATCACGTG |
| pDGB2Ω2-UraRv | AGCAGTTTGACGTGAGACCCGTTTTATTTAGGTTCTATCGAGG |
| pDGB2Ω2-LgBiT3′Fw | CATTACGGTCTCACGTCCAAACTGCTGCT |
| pDGB2Ω2-LgBiT3′Rv | CTAGAGTAGGTCTCTAGCGGCTAAAATACGTTCACATAAACGCCAACC |
| pDGB2Ω2-SmBiT5′Fw | ATAGGTCTCAGGAGGCATGTAAAATTCCTAATGATTTAA |
| pDGB2Ω2-SmBiT5′Rv | GAACTAGGTCTCAAGGATAAAATTTCTTCAAATAAACGATAACCAG |
| pDGB2Ω2-SmBiT3′Fw | CATTACGGTCTCACGTCGCATGTAAAATTCC |
| pDGB2Ω2-SmBiT3′Rv | CATAAGGGTCTCTAGCGTTATAAAATTTCTTCAAATAAACGATAA |
| pDGB2Ω2-nLUC5′Fw | CATTCATTGGTCTCAGGAGCAGCTTGTAAGATCCCAAACG |
| pDGB2Ω2-nLUC5′Rv | GTTGTATTGGGTCTCAAGGAGTAACACCATCAATAACTAAAGTACCA |
| pDGB2Ω2-nLUC3′Fw | ATAAAACGGGTCTCACGTCAAACTGCTGGTTATAATTTAGATCAAG |
| pDGB2Ω2-nLUC3′Rv | CTAGAGTAGGTCTCTAGCGGCTAAAATACGTTCACATAAACGCCAACC |
| MDH1-SmBiT-Fw | AAGAATATCGAAAAGGGTGTCAACTTTGTTGCTAGTAAAGCATGTAAAATTCCTAATGA |
| MDH1-SmBiT-Rv | TTTTTTTCCCTATTTTTCACTCTATTTCTGATCTTATAAAATTTCTTCAAATAAACG |
| CIT1-LgBiT-Fw | AATACAAGGAGTTGGTAAAGAAAATCGAAAGTAAGAACGCTTGTAAGATCCCAAACGAC |
| CIT1-LgBiT-Rv | TGAAAATACGTGTTTGAATAGTCGCATACCCTGAATCTCGTGTTACTATTAATTCTTA |
| MDH1-nLUC-Fw | AAGAATATCGAAAAGGGTGTCAACTTTGTTGCTAGTAAAAGACCAGCTTGTAAGATCCCA |
| MDH1-nLUC-Rv | TTCCCTATTTTTCACTCTATTTCTGATCTTGAACAATTTAAGCTAAAATACGTTCACA |
| MDH1seqFw | GCATCTCCGGTCACTTTGGG |
| MDH1seqRv | CTAGTTGATTTTTGGCAGTTTCCTTCCTTTC |
| CIT1seqFw | GCCAGAGCTATTGGTGTGTTACC |
| CIT1seqRv | CGGTAGGCATAGGGGACTCAAAG |
| Ura3intFw | GCGTTACCACCATCCAATGCAGAC |
| pDGB1seqFw | CGCCAGCAACGCGGCCTT |
| pDGB1seqRv | GCAAGCGGTTGCCCACCGTC |
| cit1-Fw | CTTTAAGAAGGAGATATACATATGAGTAGCGCCTCCGAACAAACG |
| cit1-Rv | AGTGGTGGTGGTGGTGGTGCTCGAGGTTCTTACTTTCGATTTTCTTTACCAACTCCTTG |
| mdh1-Fw | CTTTAAGAAGGAGATATACATATGTATAAAGTGACTGTTTTGGGTGCAGGC |
| mdh1-Rv | AGTGGTGGTGGTGGTGGTGCTCGAGTTTACTAGCAACAAAGTTGACACCCTTTTC |
| cit1-verFw | GGGCTACGAAAACAAGGATTTTATTGAC |
| mdh1-verFw | CATCAACGCAAGCATCGTTC |
| ctmd-verRv | GTTATGCTAGTTATTGCTCAGCGGTG |
Sequences of the synthesized DNA.
| DNA name | Sequences |
|---|---|
| nLUC-HA | CCCGGGAGACCAGCTTGTAAGATCCCAAACGACTTGAAGCAAAAGGTTATGAACCACTACCCATACGACGTACCAGATTACGCTATGGTTTTTACTTTAGAAGATTTTGTTGGTGATTGGCGTCAAACTGCTGGTTATAATTTAGATCAAGTTTTAGAACAAGGTGGTGTTTCTTCTTTATTTCAAAATTTAGGTGTTTCTGTTACTCCTATTCAACGTATTGTTTTATCTGGTGAAAATGGTTTAAAAATTGATATTCATGTTATTATTCCTTATGAAGGTTTATCTGGTGATCAAATGGGTCAAATTGAAAAAATTTTTAAAGTTGTTTATCCTGTTGATGATCATCATTTTAAAGTTATTTTACATTATGGTACTTTAGTTATTGATGGTGTTACTCCTAATATGATTGATTATTTTGGTCGTCCTTATGAAGGTATTGCTGTTTTTGATGGTAAAAAAATTACTGTTACTGGTACTTTATGGAATGGTAATAAAATTATTGATGAACGTTTAATTAATCCTGATGGTTCTTTATTATTTCGTGTTACTATTAATGGTGTTACTGGTTGGCGTTTATGTGAACGTATTTTAGCTGTCGAC |
| LgBiT-HA | GGATCCAGACCAGCTTGTAAGATCCCAAACGACTTGAAGCAAAAGGTTATGAACCACTACCCATACGACGTACCAGATTACGCTATGGTTTTTACTTTAGAAGATTTTGTTGGTGATTGGGAACAAACTGCTGCTTATAATTTAGATCAAGTTTTAGAACAAGGTGGTGTTTCTTCTTTATTGCAAAATTTAGCTGTTTCTGTTACTCCTATTCAACGTATTGTTAGATCTGGTGAAAATGCTTTAAAAATTGATATTCATGTTATTATTCCTTATGAAGGTTTATCTGCTGATCAAATGGCTCAAATTGAAGAAGTTTTTAAAGTTGTTTATCCTGTTGATGATCATCATTTTAAAGTTATTTTACCATATGGTACTTTAGTTATTGATGGTGTTACTCCTAATATGTTGAATTATTTTGGTCGTCCTTATGAAGGTATTGCTGTTTTTGATGGTAAAAAAATTACTGTTACTGGTACTTTATGGAATGGTAATAAAATTATTGATGAACGTTTAATTACACCTGATGGTTCTATGTTATTTCGTGTTACTATTAATTCTTAAGATATC |
| SmBiT-cMyc | GATATCAGACCAGCATGTAAAATTCCTAATGATTTAAAACAAAAAGTTATGAATCATATGGAACAAAAGTTGATTTCTGAAGAAGATTTGGTTACTGGTTATCGTTTATTTGAAGAAATTTTATAAAAGCTT |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/107953/elife-107953-mdarchecklist1-v1.docx
-
Source data 1
Metabolite profiling data of the S. cerevisiae cells.
The relative metabolite levels were used for the analyses in this study. The raw peak heights, quantitative ion m/z, and the retention time of each analyzed peak are also indicated. The metabolite profiling was conducted in two batches. CONTROL1, GLUCOSE, CYANIDE, ACETATE, ARSENITE, and AOA conditions were analyzed in the first batch (N = 7). CONTROL2, MALONATE, OLIGOMYCIN, and ANTIMYCIN were analyzed in the second batch (N = 3).
- https://cdn.elifesciences.org/articles/107953/elife-107953-data1-v1.xlsx