Two neuropeptides that promote blood feeding in Anopheles stephensi mosquitoes
Figures
Feeding behaviours of An. stephensi.
(A) Reproductive cycle of An. stephensi. Upon emergence [1, D0-D5] females have a dual appetite for protein-rich blood and carbohydrate-rich sources of sugar [2]. After a blood meal [3,4,5, D1PBM-D4PBM], the eggs mature and are laid in water [6]. The next reproductive cycle can now begin. Striped abdomens indicate mated females. (B) Blood-feeding assay. 0–7 hr-old mosquitoes were collected in cups and aged appropriately on sugar. Prior to the test, mosquitoes were ’activated’ for 5 min by presenting a human hand, followed by three exhalations. Blood meals were presented through a Hemotek perfumed with human skin odours. Blood-fed mosquitoes were visually scored. (C) Blood-feeding behaviour of Ae. aegypti. 8-day-old virgin and mated females were assessed for first blood meal. Fully fed mated females were assessed for second blood meal (D1PBM-D4PBM). 18–21 females/trial, n=10–12 trials/group. Kruskal-Wallis with Dunn’s multiple comparisons test, p<0.05. Data labelled with different letters are significantly different. (m): mated. (D). Blood-feeding behaviour of An. stephensi. Co-housed and virgin females were tested on the day of emergence (D0) and each day for the next 5 days (D1–D5). D1PBM-D4PBM represents blood feeding 1–4 days post-first blood meal and D1PO-D2PO represents blood feeding 1–2 days post-oviposition. 18–21 females/trial, n=9–20 trials/group. Generalized Linear Mixed Model with post-hoc pairwise comparisons using estimated marginal means and Bonferroni-corrected p-values; *p<0.05; **p<0.01; ****p<0.0001. (E) Sugar-feeding behaviour of An. stephensi. Females of similar conditions as in (D) were tested for sugar feeding. 18–21 females/trial, n=9–20 trials/group. Generalized Linear Mixed Model with post-hoc pairwise comparisons using estimated marginal means and Bonferroni-corrected p-values; **p<0.01; ***p<0.001; ****p<0.0001. (F) Choice assay for blood and sugar. Sugar-sated or sugar-starved females, co-housed with males (indicated by striped abdomens) were given a choice between blood and sugar and assessed for the choice made (bottom): blood and sugar (blue); blood only (magenta); sugar only (orange); none (grey). Co-housed males were assessed for sugar feeding only. Proportion of mosquitoes fed on each particular choice are shown at the bottom. 17–24 mosquitoes/trial; n=11–12 trials/condition. One-way ANOVA with Holm-Šídák multiple comparisons test, p<0.05. Data labelled with different letters are significantly different. (G) Mating and blood feeding. Mating status of D0-D5 co-housed females assayed in (D) were determined post-hoc via spermatheca dissection. n=232–239 females analysed for each time point. (H) Mating after blood feeding. Blood-fed virgins were allowed to mate and assayed for second blood meal. Age-matched virgins were used as controls. 15–20 females/trial, n=10 trials. Unpaired t-test; ****p<0.0001.
Standardisation of various behavioural assays to study feeding behaviours in An. stephensi.
(A) Detailed schematic of the assay designed to assess the blood-feeding behaviour of virgins and co-housed females across the reproductive cycle. 0–7 hr-old mosquitoes were collected and about 20 females (with or without 20 males) were separated into cups. Each cup was aged appropriately and tested on the relevant day (see methods for more details). Number of blood-fed mosquitoes were visually scored, irrespective of the quantity fed. Representative images of differently fed females are shown in A’. Females were tested for first blood meal from the day of emergence (D0) to 5 days of age, every 24 hr. Spermathecae of co-housed females were dissected post-hoc to determine the mating status. To assay for the second blood meal, fully fed females were collected and aged appropriately in groups of 20. To assess feeding 1 day post-first blood meal (D1PBM), Rhodamine B was spiked in the second blood meal offered to the females. The subsequent days (D2PBM-D4PBM) were tested without any such spiking (grey box; see methods for more details). To assay for blood-feeding behaviour in females after oviposition (D1PO-D2PO), freshly oviposited females were collected and aged in groups of 20 for the appropriate time in cups (blue box; see methods for more details). In all cases, females were presented with host cues prior to the assay and testing was performed as shown in Figure 1B (see methods for more details). (B) Standardisation of spiking Rhodamine B dye in blood to assess feeding 24 hr post-first blood meal (D1PBM). To assay for the second blood meal, blood-fed females were collected, aged for 24 hr and offered Rhodamine B-spiked blood in a Hemotek. All other assay parameters remained the same as for the first blood meal (see methods for more details). Widefield fluorescent images of Ae. aegypti and An. stephensi fed on second blood meal spiked with Rhodamine B are shown. Images on the left (black box) show mosquitoes not fed and fed on un-spiked blood (without Rhodamine B), as controls for autofluorescence from body tissues and blood itself, respectively. Fluorescence from Rhodamine B added to the second blood meal enabled identification of fresh blood intake in previously fed mosquitoes reliably. (C, D) Comparison of feeding behaviours of Ae. aegypti females (C) and An. stephensi females (D) fed on blood with and without Rhodamine B at the indicated age. Females fed similarly on both indicating that Rhodamine B itself does not affect feeding behaviour. Unpaired t-test; n.s.: not significant, p>0.05. 16–20 females/trial. n=5 trials/group. D5(m): 5 days post-emergence, mated; D2PBM(m): 2 days post-blood meal, mated; D8(m): 8 days post-emergence, mated. (E) Determining optimal oviposition timing in An. stephensi. Females were tested in groups of 10 and average number of eggs laid per group are shown at the indicated day after the first blood meal. Dashed lines connect the eggs laid by each group on the indicated day. Majority of the eggs were laid 2 days after blood meal. 10 females/group, n=10 replicates/group. D0B-D5BM: 0–5 days post-blood meal, mated. (F) Standardisation of the dual choice assay, to determine the choice between blood and sugar in sugar-sated and sugar-starved An. stephensi females, co-housed with males. Widefield fluorescent images of females fed on either blood, sugar or both are shown. White arrowhead marks the fluorescence from sugar (spiked with Rhodamine B) in the abdomens of females engorged on blood, indicating that the female has fed on both. This is not observed in the females fed on blood alone. Females fed on sugar alone can be visualised by the fluorescent lean bellies. Unfed females exhibit no fluorescence or engorgement. (G) Widefield fluorescent images of female An. stephensi fed on sugar spiked with Rhodamine B. This setup was used to study the sugar-feeding behaviour of virgins and co-housed females across the reproductive cycle. Addition of Rhodamine B to standard sucrose solution enabled visualisation of even the smallest amounts ingested, as indicated by the white arrowheads, under the fluorescent microscope. (H) Mating status of sugar-fed and sugar-unfed co-housed females tested in Figures 1E and 24–20h post-emergence (D0–D5). n=175–179 females per time point. (I) Percent participation of virgin and co-housed females tested for host-seeking behaviour in the Y-maze olfactometer (Figure 2B), at different stages of the reproductive cycle. All females tested participated well. 17–21 females/trial, n=10 trials/group. Kruskal-Wallis, with Dunn’s multiple correction test, p<0.05. Data labelled with different letters are significantly different. (D0: day of emergence; D5(m): 5 days post-emergence, mated; D5: 5 days post-emergence, virgin; D3PBM(m): 3 days post-blood meal, mated; D3PBM: 3 days post-blood meal, virgin; D2PO(m): 2 days post-oviposition, mated. (m): mated).
Host seeking is modulated like blood feeding is in An. stephensi.
(A) Y-maze schematic for host-seeking behaviour of female An. stephensi. Females were acclimatised in the chamber for 5 min while being exposed to host kairomones presented in a test arm. A fan sucked the air from both host and control arms at 0.3–0.6 m/s. Post-acclimatisation, mosquitoes were released and allowed to choose between the two arms. (B) Percent females attracted to either host cues or control arm at the indicated time points. 17–21 females/trial, n=10 trials/group. Unpaired t-test; n.s.: not significant, p>0.05.; * p<0.05; ****p<0.0001. (D0: day of emergence; D5(m): 5 days post-emergence, mated; D5: 5 days post-emergence, virgin; D3PBM(m): 3 days post-blood meal, mated; D3PBM: 3 days post-blood meal, virgin; D2PO(m): 2 days post-oviposition, mated).
Neurotranscriptome of An. stephensi.
(A) Central brains sampled from males and females at different ages and feeding preferences for bulk RNA-seq. Uninterested in blood: D0 males, D0 females, D5 males. Blood-hungry: D5, sugar-fed virgin females, D1PBM virgin females, and D1PO(m) mated females. Blood-sated: D1PBM(m) mated females. n=100 central brains per replicate; three biological replicates per sample, seven samples. (m): mated. (B) Principal Component Analysis (PCA) of the normalised counts-per-million. (C) Genes (listed on the right) with known expression patterns plotted across different samples. Average of the triplicate data are represented as z-score normalised log10 (TPM +1) values. Grey cells represent no data. (D) Identification of candidates potentially involved in promoting blood-feeding behaviour. Two types of comparisons were made: (left) genes commonly upregulated in the three blood-hungry conditions (see A) when compared against D0 females and excluded in males, and (right) genes upregulated in D5 sugar-fed virgin females when compared against D1PBM mated females (blood-sated) and excluded in males. Number of candidate genes identified from two different sets of analyses are boxed in red. (E) Nine candidate genes (listed on the right), shortlisted for further validation. RNA-seq data from central brain samples in triplicates are represented as z-score normalised log10 (TPM +1) values. (D0: day of emergence; D5: 5 days post-emergence, virgin; D1PBM: 1 day post-blood meal, virgin; D1PBM(m): 1 day post-blood meal, mated; D1PO(m): 1 day post-oviposition, mated).
Differential expression of genes across various states of blood-hunger and -satiety.
(A) Number of genes identified to be differentially up- and downregulated in the central brain of females across the reproductive cycle (indicated at the bottom), compared to either newly emerged males or females (D0), or blood-fed sated females (D1PBM(m)). Note that no genes were found to be differentially expressed between mated and virgin blood-fed females, despite their contrasting blood-appetites. (B) Top 10 Gene Ontology terms for Biological Processes (GOBP), overrepresented in the samples indicated at the bottom, compared to newly emerged males or females (D0). Size of the dot indicates the p-value significance. Processes involved in protein metabolism (highlighted in red) were found to be highly enriched in blood-fed females. (D0: day of emergence; D5: 5 days post-emergence, virgin; D1PBM: 1 day post-blood meal, virgin; D1PBM(m): 1 day post-blood meal, mated; D1PO(m): 1 day post-oviposition, mated. (m): mated).
Differential expression of genes involved in carbohydrate metabolism across different tissues and states of blood-hunger and -satiety in An. stephensi.
Expression patterns of genes (listed on the right) involved in sugar metabolism via different pathways, across the reproductive cycle in the central brain and in the fat body, midgut and ovary of blood-hungry females, are represented as heatmaps. Green box shows downregulation of genes involved in glucose utilisation and the magenta box represents genes involved in glucose storage. Note that both are low in the brains of blood-fed females suggesting that the brain goes into a state of ‘sugar rest’ after a blood meal. Analysing publicly available data from the midgut, ovary, and fat body of sugar-fed females suggests that energy expenditure via the non-oxidative branch of the pentose phosphate pathway of glucose metabolism is high in these tissues, likely to prime them for the blood meal. RNA-seq data from all central brain samples in triplicates and single sample data for fat body, midgut, and ovary (taken from Prasad et al., 2017) are represented as z-score normalised log10 (TPM +1) values. TPM values of zero were excluded from z-score transformation and are displayed as grey cells. (D0: day of emergence; D2-D4: 2–4 days post emergence; D5: 5 days post-emergence, virgin; D1PBM: 1 day post-blood meal, virgin; D1PBM(m): 1 day post-blood meal, mated; D1PO (m): 1 day post-oviposition, mated. (m): mated).
Differential expression of genes involved in lipid metabolism across different tissues and states of blood-hunger and -satiety in An. stephensi.
Expression patterns of genes (listed on the right) involved in lipid metabolism: lipid breakdown (top) and lipid synthesis (bottom), across the reproductive cycle in the central brain and in the fat body, midgut and ovary of blood-hungry females, are represented as heatmaps. No specific patterns were observed in the central brain (pre- and post-blood meal), midgut or ovaries. As expected, fat body showed high expression of genes involved in both the catabolic and anabolic branches of fatty-acid metabolism. RNA-seq data from all central brain samples in triplicates and single sample data for fat body, midgut, and ovary (taken from Prasad et al., 2017) are represented as z-score normalised log10 (TPM +1) values. TPM values of zero were excluded from z-score transformation and are displayed as grey cells. (D0: day of emergence; D2-D4: 2–4 days post emergence; D5: 5 days post-emergence, virgin; D1PBM: 1 day post-blood meal, virgin; D1PBM(m): 1 day post-blood meal, mated; D1PO(m): 1 day post-oviposition, mated. (m): mated).
Expression patterns of neuropeptides and neuropeptide receptors across different tissues and states of blood-hunger and -satiety in An. stephensi.
Expression patterns of neuropeptides (top) and neuropeptide receptors (bottom), across the reproductive cycle in the central brain and in the fat body, midgut, and ovary of blood-hungry females, are represented as heatmaps. While neuropeptides were observed to be downregulated in the central brain of newly emerged males and females (D0), neuropeptide receptors showed no such patterns. Additionally, both neuropeptides and their receptors were much more abundant in the brain, as compared to fat body, midgut or ovaries. Transcripts for the receptors highlighted in red were visualised in situ both in the midgut and brain samples via HCR (Figure 4—figure supplement 3, Figure 4—figure supplement 4). RNA-seq data from all central brain samples in triplicates and single sample data for fat body, midgut and ovary (taken from Prasad et al., 2017) are represented as z-score normalised log10 (TPM +1) values. TPM values of zero were excluded from z-score transformation and are displayed as grey cells. (D0: day of emergence; D2-D4: 2–4 days post emergence; D5: 5 days post-emergence, virgin; D1PBM: 1 day post-blood meal, virgin; D1PBM(m): 1 day post-blood meal, mated; D1PO(m): 1 day post-oviposition, mated. (m): mated).
Expression patterns of neurotransmitter-related genes in the central brain of An. stephensi across different states of blood-hunger and -satiety.
Expression patterns of genes (listed on the right) involved in neurotransmitter expression, processing and transport across the reproductive cycle in the central brain, are represented as heatmaps. Interestingly, many of these genes were observed to be upregulated in the newly emerged (D0) mosquitoes as compared to the older and blood-fed mosquitoes. RNA-seq data from all central brain samples in triplicates are represented as z-score normalised log10 (TPM +1) values. (D0: day of emergence; D5: 5 days post-emergence, virgin; D1PBM: 1 day post-blood meal, virgin; D1PBM(m): 1 day post-blood meal, mated; D1PO(m): 1 day post-oviposition, mated. (m): mated).
Candidates potentially involved in promoting blood-feeding behaviour in An. stephensi.
71 candidate genes identified as potential promoters of blood-feeding behaviour are listed. These were identified to be commonly upregulated in different conditions of blood-hunger (as compared to conditions of satiety or no-interest), and non-overlapping in males. Nine genes shortlisted for further validation are highlighted in red. RNA-seq data from all central brain samples in triplicates are represented as z-score normalised log10 (TPM +1) values. TPM values of zero were excluded from z-score transformation and are displayed as grey cells. (D0: day of emergence; D5: 5 days post-emergence, virgin; D1PBM: 1 day post-blood meal, virgin; D1PBM(m): 1 day post-blood meal, mated; D1PO(m): 1 day post-oviposition, mated. (m): mated).
short neuropeptide F (sNPF) and RYamide (RYa) together promote blood feeding in An. stephensi.
(A) Pipeline used for functional validation: dsRNAs were injected in adult virgins and tested for feeding behaviours. Knockdown efficiency was determined in heads and abdomens of fed and/or unfed females after the behaviour. (B) Blood feeding in uninjected and dsGFP-injected females. 19–25 females/replicate, n=8–9 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05. (C) Blood- and sugar-feeding behaviour of females where both RYa and sNPF were knocked down in both the heads and abdomens. Controls: Uninjected females. 14–25 females/replicate, n=8–9 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05; ****p<0.0001. (D) Relative mRNA expressions of RYa and sNPF in the heads of dsRYa +dssNPF- injected blood-fed and unfed females assayed in (C). mRNA levels were compared to those in the uninjected controls. n=5 replicates/group. Mean ± SEM are plotted. One-way ANOVA with Holm-Šídák multiple comparisons test for relative RYa expression and Kruskal-Wallis with Dunn’s multiple comparisons test for relative sNPF expression, p<0.05. Data labelled with different letters are significantly different. (E) Blood- and sugar-feeding behaviour of females when both RYa and sNPF were knocked down only in the abdomens. Controls: dsGFP-injected or uninjected females. 17–22 females/replicate, n=5 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05. (F, G) Relative mRNA expressions of RYa (F) and sNPF (G) in the heads and abdomens of dsRYa +dssNPF- injected fed females assayed in (E). mRNA levels in both tissues were compared to their respective dsGFP-injected or uninjected females controls. n=5 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05; **p<0.01; ****p<0.0001. (H) RYa (cyan) and sNPF (magenta) HCR in situ hybridisation in central brain of 5-day-old sugar-fed virgin female. nc82 (blue). Scale bar, 50 µm. (I) Co-expression of RYa (cyan) and sNPF (magenta) in mushroom body Kenyon cells of 5-day-old sugar-fed virgin female. Scale bar, 50 µm. (J) sNPF expression in the SEZ of females uninterested in blood (D0), blood-hungry females (D5) and blood-sated females (D2PBM(m)). Magenta arrow marks the novel sNPF cluster only in the blood-hungry (D5) condition. Scale bar, 50 µm. (K) sNPF HCR in situ hybridisation in gut of 5-day-old sugar-fed virgin female. Higher magnification image is shown in K’. Scale bar, 50 µm. (L) sNPF expression in the posterior midguts of females uninterested in blood (D0), blood-hungry females (D5) and blood-sated females (D2PBM(m)). Note expression in enteroendocrine cells (K’) and in two cells in the anterior midgut (L, insets). (M) No. of sNPF-positive cells. n=5–7 guts per condition. Mean ± SEM are plotted. One-way ANOVA with Holm-Šídák multiple comparisons test, p<0.05. Data labelled with different letters are significantly different. (N) sNPF receptor (sNPFR) and RYa receptor (RYaR) HCR in situ hybridisation of central brain (left) and midgut (right) of 5-day-old sugar-fed virgin female. Scale bar, 50 µm. (O) Proposed model: RYa and RYaR (cyan) are expressed only in the brain, while sNPF and sNPFR (magenta) are expressed both in the brain and the gut. Increased sNPF levels in both the tissues (dashed circles) promote a state of blood-hunger, which may drive feeding behaviour either by sNPF’s action in the two tissues independently or via a communication between them. This happens in the context of RYa signalling in the brain. (D0: day of emergence; D5: 5 days post-emergence, virgin; D2PBM(m): 2 days post-blood meal, mated).
Screening of the shortlisted candidates, potentially involved in promoting blood-feeding behaviour in An. stephensi via dsRNA-mediated gene knockdown.
(A-H) Blood-feeding behaviour of virgin females injected with dsRNA against Eiger (A), Juvenile hormone epoxide hydrolase-1 like (JHEH) (B), Orcokinin peptides type-A like (Ork) (C), Hairy (D), Prothoracicostatic peptides (Prp) (E), Na-dependent amino acid transporter-1 like 118504075 (F), Na-dependent amino acid transporter-1 like 118504077 (G), 118504075+118504077 (H). dsGFP was injected as a control in each case. 18–25 females/replicate, n=2–6 replicates/group. Mean ± SEM are plotted in each case. Unpaired t-test; n.s.: not significant, p>0.05; *p<0.05 (A, D, F, G, H). (A’-H’). Relative mRNA expression in the heads of virgin An. stephensi females injected with the indicated dsRNA, as compared to that in dsGFP-injected females, analysed via qPCR. For females injected with ds118504077, ds118504075 and ds118504075+ds118504077, gene expressions in fed and unfed mosquitoes were analysed separately, with statistical comparisons performed with their respective controls (F’-H’). Unpaired t-test were used for all comparisons (A’, D’, F’, G’, H’), except for 118504077 expression in unfed samples from ds118504077 and ds118504075+ds118504077 injected females where Mann-Whitney test was used; n.s.: not significant, p>0.05; ***p<0.001; **p<0.01; *p<0.05. Mean ± SEM are plotted in each case. For candidates JHEH (B), Ork (C), and Prp (E), significance of knockdowns could not be assessed, as statistical testing requires a minimum of three replicates, which were not available for these experiments.
Abdominal knockdown of RYa or sNPF alone does not contribute to the blood-feeding behaviour in An. stephensi.
(A) Widefield fluorescent images of females assayed for both sugar- and blood feeding, post-dsRNA injections. To assay for sugar feeding, injected females were offered Rhodamine B-spiked sugar 24 hr prior to the behavioural assay. Blood-feeding behaviour was tested as described earlier. Representative images of females fed on both blood and sugar, blood only, sugar only or none, are shown. (B) Schematic of the injection protocol for tissue-specific knockdowns. dsRNA injections in young females produced abdomen-specific knockdowns even at low concentrations, while higher concentrations in older females led to knockdowns in both heads and abdomens. (C) Blood- and sugar-feeding behaviour of virgin females where dsRYa is knocked down in both heads and abdomens. Controls: dsGFP-injected or uninjected females. 16–25 females/replicate, n=6–9 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05. (D, E). Relative mRNA expressions of RYa in the heads (D) and abdomens (E) of dsRYa-injected females assayed in (C). mRNA levels were compared to those in the uninjected or dsGFP-injected controls. n=6–9 replicates/group. Mean ± SEM are plotted. Unpaired t-test; **p<0.01; ****p<0.0001. (F) Percent females engorged on blood upon dsRYa knockdown in both heads and abdomens, assayed in (C). Controls: dsGFP-injected or uninjected females. n=7–9 replicates/group. Unpaired t-test; *p<0.05. (G) Blood- and sugar-feeding behaviour of virgin females where sNPF is knocked down in both heads and abdomens. Controls: dsGFP-injected or uninjected females. 17–26 females/replicate, n=6–7 replicates/group. Mean ± SEM are plotted. Mann-Whitney test; n.s.: not significant, p>0.05. (H, I). Relative mRNA expressions of sNPF in the heads (H) and abdomens (I) of sNPF-injected females assayed in (G). mRNA levels were compared to those in the uninjected or dsGFP-injected controls. n=6–7 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05; **p<0.01. (J) Percent females engorged on blood upon sNPF knockdown in both heads and abdomens, assayed in (G). Controls: dsGFP-injected or uninjected females. n=6–7 replicates/group. Unpaired t-test; **p<0.01. (K) Representative widefield images of females considered to be engorged or not in (F) and (J). (L) Blood- and sugar-feeding behaviour of virgin females where dsRYa is knocked down in abdomens only. Controls: dsGFP-injected females. 19–24 females/replicate, n=4–5 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05. (M,N) Relative mRNA expressions of RYa in the heads (M) and abdomens (N) of dsRYa-injected females assayed in (L). mRNA levels were compared to those dsGFP-injected controls. n=4–5 replicates/group. Mean ± SEM are plotted. Mann-Whitney test; n.s.: not significant, p>0.05 (M). Unpaired t-test; ***p<0.001 (N). (O) Blood- and sugar-feeding behaviour of virgin females where sNPF is knocked down in abdomens only. Controls: dsGFP-injected females. 19–23 females/replicate, n=5 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05. (P, Q) Relative mRNA expressions of sNPF in the heads (P) and abdomens (Q) of sNPF-injected females assayed in (O). mRNA levels were compared to those dsGFP-injected controls. n=5 replicates/group. Mean ± SEM are plotted. Unpaired t-test; n.s.: not significant, p>0.05; *p<0.05.
Transcripts of neuropeptides sNPF, RYa and their receptors are expressed in An. stephensi central brain.
(A, B) RYa and sNPF mRNA expression in the central brain of females uninterested in blood (D0), blood-hungry females (D5) and blood-sated females (D2PBM(m)), analysed via HCR. Transcripts of both neuropeptides are expressed in several clusters across the central brain (A). While the clusters are largely non-overlapping, co-expression was observed in the mushroom body Kenyon cells, indicated by the marked area (B). Maximum intensity projections of all confocal stacks (A) or selected stacks (B) are shown. Scale bar, 50 µm. (C). RYa receptor (RYaR) and sNPF receptor (sNPFR) mRNA expression in the central brain of females uninterested in blood (D0), blood-hungry females (D5) and blood-sated (D2PBM(m)), analysed via HCR. Transcripts of both receptors were found to be expressed in multiple cells. Maximum intensity projections of confocal stacks are shown. Scale bar, 50 µm. (D) sNPFR mRNA expression in the central complex. A magnified image is shown in D’. Maximum intensity projection of selected confocal stacks is shown. Scale bar, 50 µm. (E). Central brain samples incubated with HCR-Amplifiers only, to serve as a control for background signal in the absence of HCR probes. No signal was observed for either of the amplifiers used (B1 labelled with 546 fluorophore [B1-546] and B2 labelled with 488 fluorophore [B2-488]). (D0: day of emergence; D5: 5 days post-emergence, virgin; D2PBM(m): 2 days post-blood meal, mated. (m): mated).
Transcripts of sNPF and sNPFR are expressed in An. stephensi posterior midgut.
(A-F) RYa (A), sNPF (B), RYaR (C), and sNPFR (D) mRNA expression in the guts of females uninterested in blood (D0), blood-hungry females (D5) and blood-sated females (D2PBM(m)), analysed via HCR. Transcripts of both sNPF and its receptor sNPFR are expressed in the posterior midgut, at all stages analysed. No expression of RYa or RYaR was observed. Magnified images of transcript expression of neuropeptides and their receptors are shown in E and F, respectively. Scale bar, 50 µm. (G, H) Gut samples incubated with HCR-Amplifiers only, to serve as a control for background signal in the absence of HCR probes. No signal was observed for either of the amplifiers used (B1 labelled with 546 fluorophore [B1-546] and B2 labelled with 488 fluorophore [B2-488]). Scale bar, 50 µm. (D0: day of emergence; D5: 5 days post-emergence, virgin; D2PBM(m): 2 days post-blood meal, mated. (m): mated).
sNPF expression in the central brain of females uninterested in blood (D0), blood-hungry females (D5), and blood-sated females (D2PBM(m)), related to Figure 4J.
Confocal stacks of whole brains probed for sNPF mRNA expression via HCR in situ hybridisation, at three different conditions of blood-hunger and -satiety, are shown as movies. Note the appearance of novel clusters expressing sNPF transcripts (indicated by magenta arrows) in the subesophageal ganglionic region of the brain, only in the blood-hungry (D5) condition.
Tables
List of primers used in the study for dsRNA-mediated gene knockdown and quantitative PCR (qPCR).
| S. no. | Primer name | Primer sequence |
|---|---|---|
| 1.0 | T7-GFP_F_RNAi | TAATACGACTCACTATAGGGAGACTGGTCGAGCTGGACGGCGA |
| 2.0 | T7-GFP_R_RNAi | TAATACGACTCACTATAGGGAGACTTCTCGTTGGGGTCTTTGCTCAGG |
| 3.0 | T7-RYamide_F_RNAi | TAATACGACTCACTATAGGGATGACCTGGCGAACGATGAAAC |
| 4.0 | T7-RYamide_R_RNAi | TAATACGACTCACTATAGGGGGTCGCCATTCTCGTTGAACTGG |
| 5.0 | RYamide_qPCR_F | ACCGATGCTACAGTCGTGATTCG |
| 6.0 | RYamide_qPCR_R | TAGGCTAGTTGCATGGATCGTACC |
| 7.0 | T7-sNPF_F_RNAi | TAATACGACTCACTATAGGGTTTGATGTCGGAGTCACTGCATCC |
| 8.0 | T7-sNPF_R_RNAi | TAATACGACTCACTATAGGGTCACTCGCATCGTTAACCAACTGC |
| 9.0 | sNPF_qPCR_F | CAATGAGCATCAGCTAGCACCG |
| 10.0 | sNPF_qPCR_R | TCTAGCGCTTTATCCTCGGAGG |
| 11.0 | T7-Hairy_RNAi_F | TAATACGACTCACTATAGGGCTCGTATCAACAACTGTCTGAACG |
| 12.0 | T7-Hairy_RNAi_R | TAATACGACTCACTATAGGGGTACTTGGGTGGTGAGCGTTTGG |
| 13.0 | Hairy_qPCR_F | AATCGTCGGAGCAACAAACCGATC |
| 14.0 | Hairy_qPCR_R | GATGCTTCACCGTCATCTCCAGG |
| 15.0 | T7-Eiger_RNAi_F | TAATACGACTCACTATAGGGCTGGACGATAGCGAGGAAAAGG |
| 16.0 | T7-Eiger_RNAi_R | TAATACGACTCACTATAGGGGCTCATTCGGTTCAGTATTTGTGC |
| 17.0 | Eiger_qPCR_F | GGGCGTAAGACATCACTCACGC |
| 18.0 | Eiger_qPCR_R | TACGATTTCCTTCTGCGTTCCAGG |
| 19.0 | T7-JHEH_RNAi_F | TAATACGACTCACTATAGGGGATTATTGGGGACCCGGAAATGG |
| 20.0 | T7-JHEH_RNAi_R | TAATACGACTCACTATAGGGCGTTTGTGACCGATGCGTTCC |
| 21.0 | JHEH_qPCR_F | ATCGCCAGTGCCAGTTGAGC |
| 22.0 | JHEH_qPCR_R | TTGCTCCATTTCCGGGTCCC |
| 23.0 | T7-Prp_RNAi_F | TAATACGACTCACTATAGGGAATGTATCGCGGTCTGCTTTGC |
| 24.0 | T7-Prp_RNAi_R | TAATACGACTCACTATAGGGCGACTAATTTCCTGCCGTTTGCC |
| 25.0 | Prp_qPCR_F | AAGTTCGGTGCGGCCTGG |
| 26.0 | Prp_qPCR_R | TCTGCTGCTGCTGCTGCTG |
| 27.0 | T7-4075_RNAi_F | TAATACGACTCACTATAGGGGATACGGTCACTTCGCTGGTGG |
| 28.0 | T7-4075_RNAi_R | TAATACGACTCACTATAGGGATGAACAGTACGGTGATGGGCG |
| 29.0 | 4075_qPCR_F | CCTTCGCCTGGATCTATGGCG |
| 30.0 | 4075_qPCR_R | CGAGCGCATTGTAACCGAGTGG |
| 31.0 | T7-4077_RNAi_F | TAATACGACTCACTATAGGGCTCGACACATTCACCTCCATCG |
| 32.0 | T7-4077_RNAi_R | TAATACGACTCACTATAGGGATAAGAATGAGCAGTGTGGCGG |
| 33.0 | 4077_qPCR_F | ATCTACGGCGTGGATCGTATCTGC |
| 34.0 | 4077_qPCR_R | CCTAAAACGTTGTAGCCGATCGGG |
| 35.0 | T7-Orcokinin_F_RNAi | TAATACGACTCACTATAGGGGTCTGTGCCGTACTGCTGTTCG |
| 36.0 | T7-Orcokinin_R_RNAi | TAATACGACTCACTATAGGGGATCGTGCTTCAGGTTGTTACCGG |
| 37.0 | Orcokinin_qPCR_F | GCTGAACGATGGCCAACTAAAGC |
| 38.0 | Orcokinin_qPCR_R | CTTGTCGTACATCGGTGCCAATCC |
| 39.0 | RpS7_qPCR_F | AGGTTGTCGGCAAGCGTATCC |
| 40.0 | RpS7_qPCR_R | AGCTTCTTGTACACCGACGCG |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/108625/elife-108625-mdarchecklist1-v1.pdf
-
Supplementary file 1
Summary of statistical analysis of feeding behaviours using Generalised Linear Mixed Models (GLMM).
- https://cdn.elifesciences.org/articles/108625/elife-108625-supp1-v1.pdf
-
Supplementary file 2
Table of transcript abundance (in TPM values) for genes identified in the central brain RNAseq data across the gonotrophic cycle.
- https://cdn.elifesciences.org/articles/108625/elife-108625-supp2-v1.xlsx
-
Supplementary file 3
Table of differentially expressed genes (DEGs) identified across states of blood-hunger and -satiety.
- https://cdn.elifesciences.org/articles/108625/elife-108625-supp3-v1.xlsx