Three metabolic pathways replenishing the one-carbon pool collectively support growth and virulence of Listeria monocytogenes
Figures
Importance of the gcvPAB genes for the generation of one-carbon donors and for plaque formation in 3T3 mouse fibroblasts.
(A) Three enzymatic pathways ensure N5, N10-methylene-THF biosynthesis in L. monocytogenes. N5, N10-methylene-THF is generated (i) during the conversion of serine to glycine by GlyA (green), (ii) during glycine degradation in the GcvPAB-dependent GCS by GcvP and GcvT (orange), and (iii) by formate THF ligase Fhs in cooperation with the bifunctional N5,N10-methylene-THF dehydrogenase/cyclohydrolase FolD (blue). Biosynthesis of THF from dihydrofolate (DHF) and p-aminobenzoate (PABA) is inhibited by trimethoprim (TMP) and sulfamethoxazole (SMX). (B) Plaque formation assay in 3T3 mouse embryo fibroblasts with L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), and LMS311 (igcvPAB). 1 mM IPTG was added as indicated. (C) Quantification of the assay shown in panel (B). Plaque areas were determined using ImageJ, and average values and standard deviations were calculated from three independent experiments. Original data points are shown, and the asterisk marks a statistically significant difference (p<0.01, t-test with Bonferroni–Holm correction, ns, not significant).
Dissemination of the ΔgcvPAB mutant in 3T3 mouse fibroblasts.
Micrographs showing intracellular dissemination of dsRed-Express producing L. monocytogenes strains LMJD20 (wt), LMFS1 (ΔgcvPAB), and LMSF2 (ΔactA) in 3T3 mouse fibroblasts 6 hours post-infection.
In vitro and in vivo virulence of the ΔgcvPAB mutant.
(A) Replication of L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), LMS250 (Δhly, replication-deficient control), and LMS251 (ΔactA, spreading-deficient control) in 3T3 mouse fibroblasts. (B) Replication of L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), and LMS250 (Δhly, negative control) in J774 mouse macrophages. (C) Replication of L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), and BUG2214 (ΔprfA, invasion and replication-deficient control) in HepG2 human hepatocytes. The experiments shown in (A–C) were repeated three times, with each run consisting of technical replicates (n=3). The mean values and standard deviations were calculated from the technical replicates of a representative run. Asterisks mark statistically significant differences (panels A and B: p<0.01 t-test with Bonferroni–Holm correction, panel C: p<0.05 t-test). (D) CAMP assay to compare hemolysis in L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), and LMS250 (Δhly, negative control). (E) Quantification of hemolysis activity in the same set of strains towards human erythrocytes. Hemolysis activity is expressed as the number of 10-fold dilutions of the various culture supernatants after which no hemolysis could be observed anymore. The experiment was carried out four times. The asterisk marks a statistically significant difference (p<0.01, t-test with Bonferroni–Holm correction). (F) Lysozyme-induced lysis of L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), and LMS163 (ΔpgdA, positive control). The experiment was repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run. (G–I) Virulence of the ∆gcvPAB mutant in mice. Infection was conducted with 1–20 × 104 CFUs/ml injected into the tail vein of the mice. Five mice were infected with either EGD-e or the ∆gcvPAB mutant. (G) Three days post-infection, CFU were quantified in the spleen, liver, and brain to determine the bacterial burden. The geometric mean with the geometric standard deviation (SD) is illustrated. (H) Following infection, the mice were scored on a daily basis for weight loss as a parameter of disease severity during L. monocytogenes infection. The body weight is presented in relation to the weight prior to infection. The standard error of the mean (SEM) is shown. One representative experiment out of two independent repetitions is shown. (I) 9 days post-infection, the spleens were isolated and compared for organ size under infections with different L. monocytogenes strains. Statistical analysis was conducted utilizing the GraphPad Prism software, performing unpaired t-tests (G – two-tailed, H – one-tailed).
Growth of the ΔgcvPAB mutant in laboratory media.
(A) Growth of L. monocytogenes strains EGD-e (wt) and LMS305 (ΔgcvPAB) in complex BHI and chemically defined LSM medium. (B) Complementation of the growth defect of ΔgcvPAB mutant in LSM medium. Growth of L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), and LMS311 (igcvPAB) in LSM medium ±1 mM IPTG. The experiment was repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run.
The ΔgcvPAB mutant is sensitive to increased glycine concentrations.
(A, B) Growth of L. monocytogenes strains EGD-e (wt, A) and LMS305 (ΔgcvPAB, B) in LSM medium containing different glycine concentrations. Glycine concentrations are expressed relative to standard LSM concentrations (1×=1.3 mM). The experiment was repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run.
Growth of L. monocytogenes strains EGD-e (wt, A) and LMS305 (ΔgcvPAB, B) in LSM medium containing different serine concentrations.
Serine concentrations are expressed relative to standard LSM concentrations (1×=1 mM). Growth measurements were repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run.
Growth of an L. monocytogenes ΔglyA mutant in LSM medium with different glycine and serine concentrations.
(A, B) Growth of L. monocytogenes strains EGD-e (wt, A) and LMSF25 (ΔglyA, B) in LSM medium containing different glycine concentrations. (C, D) Growth of L. monocytogenes strains EGD-e (wt, C) and LMSF25 (ΔglyA, D) in LSM medium containing different serine concentrations. Glycine and serine concentrations are expressed relative to standard LSM concentrations (1×=1.3 mM for glycine, 1×=1 mM for serine). Growth measurements were repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run.
Suppression of the ΔgcvPAB phenotype by a fhs +mutation restoring formate-tetrahydrofolate ligase activity.
(A) Restoration of the full-length fhs open reading frame in ΔgcvPAB suppressor strain LMSF15. Schematic illustration of the fhs loci in the two reference strains 10403S (full length) and EGD-e (split into two pseudogenes due to a frameshift mutation in lmo1877) as well as in the ΔgcvPAB suppressor strain LMSF15 where a GTGG insertion (red) restores the full-length fhs gene. (B) Growth of ΔgcvPAB suppressor strains in various media. Strains EGD-e (wt), LMS305 (ΔgcvPAB), LMSF3 (ΔgcvPAB codY G236E), LMSF8 (ΔgcvPAB folK G82R), LMSF10 (ΔgcvPAB codY G236E glyA G62S), and LMSF15 (ΔgcvPAB fhs+) were grown in BHI broth (left panel), LSM medium without glycine (middle panel), and LSM medium supplemented with 100-fold the amount of glycine than in the standard recipe (right panel). Growth curves were repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run. (C) Intracellular growth of ΔgcvPAB suppressors in J774 mouse macrophages. The same set of strains as in the panel (B) was used to infect J774 macrophages, and the bacterial load 6 hours post-infection (p.i.) was determined. Infections were repeated three times, with each repetition consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative experiment. Asterisks mark statistically significant differences compared to wild type (black) or compared to the ΔgcvPAB mutant (red, p<0.01, t-test with Bonferroni–Holm correction, ns, not significant). (D) Recreation of the fhs+ mutation in the ΔgcvPAB background confirms suppression of ΔgcvPAB in vitro virulence phenotypes by restoration of Fhs activity. Intracellular replication of L. monocytogenes strains EGD-e (wt), LMS305 (ΔgcvPAB), LMSF26 (fhs+), and LMSF27 (ΔgcvPAB fhs+) in J774 mouse macrophages. Strains LMSF26 and LMSF27 were generated from EGD-e and LMS305, respectively, by introduction of the isolated fhs+ mutation. Infection experiments were repeated three times, with each repetition consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative experiment. Asterisks mark statistically significant differences compared to wild type (p<0.05, t-test with Bonferroni–Holm correction, ns, not significant). (E) Plaque formation in 3T3 mouse fibroblasts of the same set of strains as in panel (D). (F) Quantification of the assay shown in panel (E). Plaque areas were determined using ImageJ, and average values and standard deviations were calculated from three independent experiments. Original data points are shown, and the asterisk marks a statistically significant difference (p<0.01, t-test with Bonferroni–Holm correction, ns, not significant).
Importance of the GCS, GlyA, and Fhs for viability, intracellular growth, and adenine biosynthesis.
(A, B) Simultaneous absence of the GCS, GlyA, and Fhs activity is lethal. Growth of L. monocytogenes strains EGD-e (fhs⁻), LMS305 (fhs⁻ ΔgcvPAB), LMSF25 (fhs⁻ ΔglyA), LMTE151 (fhs+ ΔgcvPAB ΔglyA), and LMSF28 (fhs⁻ ΔglyA igcvPAB) in BHI (A) and LSM broth (B) containing or not containing 1 mM IPTG. Growth measurements were repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run. (C) Individual contribution of the three 1C-THF-generating pathways to intracellular growth in macrophages. Multiplication of L. monocytogenes strains EGD-e (fhs⁻), LMS305 (fhs⁻ ΔgcvPAB), LMSF25 (fhs⁻ ΔglyA), and LMTE151 (fhs+ ΔgcvPAB ΔglyA) inside J774 mouse macrophages within 6 hours post-infection. Infection experiments were repeated three times, with each repetition consisting of three technical replicates. Mean values and standard deviations were calculated from the technical replicates of a representative run. Statistical significance is labeled by an asterisk (p<0.01 t-test with Bonferroni–Holm correction) or ‘ns‘ (not significant). The presence or absence of the three pathways is indicated below the diagram. (D) Growth of L. monocytogenes strains EGD-e (wt) and LMS305 (∆gcvPAB) in LSM containing standard (18 µM) and increased adenine concentrations (1 mM). Growth measurements were repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run. (E) Complementation of growth defects of mutants lacking 1C-THF-generating pathways by adenine supplementation. L. monocytogenes strains EGD-e (fhs⁻), LMS305 (fhs⁻ ΔgcvPAB), LMSF25 (fhs⁻ ΔglyA), and LMSF28 (fhs⁻ ΔglyA igcvPAB) were grown in LSM broth and LSM broth supplemented with 1 mM adenine. LMSF28 cultures were also grown ±1 mM IPTG. Final optical densities were determined after 18 hours of growth. OD measurements were repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run. Asterisks mark statistically significant differences (p<0.01, t-test with Bonferroni–Holm correction where necessary, ns, not significant).
Synthetic lethality of the GCS, GlyA, and FolD can be compensated by thymine addition.
(A) Simultaneous absence of the GCS, GlyA, and FolD activity is lethal. Growth of L. monocytogenes strains LMSF26 (fhs+), LMTE151 (fhs+ ΔgcvPAB ΔglyA), LMMM14 (fhs+ ΔfolD), and LMMM13 (fhs+ ΔfolD ΔglyA igcvPAB) in BHI broth ±1 mM IPTG. For strain LMMM13, pre-depleted cells were used as inoculum. (B) Thymine but not adenine addition rescues growth of strain LMMM13 (fhs+ ΔfolD ΔglyA igcvPAB) in the absence of IPTG. Strain LMMM13 was cultivated in LSM broth ±1 mM IPTG and grown at 37°C for 24 hours. The same experiment was carried out in LSM broth containing 1 mM adenine or 0.5 mM thymine and the maximal optical density was determined. For strain LMMM13, cells grown in the presence of IPTG were used as inoculum. Both growth measurements were repeated three times, with each run consisting of technical replicates (n=3). Mean values and standard deviations were calculated from the technical replicates of a representative run. The p-value (t-test with Bonferroni–Holm correction) for the most relevant comparison is indicated.
Tables
Plasmids and L. monocytogenes strains used in this study.
| Name | Relevant characteristics | Source*/ reference |
|---|---|---|
| Plasmids | ||
| pIMK3 | Phelp-lacO lacI neo | Monk et al., 2008 |
| pJEBAN6 | Pdlt-dsRedExpress emR | Andersen et al., 2006 |
| pMAD | bla erm bgaB | Arnaud et al., 2004 |
| pMM13 | bla erm bgaB ΔfolD (lmo1360) | This work |
| pSF2 | bla erm bgaB ΔglyA (lmo2539) | This work |
| pSF4 | bla erm bgaB fhs+ (lmo1877nt1245insGTGG) | This work |
| pSH572 | attB::Phelp-lacO-gcvPAB lacI neo | This work |
| L. monocytogenes strains | ||
| EGD-e | Wild-type, serovar 1/2a strain | Fujiwara et al., 1984 |
| BUG2214 | ΔprfA | Mandin et al., 2007 |
| LMS163 | ΔpgdA | Rismondo et al., 2018 |
| LMS250 | Δhly | Fischer et al., 2022 |
| LMS251 | ΔactA | Fischer et al., 2022 |
| LMS305 | ΔgcvPAB (lmo1349-lmo1350) | Fischer et al., 2022 |
| LMJD20 | Pdlt-dsRedExpress emR | pJEBAN6 → EGD-e |
| LMMM12 | fhs+ ΔglyA igcvPAB | pSH572 → LMTE151 |
| LMMM13 | fhs+ ΔfolD ΔglyA igcvPAB | pMM13 ↔ LMMM12 |
| LMMM14 | fhs+ ΔfolD | pMM13 ↔ LMSF26 |
| LMS311 | ΔgcvPAB attB::Phelp-lacO-gcvPAB lacI neo | pSH572 → LMS305 |
| LMSF1 | ΔgcvPAB Pdlt-dsRedExpress emR | pJEBAN6 → LMS305 |
| LMSF2 | ΔactA Pdlt-dsRedExpress emR | pJEBAN6 → LMS251 |
| LMSF3 | ΔgcvPAB codY G236E | Gycine-resistant ΔgcvPAB suppressor |
| LMSF8 | ΔgcvPAB folK G82R | Glycine-resistant ΔgcvPAB suppressor |
| LMSF10 | ΔgcvPAB codY G236E glyA G62S | Glycine-resistant ΔgcvPAB suppressor |
| LMSF15 | ΔgcvPAB fhs+ | Glycine-resistant ΔgcvPAB suppressor |
| LMSF25 | ΔglyA | pSF2 ↔ EGDe |
| LMSF26 | fhs+ | pSF4 ↔ EGDe |
| LMSF27 | fhs+ ΔgcvPAB | pSF4 ↔ LMS305 |
| LMSF28 | ΔglyA igcvPAB | pSF2 ↔ LMS311 |
| LMTE151 | fhs+ ΔglyA ΔgcvPAB | pSF2 ↔ LMSF15 |
-
*
The arrow (→) stands for a transformation event and the double arrow (↔) indicates gene deletions obtained by chromosomal insertion and subsequent excision of pMAD plasmid derivatives (see experimental procedures for details).
Oligonucleotides used in this study.
| Name | Sequence (5´→3´) |
|---|---|
| MM52 | GATCTATCGATGCATGCCATGGCTACCGTAAAGGCGTAAAAG |
| MM53 | CGCGTCGGGCGATATCGGATCCCAAAATCAGTTTCATGTCCG |
| MM54 | CTTATTTTTAAGGGGGCAATACTCGTCGACTTAATTGGATGTGAAATG |
| MM55 | CATTTCACATCCAATTAAGTCGACGAGTATTGCCCCCTTAAAAATAAG |
| SF1 | GATGCATGCCATGGTACCCGGGCTATCTCTGAAAACTCACGTC |
| SF2 | GGATCACTTATTTTACTGCAGCATCTGTGGACCCCATCCTTTTC |
| SF3 | GGGGTCCACAGATGCTGCAGTAAAATAAGTGATCCGGTTTTTTC |
| SF4 | CGGATCCATATGACGTCGACGTATCATGGTCACGATAAAGACC |
| SF7 | GATGCATGCCATGGTACCCGGGAAAATAAACCTTGCGCGTTACC |
| SF8 | CGGATCCATATGACGTCGACCTCCTGCCATCGTACACGGCG |
| TE263 | GTAGAAGGAGAGTGAAACCCATGGCAAAACATCGTTATTTACCAATG |
| TE276 | CAAAGCATAATGGGATCGTCGACTTATACTTCTTTTTGATAACGTAAAATCGGTTTTC |