The chromatin remodeller CHD4 regulates transcription factor binding to both prevent activation of silent enhancers and maintain active regulatory elements
- Cambridge Stem Cell Institute, Jeffrey Cheah Biomedical Centre, University of Cambridge, United Kingdom
- Department of Biochemistry, University of Cambridge, United Kingdom
- Living Systems Institute, University of Exeter, United Kingdom
Figures
Figure 1 with 1 supplement
The impact of CHD4 depletion on chromatin accessibility.
(A) Western blots of nuclear soluble (nucleoplasm) and chromatin fractions across CHD4 depletion probed with antibodies directed against indicated proteins. Times in hours of Auxin addition are indicated across the top. Lamin B1 and Histone H3 act as loading controls. Position of relevant size marker indicated at left in KDa. (B) Cell cycle analysis across CHD4 depletion time course. Hours post Auxin addition are indicated at the bottom, ‘CTRL’ indicates DMSO control. Data represent an average of three replicates. Asterisks indicate significant differences from CTRL using a mixed-effects model with Dunnett’s multiple comparisons corrections. Error bars show standard error of the mean. *p < 0.05; **p < 0.01. Representative images of cells and cell cycle profiles are provided in Figure 1—figure supplement 1. (C) Volcano plots of differentially accessible ATAC-seq peaks between 0 and 1 hr of Auxin addition (left) or 0 and 4 hr of Auxin addition (right). Magenta spots indicate statistically significant differences (FDR >0.05). Numbers of peaks that decreased or increased significantly are indicated on the plots. (D) Heatmaps of ATAC-seq signal for all regions displaying increased accessibility (N = 52,041) or decreased accessibility (N = 8384) at any time across the CHD4 depletion time course are displayed for each time point. (E) Heatmaps of Cut&Run data for indicated histone modifications at sites increasing or decreasing in accessibility (as in panel D) at indicated times after CHD4 depletion. (F) Percentages of sites increasing in accessibility (top, blue) or decreasing in accessibility upon CHD4 depletion (bottom, red) which localise to indicated genomic features. Active enhancers are defined as having H3K4Me1 and K3K27Ac but not K3K4Me3, and inactive enhancers as having H3K4Me1 but not H3K4Me3 or H3K27Ac. (G) Heatmaps of CHD4 and MBD3 Cut&Run data at upDARs and downDARs in 2iL conditions. (H) Heatmaps of ATAC-seq signal at active enhancers (N = 4707) across the CHD4 depletion time course. Median curves in graphs in D, E, G, and H are plotted with standard error of the mean in lighter shading.
-
Figure 1—source data 1
PDF file containing original western blots for Figure 1A, indicating the relevant bands and conditions.
- https://cdn.elifesciences.org/articles/109280/elife-109280-fig1-data1-v1.zip
-
Figure 1—source data 2
Original files for western blots displayed in Figure 1A.
- https://cdn.elifesciences.org/articles/109280/elife-109280-fig1-data2-v1.zip
Figure 1—figure supplement 1
Cell cycle arrest and cell death following CHD4 depletion.
Phase contrast images and example flow cytometry plots of CHD4-mAID embryonic stem (ES) cells in 2iL conditions after indicated times of Auxin addition. Cell cycle stage and relative percentage of cells are indicated on the flow cytometry plots. Scale bars = 300µm.
Figure 2
CHD4 acutely regulates gene expression.
Heatmaps from nascent RNA-seq (A) or bulk RNA-seq (B) of genes showing significant (padj < 0.05) changes in expression at any point during the CHD4 depletion time course. Heatmaps display z-scores, meaning expression for each gene has been centred and scaled across the entire time course. (C) Volcano plots showing significant gene expression changes at indicated time points in nascent RNA-seq (top) and bulk RNA-seq (bottom). Genes increasing upon CHD4 depletion are shown in red, and those decreasing are shown in blue. The number of significantly misexpressed genes at each time point is indicated in the figure. (D) Violin plots showing the average log2 fold change of significant upregulated (red) and downregulated (blue) genes during the CHD4 depletion time course. (E) Gene ontology (GO) enrichment analysis of genes increased or decreased after 4 or 24 hr of CHD4 depletion. The top 10 biological processes are shown for each category, based on smallest adjusted p-value.
Figure 3
Chromatin opening upon CHD4 depletion.
(A) Frequency density distribution of the distance of increasing differentially accessible regions (‘↑ DAR’, red lines) and decreasing regions (‘↓ DAR’, blue lines) to the TSS of genes showing increased (solid lines) or decreased (dotted lines) expression within 4 hr of CHD4 depletion. (B) Heatmaps of Cut&Tag signal for H3K27Ac and H3K4Me1 at sites increasing in accessibility (N = 52,041) at indicated times of CHD4 depletion. (C) Heatmaps of NANOG and SOX2 Cut&Run signal at increasing accessibility sites at indicated times of CHD4 depletion. Median curves in B and C are plotted with standard error of the mean in lighter shading. (D) Pairwise comparisons of called peaks of binding for NANOG (top) and SOX2 (bottom) between undepleted cells (0 hr) and 30 min, 1 hr, or 4 hr of CHD4 depletion. Significantly changed (FDR >0.05) binding sites are shown in blue when log2 FC >0 and red when log2 FC <0. (E) IGV screenshot of the upstream region of the mouse Eomes locus displaying ATAC-seq, Cut&Run, and Cut&Tag data as indicated at left. Boxed regions labelled 1–5 are CHD4-condensed sites, while the box labelled P corresponds to the Eomes promoter.
Figure 4
CHD4 and SALL4 both restrict chromatin accessibility.
(A) Volcano plots of differentially accessible ATAC-seq peaks when comparing 1, 4, or 24 hr of SALL4 depletion with those seen in undepleted cells (0). Magenta spots indicate statistically significant differences (FDR >0.05). Numbers of peaks that decreased or increased significantly are indicated on the plots. (B) Heatmaps of ATAC-seq signal for all regions displaying increased accessibility (N = 26,510) across the SALL4 depletion time course are displayed for each time point. (C) Heatmap of SALL4 Cut&Run signal in undepleted embryonic stem (ES) cells (taken from Ru et al., 2022) at all regions displaying increased accessibility across the SALL4 depletion time course (left, N = 26,510) or at active enhancers (right, N = 4707). (D) Overlap of sites showing increased accessibility upon SALL4 depletion with those increasing upon CHD4 depletion (upDARs). The % A/T base composition of the different categories of sites is indicated. Heatmaps of ATAC-seq signal at sites increasing upon either SALL4 or CHD4 depletion (SALL4 + CHD4), sites increasing upon CHD4 depletion but not upon SALL4 depletion (CHD4 only), or sites increasing upon SALL4 depletion but not upon CHD4 depletion (SALL4 only) plotted at indicated time points of CHD4 depletion (E) and SALL4 depletion (F). Cut&Run signal for SALL4 (G) or for CHD4 and MBD3 (H) in undepleted ES cells at the three different classes of sites. Median curves in B, C, and E–H are plotted with standard error of the mean in lighter shading.
Figure 5
Nucleosome Remodelling and Deacetylation (NuRD) regulates NANOG and SOX2 binding to active sites.
(A) Heatmaps of NANOG and SOX2 Cut&Run signal at indicated times of CHD4 depletion across sites decreasing in accessibility (N = 8384). (B) Heatmaps of H3K27Ac and K3H4Me1 Cut&Tag signal at indicated times of CHD4 depletion across decreasing accessibility sites. (C) Heatmaps of Cut&Run signal for NANOG and SOX2 across active enhancers (N = 4707) at indicated times of CHD4 depletion. Median curves in A–C are plotted with standard error of the mean in lighter shading. (D) IGV screenshot of the enhancer cluster downstream of the Klf4 gene displaying ATAC-seq, Cut&Run, and Cut&Tag data as indicated at the left. Boxed regions are labelled with the distance in kb from the annotated Klf4 transcription start site. (E) Fluorescence survival curves of chromatin-bound NANOG-HALO molecules in 2iL (blue line) or after 1 hr of CHD4 depletion (purple line). The grey dotted line represents the fluorescence survival curve for molecules in a fixed-cell control imaged under identical conditions. (F) Apparent dissociation rates (koff) of chromatin-bound NANOG molecules calculated through fitting a single exponential decay model to the survival curves in panel E. Error bars represent 95% confidence intervals for each fit applied to data taken from three independent experiments. The horizontal dashed line represents the upper 95% confidence limit for a fixed-cell control. ** indicates that 99% confidence intervals do not overlap, that is p < 0.01. As in F but for SOX2 (G) and KLF4 (H). The fixed-cell control was not imaged in the SOX2 experiments in panel F. (I) Western blots of nuclear soluble (nucleoplasm) and chromatin fractions across MBD3 depletion probed with antibodies directed against the indicated proteins. Times in hours of Auxin addition are indicated across the top. Lamin B1 and Histone H3 act as loading controls. Position of relevant size marker indicated at left in KDa. (J, K) Apparent dissociation rates (koff) for NANOG-HALO (I) and KLF4-HALO (J) before and after 60 min of MBD3 depletion. For the calculation of koff, the trajectories were pooled from four replicates of each time point obtained over 2 days.
-
Figure 5—source data 1
PDF file containing original western blots for Figure 5I, indicating the relevant bands and conditions.
- https://cdn.elifesciences.org/articles/109280/elife-109280-fig5-data1-v1.zip
-
Figure 5—source data 2
Original files for western blots displayed in Figure 5I.
- https://cdn.elifesciences.org/articles/109280/elife-109280-fig5-data2-v1.zip
Figure 6 with 1 supplement
CHD4 controls accessibility differently at different classes of sites.
(A, C, E, G) Tn5 integration frequency was determined from ATAC-seq data and plotted across indicated sites across the CHD4 depletion time course. The number of sites is shown in parentheses. (B, D, F, H) Vplots across sites indicated above (corresponding to the Tn5 integration plots) at indicated times of CHD4 depletion. See Figure 6—figure supplement 1 for a Vplot schematic. (I) MNase-seq data collected 0 (red), 30 min (dark red), or 24 hr (black) after Nucleosome Remodelling and Deacetylation (NuRD) reformation in Mbd3−/− embryonic stem (ES) cells are plotted across indicated sites. Top graphs show results from ‘Hard’ MNase treatment while bottom graphs show ‘Soft’ MNase treatment (see text). The y-axis shows normalised read coverages, while the x-axis shows distance in base pairs from the centre of the feature. Curves show mean and standard error from three biological replicates.
Figure 6—figure supplement 1
Schematic diagram of Vplots.
Adapted from Henikoff et al., 2011. The Vplot is derived by plotting the midpoint of all recovered fragments (horizontal lines) onto the graph, with midpoint position (white circle) on the x-axis and fragment length on the y-axis. Red lines correspond to reads obtained from fragments with both ends (i.e. Tn5 integration sites) in the nucleosome-free region (NFR), while blue lines represent reads spanning a nucleosome. The vertical dotted line indicates the position of the central hyperaccessible site. The inferred chromatin structure of the locus is shown below.
Figure 7
Model of CHD4 function.
(A) Highly accessible sites. In undepleted cells, these sites are extensively bound by CHD4/NuRD, where it acts to promote the off rate of transcription factors (TFs) to promote accessibility. Tn5 is able to access the central nucleosome-free region (NFR) but also can integrate into the flanking nucleosomal DNA. After CHD4 depletion, the on rate for TFs does not change, but the off rate is now much reduced, resulting in increased TF binding. The sites become less accessible to Tn5, such that although it can still access the hypersensitive site within the NFR, there are fewer integrations extending outwards. These regulatory regions cannot quickly respond to receipt of external signals. (B) Model of CHD4 function at inaccessible, silent enhancers. In undepleted conditions, there is low CHD4 enrichment at these sites. Here, CHD4 acts to prevent binding of TFs and maintain low accessibility, such that Tn5 cannot frequently access the DNA. After CHD4 depletion, the locus becomes more accessible, and TFs can stably bind. This leads to spurious activation of distal promoters and an increase in transcriptional noise.
Tables
Table 1
gRNA sequences used for gene targeting.
| Gene | gRNA | Sequence (5′–3′) |
|---|---|---|
| Chd4 | gRNA1 | GGTGGAGGTGGATATCACTC |
| Mbd3 A3xF | gRNA1 | TTCTCACGCGTCACTCGCTC |
| Mbd3 | gRNA2 | CAGCCATTCCCTGGAAGTAC |
| Sall4 | gRNA1 | AATAAGATTGCTGTCAGCTA |
| Sall4 | gRNA2 | AAGATTGCTGTCAGCTAAGG |
| Nanog | gRNA1 | AACTACTCTGTGACTCCACC |
| Sox2 | gRNA1 | TGCCCCTGTCGCACATGTGA |
| Klf4 | gRNA2 | GTGGGTCACATCCACTACGT |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Mus musculus) (XY) | BC8 ES cells | PMID:26025256 | F1 hybrid from a C57Black/6 and Mus castaneus cross (40, XY), obtained from Anne Ferguson-Smith | |
| Cell line (Mus musculus) (XY) | CHD4-mAID ADNP-FKBP ES cells | This paper | CHD4-mAID/ADNP-FKBP/OsTir1 double depletable cell line. G418 resistant. Can be requested from BDH | |
| Cell line (Mus musculus) (XX) | MBD3-AID ES cells | This paper | MBD3-AID/OsTir1. G418, Hyg resistant. Made in 23AF. Can be requested from BDH | |
| Cell line (Mus musculus)(XX) | 23AF ES cells | This paper | primary ES cell line derived from Mbd2−/−, Mbd3Flox/Flox mice. G418 resistant. Can be requested from BDH | |
| Cell line (Mus musculus) (XX) | Sall4-FKBP ES cells | This paper | Created in Sall1−/− Sall4+/− ES cells. Can be requested from BDH | |
| Cell line (Mus musculus) (XX) | Sall1−/− Sall4+/− ES cells | PMID:27471257 | Parent line for Sall4-FKBP cells | |
| Cell line (Mus musculus)(XX) | Mbd3-inducible ES cells | PMID:30008319 | MER-MBD3b-MER in Mbd3(−/−) ES cells | |
| Cell line (Rattus norvegicus) | Rat ES cells | PMID:19109897 | Used as spike-in for genomics experiments. A gift from Austin Smith | |
| Antibody | anti-CHD4, mouse monoclonal | Abcam | RRID:AB_2229454, ab70469 | (1/5000) |
| Antibody | anti-CHD4, rabbit polyclonal | Abcam | RRID:AB_1268107, ab72418 | (1/10,000) |
| Antibody | anti-FLAG, mouse monoclonal | Sigma-Aldrich | RRID:AB_259529/RRID:AB_262044, F3165/F1804 | (1/2000) |
| Antibody | anti-HA, mouse monoclonal | Invitrogen | RRID:AB_10978021, 26183 | (1/2000) |
| Antibody | anti-ADNP, goat polyclonal | R&D Systems | AF5919 | (1/2000) |
| Antibody | anti-Histone H3, rabbit polyclonal | Abcam | RRID:AB_302613, ab1791 | (1/5000) |
| Antibody | anti-MTA2, mouse monoclonal | Abcam | RRID:AB_2146939, ab50209 | (1/5000) |
| Antibody | anti-NANOG, rabbit polyclonal | Bethyl Labs | RRID:AB_386108, A300-387A | (1/2000) |
| Antibody | anti-SOX2, rat monoclonal | Ebioscience | RRID:AB_11219471, 14-9811-82 | (1/2000) |
| Antibody | anti-LaminB1, rabbit polyclonal | Abcam | RRID:AB_2616597, ab133741 | (1/10,000) |
| Antibody | anti-H3K27Ac, rabbit polyclonal | Abcam | RRID:AB_2118291, ab4729 | (1/1000) |
| Antibody | anti-H3K4Me1, rabbit polyclonal | Abcam | RRID:AB_306847, ab8895 | (1/1000) |
| Antibody | anti-H3K4Me3, rabbit polyclonal | Millipore | RRID:AB_1163444, 04-745 | (1/1000) |
| Antibody | anti-H3K27Me3, rabbit polyclonal | Millipore | RRID:AB_310624, 07-449 | (1/1000) |
| Recombinant DNA reagent | Oct4-AID | PMID:34143975 | AID source. A gift from José Silva | |
| Recombinant DNA reagent | pLEX_305-C-dTAG | Addgene | RRID:Addgene_91798 | FKBP source.https://www.addgene.org/ |
| Recombinant DNA reagent | pMGS56 | Addgene | RRID:Addgene_129668 | GFP-ARF16-PB1-P2A-OsTIR1. https://www.addgene.org/ |
| Recombinant DNA reagent | pSpCas9(BB)-2A-GFP | Addgene | RRID:Addgene_48138 | Cas9/gRNA expression.https://www.addgene.org/ |
| Recombinant DNA reagent | PB CAG Tir1 iHyg | This paper | RRID:Addgene_235506 | OsTir1 Expression construct. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pBS_GGSG_Fkbp_2xHA_BB2 | This paper | RRID:Addgene_235503 | FKBP Cloning Vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pBS_GGSG_mAID_HA_BactBsd | This paper | RRID:Addgene_235504 | mAID Cloning Vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pBS AID-3xF_PP | This paper | RRID:Addgene_235502 | AID Cloning Vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pMbd3-GGSG-AID-3xF_PP | This paper | RRID:Addgene_235507 | MBD3-AID targeting vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pChd4 GGSG_mAID-3xF_BactBsd | This paper | RRID:Addgene_235508 | CHD4-mAID targeting vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pSall4_GGSG_Fkbp_2xHA_BB | This paper | RRID:Addgene_235510 | Sall4-FKBP targeting vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pAdnp_GGSG_Fkbp_2xHA_BB | This paper | RRID:Addgene_235526 | Sall4-FKBP targeting vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pNanog-Halo-Ty2-BactBsd | This paper | RRID:Addgene_235511 | Nanog-Halo targeting vector. https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pKlf4_Halo_Ty2_BactBsd | This paper | RRID:Addgene_235512 | Klf4-Halo targeting vector.https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | pSox2_Halo_Ty2_BactBsd | This paper | RRID:Addgene_235513 | Sox2-Halo targeting vector.https://www.addgene.org/Brian_Hendrich/ |
| Recombinant DNA reagent | 3XFlag-pA-Tn5-Fl | Addgene | RRID:Addgene_124601 | https://www.addgene.org/ |
| Recombinant DNA reagent | pAG/MNase | Addgene | RRID:Addgene_123461 | https://www.addgene.org/ |
| Sequence-based reagent | ATAC-seq: 0, 30, 60, and 240 min CHD4 depletion | This paper | E-MTAB-15037 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | ATAC-seq: 0, 1, 4, and 8 hr SALL4 depletion | This paper | E-MTAB-15375 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | RNA-seq: 0, 1, 2, 4, and 24 hr CHD4 depletion | This paper | E-MTAB-15102 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | nascent RNA-seq: 0, 1, 2, 3, 4, and 6 hr CHD4 depletion | This paper | E-MTAB-15127 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | Cut&Run: MBD3 and CHD4 | This paper | E-MTAB-15606 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | Cut&Run: NANOG and SOX2 after 0, 30, 60, and 240 min of CHD4 depletion | This paper | E-MTAB-15607 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | Cut&Run: SALL4 | PMID:36257403 | GSE203303 | https://www.ncbi.nlm.nih.gov/gds |
| Sequence-based reagent | Cut&Run: H3K4Me3 and H3K27Me3 | This paper | GSE311420 | https://www.ncbi.nlm.nih.gov/gds |
| Sequence-based reagent | Cut&Tag: H3K27Ac and H3K4Me1 after 0, 4, and 24 hr of CHD4 depletion | This paper | E-MTAB-15625 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | Cut&Tag: MBD3 after 0, 4, and 24 hr CHD4 depletion | This paper | E-MTAB-15627 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | MNase-seq, Mbd3-inducible ES cells, time 0, 0.5, and 24 hr, hard digest | PMID:30008319 | E-MTAB-6807 | https://www.ebi.ac.uk/biostudies/arrayexpress/studies/ |
| Sequence-based reagent | MNase-seq, Mbd3-inducible ES cells, time 0, 0.5, and 24 hr, soft digest | This paper | PRJNA1332303 | https://www.ncbi.nlm.nih.gov/sra |
| Peptide, recombinant protein | Micrococcal nuclease | New England Biolabs | M0247S | |
| Peptide, recombinant protein | pAG-MNAse | PMID:31232687 | Made in-house | |
| Peptide, recombinant protein | pA-Tn5 | PMID:31036827 | Made in-house | |
| Peptide, recombinant protein | Tn5 | PMID:25079858 | Made in-house | |
| Peptide, recombinant protein | mouse LIF | Cambridge Department of Biochemistry | (10 ng/ml) | |
| Commercial assay or kit | Direct-zol RNA Microprep | Zymo Research | R2062 | |
| Commercial assay or kit | DNA Clean and Concentrator-5 | Zymo Research | D4003 | |
| Commercial assay or kit | NEBNext High-Fidelity 2X PCR Master Mix | New England Biolabs | M0541L | |
| Chemical compound, drug | dTAG-13 | Bio-Techne Ltd | 6605/5 | (500 nM) |
| Chemical compound, drug | Auxin | Cambridge Bioscience | 16954-1g-CAY | (500 µM) |
| Chemical compound, drug | HaloTag-PA-JF646 | Lavis, Janelia | (250 nM) | |
| Chemical compound, drug | Propidium iodide | Invitrogen | P3566 | |
| Chemical compound, drug | PD0325901 | Cambridge Department of Biochemistry | (1 mM) | |
| Chemical compound, drug | CHIR99021 | Cambridge Department of Biochemistry | (3 mM) | |
| Software, algorithm | PeakFit tool within the GDSC single-molecule light microscopy (SMLM) plugin, V1 | PMID:37351368 | RRID:SCR_022717 | https://github.com/aherbert/gdsc-smlm |
| Software, algorithm | DHPSFU | PMID:40835649 | https://github.com/TheLaueLab/DHPSFU | |
| Software, algorithm | Trajectory Analysis | PMID:29955052 | hhttps://github.com/wb104/trajectory-analysis | |
| Software, algorithm | R version 4.3.1 (2023-06-16) | https://www.R-project.org/ | RRID:SCR_001905 | https://www.R-project.org/ |
| Software, algorithm | DiffBind | PMID:25972895 | RRID:SCR_012918 | https://bioconductor.org/packages/release/bioc/html/DiffBind.html |
| Software, algorithm | DEseq2 | PMID:25516281 | RRID:SCR_015687 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Software, algorithm | deepTools | PMID:27079975 | RRID:SCR_016366 | https://deeptools.readthedocs.io/ |
| Software, algorithm | VplotR | doi: 10.18129/B9.bioc.VplotR | https://bioconductor.org/packages/VplotR | |
| Software, algorithm | IGV – Integrative genomics viewer | PMID:21221095 | RRID:SCR_011793 | https://igv.org/ |
| Software, algorithm | TrimGalore v0.6.4 | doi: 10.5281/zenodo.5127898 | RRID:SCR_011847 | https://zenodo.org/records/7598955 |
| Software, algorithm | Burrows–Wheeler Aligner (BWA) | PMID:19451168 | RRID:SCR_010910 | https://bio-bwa.sourceforge.net/ |
| Software, algorithm | samtools | PMID:33590861 | RRID:SCR_002105 | https://www.htslib.org/ |
| Software, algorithm | featureCounts | PMID:24227677 | RRID:SCR_012919 | https://subread.sourceforge.net/featureCounts.html |
| Software, algorithm | MACS2 V2 | PMID:18798982 | RRID:SCR_013291 | https://github.com/macs3-project |
| Software, algorithm | HOMER | PMID:20513432 | RRID:SCR_010881 | http://homer.ucsd.edu/homer/ |
| Software, algorithm | ChromHMM | PMID:29120462 | RRID:SCR_018141 | https://ernstlab.biolchem.ucla.edu/software-and-resources/chromhmm |
| Software, algorithm | SEACR v1.3 | PMID:31300027 | RRID:SCR_027011 | https://github.com/FredHutch/SEACR |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The chromatin remodeller CHD4 regulates transcription factor binding to both prevent activation of silent enhancers and maintain active regulatory elements
eLife 14:RP109280.
https://doi.org/10.7554/eLife.109280.3
