Endogenous corazonin signaling modulates the post-mating switch in behavior and physiology in females of the brown planthopper and Drosophila
Figures
Corazonin (CRZ) signaling affects the post-mating response (PMR) and oviposition in female N. lugens.
Wild-type males were used in all behavioral assays. (A) Experimental design for panels B-C. The white/black segments on the experimental time lines denote light/dark periods, respectively. (B) Receptivity of virgin females 6 hr post-injection, using different doses of CRZ (sCRZ as control), each virgin female BPH was injected with a calibrated glass capillary needle directly into the abdomen with 100 ng/10 ng/1 ng/0.1 ng of peptide dissolved in 50 nL of 1x PBS balanced salt solution. The graph shows the percentage of females copulating within 30 min. **p<0.01 vs. control; ns (non-significant): p>0.05 (Mann-Whitney test). The small circles denote the number of replicates, ≥5 insects/replicate; the numbers above the curves denote total number of animals. (C) Eggs laid per mated female 24hr post-copulation. We used the highest CRZ dose from panel B (sCRZ, control). Each mated female BPH was injected with a calibrated glass capillary needle directly into the abdomen with 100 ng of peptide dissolved in 50 nL of 1x PBS balanced salt solution. *p<0.05 (Student’s t-test). Data: mean ± s.e.m (≥4 biological replicates, ≥6 insects/replicate). The numbers below the bars denote total number of animals. (D) Experimental design for panels E-F. (E) Receptivity of virgin (first mating) and mated females after Crz-RNAi (dsgfp as control). Graph displays the percentage of females copulating within 30 min. The small circles denote the number of replicates, ≥7 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (F) Total number of eggs laid per female over 72 hr after Crz-RNAi (dsgfp as control). ****p<0.0001 (Student’s t-test). The small circles and the numbers below the bars denote total number of animals, (≥4 biological replicates, ≥8 insects/replicate). Data are shown as mean ± s.e.m. (≥3 biological replicates, ≥8 insects/replicate). (G) Schematic diagram of the Crz gene and sgRNA (single-guide RNA) design for Crz mutant production. The Crz gene consists of 2 exons, and ATG and TAG are located on Exon 1. The target site of the 20 bp sgRNA on Exon 1 is highlighted in pink. The PAM sites are indicated in yellow. The two knockout strains ΔCrz1 and ΔCrz2 were unable to produce mature CRZ peptides. (G’) The amino acid sequences obtained by translating the mutated base sequences. (H) Absence of CRZ immunoreactivity in homozygous ΔCrz1 and ΔCrz2 mutants compared to wild-type (WT) expression. Scale bars: 50 μm. (I) Experimental design for panels J-K. (J) Receptivity of virgin/mated females across genotypes. No effect was seen on virgin receptivity, only the re-mating was affected. The small circles denote the number of replicates; ≥6 insects/replicate, the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (K) Eggs laid 72 hr post-mating. The numbers below the bars denote total number of animals, ≥4 biological replicates, ≥8 insects/replicate. Data are shown as mean ± s.e.m. ****p<0.0001; Student’s t-test.
-
Figure 1—source data 1
Source data for all graphs presented in Figure 1.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig1-data1-v1.xlsx
Evolutionary conservation of corazonin (CRZ) peptide sequences in Nilaparvata lugens and other arthropods.
(A) Alignment of mature CRZ peptide sequences across species. Abbreviations of species names are as follows: Bmori (Bombyx mori), Gmole (Grapholita molesta), Cpomo (Cydia pomonella), Sexig (Spodoptera exigua), Harmi (Helicoverpa armigera), Dplex (Danaus plexippus), Dmela (Drosophila melanogaster), Csupp (Chilo suppressalis), Dmagn (Daphnia magan), Dviri (Drosophila virilis), Cnodu (Catagly nodus), Carcu (Callinectes arcuatus), Nnorv (Nephrops norvegicus), Cmaen (Carcinus maenas), Mrose (Macrobrachium rosenbergii), Mscal (Megaselia scalaris), Cglom (Cotesia glomerata), Rmicr (Rhipicephalus microplus), Derec (Drosophila erecta), Agamb (Anopheles gambiae), Pstal (Plautia stali), Nluge (Nilaparvata lugens), Cdraw (Caerostris darwini), Cextr (Caerostris extrusa), Dpule (Daphnia pulex), Hitam (Heterotrigona itama), Lmigr (Locusta migratoria), Cmoro (Carausius morosus), Sgreg (Schistocerca gregaria), Lsalm (Lepeophtheirus salmonis), Alabo (Apis laboriosa). Species within the blue area possess highly conserved mature peptide sequences, whereas those in the magenta zone exhibit relatively less conservation in their mature peptides. (B) Schematic organization of CRZ precursors in representative species. Signal peptides (blue) and mature CRZ peptides (red) are indicated.
The corazonin (Crz) gene-silencing efficacy in female insects following dsRNA injection assayed by qPCR.
The small circles denote the number of replicates. Data are shown as mean ± s.e.m. Mann-Whitney test. **p<0.001.
-
Figure 1—figure supplement 2—source data 1
Source data for all graphs presented in Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig1-figsupp2-data1-v1.xlsx
Phenotypic effects of corazonin (CRZ) peptide injection.
(A) Receptivity of virgin females at indicated time points after CRZ injection (sCRZ as control). Each virgin female brown planthopper (BPH) was injected with a calibrated glass capillary needle directly into the abdomen with 100 ng of peptide dissolved in 50 nL of 1x PBS balanced salt solution. Graph shows the percentage of females copulating within 30 min. **p<0.01; ns: not significant Binomial, GLM with logit link, followed by pairwise contrasts. The small circles denote the number of replicates, ≥8 insects/replicate; the numbers associated with the curves denote total number of animals. (B) Eggs laid per virgin female after neuropeptide injection (sCRZ, control). Females were mated with wild-type males for 24hr prior to assessment. Each virgin female BPH was injected with a calibrated glass capillary needle directly into the abdomen with 100 ng of peptide dissolved in 50 nL of 1x PBS balanced salt solution. Data are shown as mean ± s.e.m. ns: p>0.05 (Student’s t-test). The numbers below the bars denote total number of animals, ≥4 biological replicates, ≥10 insects/replicate.
Characterization of corazonin (Crz) mutants in N. lugens.
(A) Sequencing of Crz mutant (ΔCrz1 and ΔCrz2) and wild-type (WT) PCR products from BPHs. The exact indel types of the G0 mutant individuals were confirmed by cloning and sequencing. The wild-type sequences are shown at the top with the target site marked in pink shading and PAM in yellow shading. The change in the length of the mutant sequence is shown on the right side of the sequence (+, insertion; -, deletion). (B) The Sanger sequence chromatograms flanking the sgRNA target site for wild-type (WT). (C-D) The Sanger sequence chromatograms flanking the sgRNA target site for wild-type (WT), heterozygous mutant (ΔCrz1/+ and ΔCrz2/+). (C’-D’) The Sanger sequence chromatograms flanking the sgRNA target site for wild-type (WT), homozygous mutant (ΔCrz1 and ΔCrz2). (E) Developmental duration (egg to adult) across genotypes. ****p<0.0001 (Student’s t-test). The numbers below the bars denote total number of animals. (F) Survival curves of adult Crz mutants vs. WT. *p<0.05 (Log-rank Mantel-Cox test; df = 1; n≥50/group).
Virgin brown planthopper females reject mating after CRZ peptide injection.
Expression of Crz and corazonin (CRZ) in the nervous system of the brown planthopper (BPH).
(A) Schematic of primer design for Crz detection (primer sequences provided in Supplementary file 1). (B) RT-PCR analysis of Crz mRNA levels in various BPH tissues. Actin served as the loading control. Tissues: Nervous system (NS), fat body (FB), Epidermis (EP), digestive system (DS), female reproductive organs (FRO), male reproductive organs (MRO). Note: Tissues except reproductive organs were pooled from both sexes. (C) Relative Crz expression in female N. lugens tissues determined by RT-qPCR (abbreviations as in B). Expression was normalized to Actin and 18SrRNA and expressed relative to the mean value of the highest-expressing tissue (set to 1). Data are shown as mean ± s.e.m. Groups that share at least one letter are statistically indistinguishable. One-way ANOVA followed by Tukey’s multiple comparisons test. (D-E) Immunolocalization of CRZ peptide in the nervous system of male (D) and female (E) BPHs. Four pairs of CRZ neurons in the brain and one pair in the subesophageal ganglion are shown. Note that some of the CRZ neurons are likely to be neurosecretory cells with axon terminations in the corpora cardiaca, others may be interneurons. The extensive branches within the brain suggest CRZ signaling in brain circuits. VNC, ventral nerve cord. Scale bars: 50 μm. (E) CRZ immunolabeling in the nervous system of female BPHs. Scale bar: 50 μm. (F-G) Lack of CRZ immunoreactivity in BPH reproductive organs. (F1–F3) Male reproductive organs (MRO): testes (test). (G1–G3) Female reproductive organs (FRO): lateral oviduct (Lat. ov), common oviduct (Com. ov). Scale bars: 100 μm.
-
Figure 2—source data 1
Original gel image used for Figure 2B.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig2-data1-v1.zip
-
Figure 2—source data 2
Uncropped gel image for Figure 2B, with the relevant bands indicated.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig2-data2-v1.zip
-
Figure 2—source data 3
Source data for all graphs presented in Figure 2.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig2-data3-v1.xls
Corazonin (CRZ) immunolabeling in abdominal ganglion and reproductive organs of male and female brown planthoppers (BPHs) and D. melangaster.
Anti-CRZ immunolabeling in the abdominal ganglia of the ventral nerve cord (VNC) in N. lugens and D. melanogaster (D. Melan.). Scale bar: 50 μm. Note: Male-specific CRZ-positive neurons are present in D. melanogaster, as previously reported.
The corazonin (CRZ) receptor (CrzR) is essential for the female post-mating response (PMR) and is required for action of male accessory gland (MAG)-derived factors.
(A) Experimental design for B and C. (B) Receptivity after CrzR-RNAi (injection of dsCrzR; dsGFP as control). Percentage of females copulating within 30 min. The small circles denote the number of replicates, ≥9 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (C) Numbers of eggs laid within 72 hr post-mating (dsCrzR females × WT males). Data are shown as mean ± s.e.m. ****p<0.0001 (Student’s t-test). The numbers below the bars denote total number of animals, ≥4 biological replicates, ≥7 insects/replicate. (D) Experimental design for E-F. (E) Receptivity after CRZ injection in CrzR-knockdown virgins (dsGFP+CRZ control). Graph shows the percentage of females copulating within 30 min. Each virgin female BPH was injected with a calibrated glass capillary needle directly into the abdomen with 10 ng of peptide dissolved in 50 nL of 1x PBS balanced salt solution. The small circles denote the number of replicates, ≥7 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (F) Receptivity after MAG extract (with seminal fluid proteins) injection in CrzR-knockdown virgins (dsGFP+SFP control). Percentage copulating within 30 min. The small circles denote the number of replicates, ≥7 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (G) CrzR targeting strategy for generation of mutants. Top: Genomic structure (ATG/TAG in Exons 2/7). sgRNA target (pink), PAM (yellow). Bottom: CRISPR alleles. (G’) Translated receptor mutant sequences. (H) Experimental design for I-J. (I) Receptivity of CrzR mutants compared to wild-type animals (WT). Graph displays the percentage of females copulating within 30 min. The small circles denote the number of replicates, ≥9 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (J) Number of eggs laid by mutants mated with WT males within 72 hr. The numbers below the bars denote total number of animals, ≥4 biological replicates, ≥7 insects/replicate. Data are shown as mean ± s.e.m. ****p<0.0001; Student’s t-test. (K) Experimental design for L-M. (L) Receptivity after CRZ injection in CrzR mutants compared to WT. Graph displays the percentage of females copulating within 30 min. Each virgin female BPH was injected with a calibrated glass capillary needle directly into the abdomen with 10 ng of peptide dissolved in 50 nL of 1x PBS balanced salt solution. The small circles denote the number of replicates, ≥5 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (M) Receptivity after SFP injection in CrzR mutants compared to WT. Graph displays the percentage of females copulating within 30 min. The small circles denote the number of replicates, ≥7 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (N) Receptivity after macc injection in CrzR mutants compared to WT. Graph displays the percentage of females copulating within 30 min. The small circles denote the number of replicates, ≥10 insects/replicate; the numbers below the bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant.
-
Figure 3—source data 1
Source data for all graphs presented in Figure 3.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig3-data1-v1.xlsx
Structural conservation of the CrzR across insect species.
(A) Multiple sequence alignment highlighting conserved transmembrane domains (TM1-TM7, shaded) in corazonin (CRZ) receptor orthologs. The species shown are: N. lugens: Nilaparvata lugens; M. sexta: Manduca sexta; B. mori: Bombyx mori; A. gamb: Anopheles gambiae; D. mel: D. melanogaster. (B) Phylogenetic analysis of CrzR and AkhR based on the alignment of amino acid sequences of insect species. Phylogenetic analysis was performed in MEGA 12 using the Maximum Likelihood method with the LG amino-acid substitution model and Gamma-distributed rate variation among sites (G, 5 discrete categories), with gaps treated by complete deletion. Branch support was evaluated with 10,000 bootstrap replicates, and the numbers at the nodes indicate bootstrap support values.
Characterization of CrzR mutants in N. lugens.
(A) Sanger sequencing of CrzR mutants. Wild-type (WT) sequence with target (pink), PAM (yellow). Indels: + (insertion), – (deletion). (B) Sanger sequencing chromatograms of CrzR alleles: WT (wild-type). (C) Sanger sequencing chromatograms of CrzR alleles: heterozygous (CrzRM/+). (C’) Sanger sequencing chromatograms of CrzR alleles: homozygous (CrzRM) mutants. (D) Developmental duration (egg to adult eclosion) in CrzR mutants compared to WT. Data: mean ± SD. ****p<0.0001 (Student’s t-test; n≥40/group). (E) Survival curves of adult CrzR mutants compared to WT. ***p<0.001 (Log-rank Mantel-Cox test; df = 1; n≥50/group).
-
Figure 3—figure supplement 2—source data 1
Source data for all graphs presented in Figure 3—figure supplement 2.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig3-figsupp2-data1-v1.xlsx
Spatial expression profiling of CrzR in the female N. lugens reproductive tract.
(A) CrzR genomic structure with primer design for experiments in panels B-C. (B) RT-PCR analysis of CrzR tissue distribution. Note weaker expression in central nervous system and fat body. Actin loading control is shown in top row. Tissue abbreviations: NS: central nervous system; FB: fat body; EP: Epidermis; DS: digestive system, FRO: female reproductive organs, MRO: male reproductive organs. Except for the reproductive system, the rest of the tissues come from a mixture of female and male. (C) Relative CrzR expression in female N. lugens tissues determined by RT-qPCR (abbreviations as in B). Expression was normalized to Actin and 18SrRNA and expressed relative to the mean value of the highest-expressing tissue (set to 1). Data are shown as mean ± s.e.m. Groups that share at least one letter are statistically indistinguishable. One-way ANOVA followed by Tukey’s multiple comparisons test. (D1-D2’) CrzR mRNA localization via fluorescent in situ hybridization (antisense probe): D1: There is no signal in lateral/common oviducts; D2/D2': Specific signal is detected in spermatheca (SP) and pouched gland (PG). (D3-D4’) Negative controls (sense probe) showing background-level signal. Scale bars: 100 μm.
-
Figure 4—source data 1
Original gel image used for Figure 4B.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig4-data1-v1.zip
-
Figure 4—source data 2
Uncropped gel image for Figure 4B, with the relevant bands indicated.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig4-data2-v1.zip
-
Figure 4—source data 3
Source data for all graphs presented in Figure 4.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig4-data3-v1.xlsx
Developmental and tissue-specific expression profiling of CrzR in N. lugens determined by qPCR.
(A) CrzR transcript levels across developmental stages. Relative expression levels were quantified by RT-qPCR, normalized to the reference gene Actin, expressed relative to the mean value of the highest-expressing tissue (set to 1). Data are shown as mean ± SEM shown. Groups that share at least one letter are statistically indistinguishable. One-way ANOVA followed by Tukey’s multiple comparisons test. (B) CrzR expression in distinct body regions. Relative expression levels were quantified by RT-qPCR, normalized to the reference gene Actin, expressed relative to the mean value of the highest-expressing tissue (set to 1). Data are shown as mean ± SEM shown. Groups that share at least one letter are statistically indistinguishable. One-way ANOVA followed by Tukey’s multiple comparisons test.
-
Figure 4—figure supplement 1—source data 1
Source data for all graphs presented in Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig4-figsupp1-data1-v1.xlsx
Corazonin (CRZ) regulates part of the post-mating response (PMR) in D. melanogaster.
(A) Schematic of experimental design. White segments on the time axis indicate light periods; black segments indicate dark periods. (B) Receptivity of virgin and mated Crz mutant (Crzattp) females. Graph displays the percentage of females copulating within 30 min. Small circles indicate the number of replicates, ≥6 insects/replicate; numbers below bars denote total number of animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (C) Graph shows eggs laid per female after mating. Numbers below bars denote total animals, ≥4 biological replicates, ≥8 insects/replicate. ****p<0.0001 (Student’s t-test). (D) Anti-CRZ immunostaining in brains of Crz mutant (Crzattp), control (Cs), and after Crz-RNAi. Note CRZ-expressing cells at arrows in control. Scale bar: 100 μm. (E) Receptivity of virgin and mated females after Crz-RNAi. Graph displays the percentage of females copulating within 30 min. Small circles indicate the number of replicates, ≥8 insects/replicate; numbers below bars denote total animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (F) Graph shows eggs laid per female after mating. Numbers below bars denote total animals, ≥4 biological replicates, ≥8 insects/replicate. ****p<0.0001 (Student’s t-test). (G) Receptivity of virgin females following CRZ peptide injection (monitored 6 h after injection). Graph displays the percentage of females copulating within 30 min. Small circles indicate the number of replicates, ≥9 insects/replicate; numbers below bars denote total animals. Statistical comparisons of proportions were performed using chi-square tests for contingency tables, p<0.05 was considered significant. (H) RT-PCR analysis of Crz tissue distribution. Note the lack of expression in the accessory gland. Actin loading control is shown in the top row. Tissue abbreviations: MAG, male accessory gland; Male–MAG, whole body without male accessory gland. (I) Anti-GFP and anti-CRZ immunostaining in brains of w-/y; Crz-Gal4/UAS-mCD8-GFP. Note no signal was detected in male accessory gland (MAG). Some GFP-stained signals were observed in the testes (indicated by white arrows), whereas no corresponding signals were detected via CRZ antibody staining. Scale bar: 50 μm.
-
Figure 5—source data 1
Original gel image used for Figure 5H.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig5-data1-v1.zip
-
Figure 5—source data 2
Uncropped gel image for Figure 5H, with the relevant bands indicated.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig5-data2-v1.zip
-
Figure 5—source data 3
Source data for all graphs presented in Figure 5.
- https://cdn.elifesciences.org/articles/109297/elife-109297-fig5-data3-v1.xlsx
Crz expression is undetectable in the Drosophila male accessory gland in Fly Cell Atlas single-cell datasets.
(A) Fly Cell Atlas male reproductive glands single-cell dataset. Left, schematic of male reproductive glands. Middle, two-dimensional embedding colored by annotated cell types, including male accessory gland (MAG) main and secondary cells. Right, feature plot showing expression of Crz (green scale) together with the AG marker sex peptide (SP) (red scale). Crz transcripts are not detected in MAG cell populations, whereas SP is robustly expressed. (B) Fly Cell Atlas male testis single-cell dataset. Left, schematic of testis. Middle, embedding colored by annotated testis cell types. Right, feature plot showing Crz (green), SP (red), and β2-tubulin (blue) expression, with β2-tubulin marking spermatogenic populations and Crz detected only in a small subset of cells. (C) Strip/dot plot summarizing normalized Crz expression across selected testis cell clusters, illustrating sparse Crz expression without broad enrichment in a major lineage. The y-axis signifies the expression level.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Nilaparvata lugens) | crz | GenBank | GenBank accession: AB817247.1 | |
| Gene (N. lugens) | crzr | GenBank | GenBank accession: AB817313.1 | |
| Strain, strain background (N. lugens) | Wild-type brown planthopper | Lab | Collected from Hangzhou, Zhejiang Province, China, in 1995; maintained on Taichung Native 1 (TN1) rice seedlings | |
| Genetic reagent (Drosophila melanogaster) | Canton-S | Bloomington Drosophila Stock Center | BDSC:64349 | Wild-type strain |
| Genetic reagent (D. melanogaster) | CrzattP | Bloomington Drosophila Stock Center | BDSC:84487 | FBst0084487 |
| Genetic reagent (D. melanogaster) | Crz-GAL4 | Bloomington Drosophila Stock Center | BDSC:51976 | FBst0051976 |
| Genetic reagent (D. melanogaster) | Crz-RNAi | Tsinghua Fly Center | THU:2139 | RNAi line targeting Crz; |
| Antibody | anti-CRZ (Rabbit polyclonal) | Gift from Prof. Jan A. Veenstra | IF(1:1000); used for immunostaining | |
| Antibody | anti-Bruchpilot / nc82 (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# nc82; RRID:AB_2314866 | IF(1:1000) |
| Antibody | donkey anti-rabbit IgG conjugated to Alexa 488 | Thermo Fisher Scientific | Cat#R37118 | IF(1:500) |
| Antibody | donkey anti-mouse IgG conjugated to Alexa 555 | Thermo Fisher Scientific | Cat#R37115 | IF(1:500) |
| Antibody | anti-DIG conjugated fluorescent antibody | Jackson | Cat#200-542-156 | IF(1:100) |
| Peptide, recombinant protein | Corazonin (CRZ) | GenScript | Sequence: pQTFQYSRGWNamide | |
| Peptide, recombinant protein | Scrambled CRZ peptide | GenScript | Sequence: pQSRYTTFGQWTNamide | |
| Peptide, recombinant protein | TrueCut Cas9 Protein v2 | Thermo Fisher Scientific | Cat#A36497 | Used for CRISPR/Cas9 mutagenesis in N. lugens embryos |
| Sequence-based reagent | dsRNA for NlCrz | GenScript | F: TAATACGACTCACTATAGGGGCTAGTGTTGCAATGCTGTTG R: TAATACGACTCACTATAGGGGCTGTTGAGCGTTAGACTGT | |
| Sequence-based reagent | dsRNA for NlCrzR | GenScript | F: TAATACGACTCACTATAGGGCGCCGTCTACACACTCATCT R: TAATACGACTCACTATAGGGCTACCAGCTTCGTACAGCGT | |
| Sequence-based reagent | sgRNA1 for NlCrz | GenScript | F: TAATACGACTCACTATAGGCACAGGAGTGATGCAGAC R: TTCTAGCTCTAAAACGTCTGCATCACTCCTGTGCC | |
| Sequence-based reagent | sgRNA2 for NlCrz | GenScript | F: TAATACGACTCACTATAGCTACTAGTGCTGGGCTGCA R: TTCTAGCTCTAAAACTGCAGCCCAGCACTAGTAGC | |
| Sequence-based reagent | sgRNA1 for NlCrzR | GenScript | F: TAATACGACTCACTATAGGCACGCACTCGAGCTGCCT R: TTCTAGCTCTAAAACAGGCAGCTCGAGTGCGTGCC | |
| Commercial assay or kit | TRIzol reagent | Invitrogen | CAT#15596026 | Total RNA extraction |
| Commercial assay or kit | M-MLV reverse transcription kit | Biotech | CAT#B639277 | cDNA synthesis for cloning/RT-PCR |
| Commercial assay or kit | HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit | Vazyme | CAT#R223-01 | First-strand cDNA synthesis |
| Commercial assay or kit | UltraSYBR Mixture (with ROX) Kit | CWBIO | CAT#CW0957M | Real-time qPCR |
| Commercial assay or kit | MEGAscript T7 transcription kit | Ambion | CAT#AM1333 | dsRNA synthesis |
| Commercial assay or kit | GeneArt Precision gRNA Synthesis Kit | Thermo Fisher Scientific | CAT#29377 | sgRNA synthesis |
| Commercial assay or kit | Pre-hybridization solution | Boster | Cat#AR0152 | Used for FISH |
| Commercial assay or kit | DIG RNA Labeling Kit (SP6/T7) | Roche | Cat#11175025910 | Synthesis of in situ hybridization probes |
| Software, algorithm | Fiji | ImageJ | RRID:SCR_002285 | Image processing |
| Software, algorithm | GraphPad Prism 9 | GraphPad | RRID:SCR_002798 | Statistical analysis and graphing |
| Software, algorithm | Adobe Illustrator | Adobe | RRID:SCR_010279 | Figure preparation |
| Software, algorithm | ZEN | Zeiss | RRID:SCR_013672 | Confocal image acquisition |
| Software, algorithm | Motic Images Plus 3.0 | Motic | Microscopy image acquisition/processing |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/109297/elife-109297-mdarchecklist1-v1.docx
-
Supplementary file 1
Primers used in this study.
- https://cdn.elifesciences.org/articles/109297/elife-109297-supp1-v1.docx