Impacts of DNA methylation on H2A.Z deposition and nucleosome stability

  1. Rochelle M Shih
  2. Yasuhiro Arimura
  3. Hide A Konishi
  4. Hironori Funabiki  Is a corresponding author
  1. Laboratory of Chromosome and Cell Biology, The Rockefeller University, United States
  2. Basic Sciences Division, Fred Hutchinson Cancer Center, United States
8 figures, 3 tables and 6 additional files

Figures

Figure 1 with 2 supplements
Cryo-EM structures of methylated and unmethylated Sat2R-P human H2A.Z nucleosomes.

(A) Diagram of the palindromic 152-bp Sat2R-P sequence. CpGs are underlined. Triangle denotes midpoint. Atomic models of unmethylated (B) and methylated (C) Sat2R-P H2A.Z structures (the v1 model for both). Two face views (DF1 and DF2) and a side view (middle) are shown. (D) Left, overlay of unmethylated (UM) and methylated (Me) Sat2R-P DNA EM densities. Middle and right, overlays of DNA densities on top of the corresponding v1 DNA atomic models for either the unmethylated (middle) or methylated (right) structures. Arrows point to the visualizable end of the DF2 linker DNA for each structure. (E) Root mean squared distance (RMSD) analysis comparing differences between unmethylated and methylated v1 Sat2R-P H2A.Z atomic models.

Figure 1—figure supplement 1
Workflow of Sat2R-P cryo-EM analysis.

(A) Native PAGE analysis of H2A.Z nucleosomes used for cryo-EM analysis. Bands visualized through SYBR Safe staining. (B) Native PAGE analysis of Sat2R-P DNA after digestion with BstBI to check for methylation status. (C) Diagram of structure analysis pipeline for either unmethylated (left) or methylated (right) H2A.Z SAT2R-P samples. Further details described in methods.

Figure 1—figure supplement 2
DNA atomic model generation for Sat2R-P H2A.Z nucleosome structures.

Overlays of electron density maps for the DNA with both generated atomic models for either the unmethylated (A) or methylated (C) Sat2R-P H2A.Z nucleosome structure. Zoom-in of dyad regions showing fitting of both DNA atomic models (v1 and v2) generated for either the unmethylated (B) or methylated (D) structure. Methylated cytosines are highlighted in green. Top panels are overlays of both models for the two structures. Positioning was determined by assessing densities around bases which retain purine/pyrimidine identity in both models vs those that switch. Bases that switched from purine to pyrimidine, and vice versa, showed more ambiguous densities than those that retained identity. Positioning was determined using the unmethylated structure and then used in modeling the methylated structure. (E) Comparison of predicted CpG positioning for the v1 (top) and v2 (bottom) atomic models generated for the methylated structure.

Figure 2 with 4 supplements
DNA methylation reduces H3–DNA contacts, alters H4 N-terminal tail orientations, and forms open nucleosome structures.

(A) Density maps of unmethylated (UM) and methylated (Me) Sat2R-P H2A.Z nucleosomes filtered and resampled to ~3 Å. The face shown, and all following zoom-ins, is of DF2. Maps are overlaid onto each other. Boxed regions highlight major areas of difference shown in B–D. (B) Zoom-in of the H3 N-terminus on DF2 of both structures. Density maps are shown as a transparent overlay on top of the corresponding v1 atomic models. (C) Zoom-in of the DF2 acidic patch on both structures. Area corresponding to the extra density found in the Me structure labeled in red. (D) Zoom-in of the H4 N-terminal tail. Dotted lines show each structure’s preferred orientation. (E) 3D Models used in the in silico mixing 3D classification analysis. Classes are as follows: (1 and 2) closed nucleosome structures with varying linker lengths; (3 and 6) open nucleosomes with highly flexible linkers; (4) open nucleosomes that have shifted position from center; (5) hexasomes. Both distal faces (DF1 and DF2) are shown of each model. (F) Results of classification analysis. Y-axis is the proportion of particles sorted into each class as a percent of the total input particles from each sample (UM or Me). Error bars represent SEM, n = 3 technical replicates.

Figure 2—figure supplement 1
Workflow of in silico mixing 3D classification analysis.

Particles from a merged batch of unmethylated and methylated Sat2R-P H2A.Z nucleosome micrographs were picked and fed through the standard analysis pipeline. Six 3D models were then generated representing various open, closed, or hexasome-containing states of the nucleosome. Merged particles were then sorted to each of the classes through CryoSPARC’s heterorefinement tool (n = 3 technical replicates).

Figure 2—figure supplement 2
Local resolution estimates for unmethylated and methylated Sat2R-P H2A.Z structures.

Left, local resolution estimates of DF1 for both unmethylated (top) and methylated (bottom) Sat2R-P density maps. Right, side view showing local resolution of the DNA backbone for both methylated and unmethylated density maps. Local resolution maps were generated in CryoSPARC using the local resolution estimation tool and overlaid on density maps filtered using CryoSPARC’s local filtering tool.

Figure 2—figure supplement 3
Cryo-EM structures of 601L H2A.Z nucleosomes show no DNA methylation-dependent differences.

(A) Diagram of the 205 bp palindromic 601L sequence. Triangle indicates sequence midpoint. CpGs are underlined. Final density maps of unmethylated (B) or methylated (C) H2A.Z nucleosomes. (D, E) Atomic models generated for (B, C). Methylated cytosines shown in green. (F) Root mean squared distance (RMSD) analysis comparing differences between methylated and unmethylated 601L H2A.Z atomic models.

Figure 2—figure supplement 4
Workflow of 601L H2A.Z nucleosome cryo-EM structures.

(A) Native PAGE analysis of 601L H2A.Z nucleosome samples used for cryo-EM. Bands visualized through SYBR Safe staining. (B) Native PAGE analysis of 601L DNA after digestion with HpaII to check for methylation status. (C) Diagram showing analysis pipeline for solving 601L nucleosome structures. Further details described in methods.

Figure 3 with 2 supplements
DNA methylation increases H2A.Z nucleosome accessibility.

(A) Diagram of the 152 bp 1HinfI_Sat2R DNA sequence used. CpG sites underlined and sequence midpoint indicated by the triangle. HinfI recognition site highlighted in magenta. A Cy5 fluorophore is attached to the 5′ end nearest the HinfI site. (B) Schematic of 1HinfI_Sat2R H2A.Z nucleosome with HinfI recognition site demarcated in magenta and H2A.Z in yellow. (C) Native gel showing HinfI digestion time course of UM and Me human H2A and H2A.Z nucleosomes. SYBR Safe was used to stain total DNA. Digestion efficiency was assessed via loss of Cy5 signal and a downward shift in the total DNA band. (D) Quantification of (C). Cy5 signals were normalized to total SYBR Safe signal for each sample. Error bars represent SEM. Each shape represents data from one independent experiment, n = 5 experiments. Statistics comparing unmethylated and methylated samples at indicated timepoints were completed with a two-tailed t-test assuming unequal variance with p-values listed above each comparison.

Figure 3—figure supplement 1
Native PAGE and mass photometry analysis of nucleosomes used in HinfI digest assays.

(A) Native PAGE analysis of nucleosome samples. Bands visualized through SYBR Safe staining. Mass photometry analysis of methylated or unmethylated H2A (B) or H2A.Z (C) nucleosomes. Peaks around 200–220 kDa represent the fully formed nucleosome population. (D) BstBI digestion of 1HinfI_Sat2R DNA to verify methylation status. (E) HinfI digest time course of bare unmethylated or methylated DNA.

Figure 3—figure supplement 2
Replicate gels of data from Figure 3.
Figure 4 with 4 supplements
Presence or absence of DNA methylation influences H2A.Z deposition.

(A) Percentage of methylated CpG sites (≥5x coverage) associated with H2A.Z peaks or H3 reads in sperm pronuclei incubated in interphase egg extract or XTC-2 nuclei following CnT-BS library preparation. H3 data is taken from regions outside of H2A.Z enriched peaks. Data points represent biological replicates (n = 2). (B) Schematic of chromatinization assay. Magnetic beads coated with DNA of interest were incubated in Xenopus egg extract with the addition of CaCl2 to induce cycling into interphase. After 60 min, DNA beads were isolated to assess for histone composition. Western blot results of chromatinization assay probing for either H2A.Z (C) or H2A.X-F (E). Ku70 and H4 signals are shown as loading controls. Beads coated with unmethylated (UM) or methylated (Me) 19-mer arrays of Widom 601 (19x601) or 16-mer arrays of HSat2 (16xHSat2) were used. A representative blot of technical triplicates for each condition is presented. (D, F) Quantification of (C, E). H2A.Z and H2A.X-F signals were normalized to H4 intensity. Error bars represent SEM. Data points represent technical triplicates across 3 biological replicates with each shape representing data from a single independent experiment (n = 9).

Figure 4—figure supplement 1
Reproducibility comparison of CnT-BS samples.

(A) Pearson correlation plot comparing fragment counts mapped to 1000 bp genomic bins across samples. Bins containing zero fragments were first filtered out. Fragment counts were then normalized using DESeq2 to account for sequencing depth differences and underwent a variance stabilizing transformation (VST) before the correlation matrix was generated. (B) Pearson correlation plot comparing CpG methylation across samples. Percent methylation at individual CpG sites was calculated for high coverage CpGs (≥10 reads) and normalized using methylKit. The correlation matrix was then generated using pairwise observations across all eight samples. Both correlation matrices were ordered, and rectangles drawn (n = 4, user-specified), via hierarchical clustering.

Figure 4—figure supplement 2
H2A.Z localizes to hypomethylated transcription start sites (TSSs).

(A) Genomic annotation plots for the top quantile of 1000 bp genomic bins containing the most mapped reads averaged between replicates for each specified condition. Heatmaps of either H3 CpG methylation calls averaged over 500 bp tiles (left-most panel) or H2A.Z reads (right panels) from two biological replicates across a representation of all annotated Xenopus laevis genes from either sperm (B) or XTC-2 (C) samples. Corresponding H3 and H2A.Z data are shown on the same sets of genes sorted in the same order. (D) IGV snapshot of a region on chromosome 1L showcasing preferential H2A.Z deposition at hypomethylated TSSs. Average H3 methylation tracks were generated across 500 bp tiles for visualization purposes on a scale of 0–100% CpG methylation. Gray indicates regions with no methylation data availability. Two biological replicates of H2A.Z and H3 tracks are shown.

Figure 4—figure supplement 3
DNA methylation check and replicates of data from Figure 4.

(A) BstUI digestion of 19x601 DNA substrates to verify methylation status. Both 19x601 and 16xHSat2 DNA were methylated under identical conditions; however, the HSat2 sequence lacks appropriate cut sites for methylation-sensitive restriction enzymes. The 601 substrates were used to determine complete methylation status for each batch. (B) Replicate blots for data shown in Figure 4.

Figure 4—figure supplement 3—source data 1

Labeled original gel and western blot images.

https://cdn.elifesciences.org/articles/109762/elife-109762-fig4-figsupp3-data1-v1.zip
Figure 4—figure supplement 3—source data 2

Raw gel and western blot images.

https://cdn.elifesciences.org/articles/109762/elife-109762-fig4-figsupp3-data2-v1.zip
Figure 4—figure supplement 4
Both H2A.Z variants preferentially associate with unmethylated DNA substrates.

(A) Expression check of exogenously added mRNA expression for ALFA-tagged versions of both H2A.Z.1 and H2A.Z.2. Blots of DNA beads incubated with interphase extract expressing either ALFA-tagged H2A.Z.1 (B) and H2A.Z.2 (C). Presence of the specified H2A.Z variant on DNA beads was determined by blotting against the ALFA-tag with H4 shown as a loading control. (D) Quantification of (B, C). ALFA signals were normalized to H4 signals. Unique shapes denote results from three independent experiments (n = 3 biological replicates). Error bars represent SEM. (E) Additional replicate blots of data from (D).

Figure 5 with 4 supplements
The SRCAP complex mediates H2A.Z’s preferential association with unmethylated DNA.

(A) Western blot to detect SRCAP in control IgG-depleted Xenopus egg extract (∆IgG) or SRCAP-depleted extract (∆SRCAP). Bottom panel shows ponceau staining as a loading control. (B) Western blots of chromatinization assay in IgG control vs SRCAP-depleted egg extract. Magnetic beads coated with 19-mer arrays of Widom 601 (19x601) or 16-mer arrays of HSat2 (16xHSat2) were incubated with interphase egg extract for 60 min before their isolation. (C) Quantification of H2A.Z signal normalized to H4 from (B). (D) Quantification of H2A.X-F signal normalized to H4 from (B). Error bars in (C) and (D) represent SEM from n = 3 biological replicates, and each shape represents data from one independent experiment. (E) Western blot staining for SRCAP on 16xHSat2 DNA beads incubated in interphase egg extract. (F) Western blot staining for ZNHIT1 on specified DNA beads incubated in interphase egg extract. Representative image shown from two independent experiments.

Figure 5—figure supplement 1
SRCAP depletion efficiency and replicates of data from Figure 5.

(A) Quantification of SRCAP WB signal from egg extract after depletion with anti-IgG or anti-SRCAP antibody beads. Replicates from three independent experiments shown. Error bars represent SEM. (B) Replicate blots of data plotted in (A). (C) Replicate blots of Figure 5B–D. (D) Replicate blots of Figure 5E, F with Ku70 as a loading control.

Figure 5—figure supplement 2
Chromatinization assay with SRCAP depletion using a commercial antibody.

Western blots probing for H2A.Z (A) or H2A.X-F (C) signal along with respective loading controls bound to DNA beads incubated in interphase egg extract after SRCAP depletion using a commercial antibody raised against human SRCAP (Kerafast, Cat#: ESL103). (B, D) Quantification of (A, C). Results from three independent experiments plotted. Error bars represent SEM. (E) Replicate western blots.

Figure 5—figure supplement 3
TIP60-C does not display DNA methylation sensitivity.

Western blots of DNA bead pulldowns from interphase egg extract probing for endogenous p400 (ATPase for Tip60-C) along with respective loading controls.

Figure 5—figure supplement 4
SRCAP-C maintains unmethylated DNA binding bias in the absence of nucleosome loading.

(A) Western blot showing UBN2 depletion efficiency. (B) Western blot of SRCAP on DNA beads incubated in UBN2-depleted extract. Two replicates shown and total protein via ponceau staining used to assess loading. (C) Western blot of DNA beads incubated in IgG control- and UBN2-depleted extract. ZNHIT1, subunit of SRCAP-C, displays preference for unmethylated DNA across conditions. DNA binding proteins Dppa2 and xKID did not show any differences in chromatin accessibility between DNA methylation status. H3 shown to verify decreased nucleosome loading upon UBN2 depletion. Total protein via ponceau staining used to assess loading. One replicate of ∆IgG and two replicates of ∆UBN2 conditions shown.

Schematic models for how DNA methylation influences physical nucleosome structure and SRCAP-mediated H2A.Z loading.

(A) DNA methylation has little effect on nucleosome openness/accessibility of H2A nucleosomes. H2A.Z nucleosomes are more open/accessible than H2A nucleosomes, and DNA methylation DNA slightly opens H2A.Z nucleosome further causing nucleosomal DNA ends to be more accessible. (B) SRCAP-C is capable of binding to unmethylated DNA and replacing H2A with H2A.Z on the nucleosome. SRCAP-C cannot bind to methylated DNA, and thus H2A.Z deposition is suppressed on methylated DNA. An SRCAP-independent mechanism (possibly via TIP60) deposits H2A.Z in a DNA methylation insensitive manner.

Author response image 1
Verification of SRCAP depletion using DNA beads.

DNA beads were incubated in interphase-cycled Xenopus egg extract that had been depleted with either our custom SRCAP antibody or an IgG negative control. SRCAP and ZNHIT1 association was then assessed via Western Blot.

Author response image 2
Verification of 16xHSat2 methylation status via ZHX2/3 protein binding.

16xHSat2 DNA beads were incubated in Xenopus egg extract and endogenous ZHX2/3 protein binding assessed via Western Blot with a custom generated antibody that recognizes both ZHX2 and ZHX3.

Tables

Table 1
DNA sequences/oligos used in the study.
Sequence nameSequenceVectorPlasmid nameInsert locationSourceAssay(s) used inAdditional notes
Sat2R-PATCATCAGATTCCATTCGAATCCATTCGAAAA
TGATTACATTCGAATCCATTCGAAGATTCCAT
TTGAGCCTGCTCGAGCAGGCTCAAATGGAA
TCTTCGAATGGATTCGAATGTAATCATTTTCG
AATGGATTCGAATGGAATCTGATGAT
pUC18RMSp81Between XbaI and BamHI sitesGenerated and purchased from
Integrated DNA Technologies (IDT)
Cryo-EMModified from the
Sat2R sequence in Osakabe et al., 2015.
601LATCACAATCCCGGTGCCGAGGCCGCTCAAT
TGGTCGTAGACAGCTCTAGCACCGCTTAAA
CGCACGTACGGAATCCGTACGTGCGTTTAA
GCGGTGCTAGAGCTGTCTACGACCAATTGA
GCGGCCTCGGCACCGGGATTGTGAT
pUC57601L-145-8XEcoRV(601L-145-8X) was a gift from Curt Davey
(Addgene plasmid # 158572;
http://n2t.net/addgene:158572;
RRID:Addgene_158572)
Cryo-EM
1HinfI_Sat2RATCATCGTTCCATTCGTGACTCCATTCGAAA
ATGATTACATTCGTATCCATTCGAAGTTTCCA
TTTGAGCCTGTTCGAAAATTCCATTTGTGTCC
AACCAATGTTTCCATTCATTTCCATTCAATGTT
TCCATTCGTATCCATTTGGATGAT
pUC18RMSp161Between XbaI and BamHI sitesGenerated and purchased from
Integrated DNA Technologies (IDT)
Restriction Digest AssayDNA generated
via PCR amplification using the following primers:
/5Cy5/ATCATCGTTCCATTCGTGAC;
ATCATCCAAATGGATACGAATGG
HSat2 arrays (1 repeat shown)CGTTTGATTCCATTTGATGTTGATTCCATTCGA
GTCCATTCGATGATAATTCCATTCGATTCTTT
GCGATGATTCCATTCCTTTCCATTTGAGATGA
TTCCATTCGAGACCATTCGATGATTGCATTCA
ATTCATTCGATGACGATTATTCAATTCCGTTC
AATGATTCCATTCGATTCCAATTGATGATGATT
CCATTCGATTCCATTTGATGATGATTCCATGC
GATTCCATTCGATGATGACTCCGATATCGGA
TCTGATATC
pUC18RMSp64Between XbaI and BamHI sitesGenerated and purchased from
Integrated DNA Technologies (IDT)
Chromatinization AssaysGenBank: X06199.1
601 arrays (1 repeat shown)CTGGAGAATCCCGGTGCCGAGGCCGCTCA
ATTGGTCGTAGCAAGCTCTAGCACCGCTTAA
ACGCACGTACGCGCTGTCCCCCGCGTTTTA
ACCGCCAAGGGGATTACTCCCTAGTCTCCA
GGCACGTGTCAGATATATACATCCTGTGCAT
GTATTGAACAGCGACTCGGGTTATGTGATGG
ACCCTATACGCGGCCGCC
pUC18pAS696EcoRI/XbaIGift from Aaron StraightChromatinization Assays
Oligos for sequencing library preparation
Sequence nameSequenceSourceAssay(s) used inAdditional notes
Tn5mC-Apt1T/iMe-dC/GT/iMe-dC/GG/iMe-dC/AG/iMe-dC/GT/iMe-dC/AGATGTGTATAAGAGA/iMe-dC/AGLi et al., 2021; generated and purchased from
Integrated DNA Technologies (IDT)
CnT-BS adapter oligoAnnealed with Tn5mC1.1-A1block
to form adapter oligo
Tn5mC1.1-A1block/5Phos/CTGTCTCTTATACA/3ddC/Li et al., 2021; generated and purchased from
Integrated DNA Technologies (IDT)
CnT-BS adapter oligoAnnealed with Tn5mC-Apt1
to form adapter oligo
Tn5mC-ReplO1/5Phos//iMe-dC/TGT/iMe-dC/T/iMe-dC/TTATA/iMe-dC/A/iMe-dC/AT/iMe-dC/T/iMe-dC//iMe-dC/GAG/iMe-dC//iMe-dC//iMe-dC/A/iMe-dC/GAGA/iMe-dC//3InvdT/Li et al., 2021; generated and purchased from
Integrated DNA Technologies (IDT)
CnT-BSUsed during oligonucleotide
replacement step
Table 2
Antibodies used in this study.
AntigenHostCompanyCatalog No.Peptide used for generationDilutionAssay(s) used in
Xl H2A.ZRabbitCustomCIHKSLIGKKGQQKTV2 µg/mlWestern blots
H2A.ZRabbitActive MotifCat# 390131:10CnT-BS
H3MouseCosmo Bio USAMABI0001-100-EX1:100CnT-BS
H4MouseActive MotifCat# 615211:1000Western blots
Xl H2A.X-FRabbitCustom, gift from David ShechterShechter et al., 20091:1000 (of serum)Western blots
Xl Ku70RabbitCustomPostow et al., 20082 µg/mlWestern blots
Xl SRCAPRabbitCustomCPNSPSSHRVRKAKT0.8 µg per 1 µl of beads (depletions); 12 µg/ml (WB)Depletions; western blots
hsSRCAPRabbitKerafastESL1030.8 µg per 1 µl of beads (depletions); 1:500 (WB)Depletions; western blots
ZNHIT1RabbitProteintech16595-1-AP1:1000Western blots
P400RabbitBethylA300-541A1:1000Western blots
ALFA tagAlpaca (single domain antibody purified from E. coli)NanoTag BiotechnologiesN1502-Li800-L1:1000Western blots
Xl UBN2RabbitCustomCGGQNKGDAKLPRKNR1.5 µg per 1 µl of beads (depletions); 2 µg/ml (WB)Depletions; western blots
xKIDRabbitCustomFunabiki and Murray, 20001 µg/mlWestern blots
Xl Dppa2RabbitCustomXue et al., 20135 µg/mlWestern blots
Secondaries
IRDye 800CW anti-Rabbit IgGGoatLICORbio926-322111:10,000Western blots
IRDye 680RD anti-Mouse IgGGoatLICORbio926-680701:10,000Western blots
anti-Rabbit IgGGuinea Pighttps://www.antibodies-online.com/ABIN1019611:100CnT-BS
anti-Mouse IgGRabbitabcamab465401:100CnT-BS
Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Transfected construct (X. laevis)H2A.Z.1.lGenBankBC044011.1
Transfected construct (X. laevis)H2A.Z.2.sNCBINM_001092643.1
Strain, strain background (X. laevis, male)XLa.J-StrainNXRNational Xenopus ResourceRRID:NXR_0024
Strain, strain background (X. laevis, male and female)Xenopus laevisXenopus 1
Cell line (X. laevis)XTC-2 (Xenopus laevis fibroblast line)Gift from David ShechterRRID:CVCL_5610
AntibodyAnti-Xenopus laevis H2A.Z (Rabbit polyclonal)This paperUsed at 2 µg/ml. Generated using the following peptide sequence: CIHKSLIGKKGQQKTV
AntibodyAnti-H2A.Z (Rabbit polyclonal)Active MotifCat# 39013; RRID:AB_26150811:10
AntibodyAnti-H3 (Mouse monoclonal)Cosmo Bio USAMABI0001-100-EX; RRID:AB_107092431:100
AntibodyAnti-H4 (Mouse monoclonal)Active MotifCat# 61521; RRID:AB_27936671:1000
AntibodyAnti-Xenopus laevis H2A.X-F (Rabbit polyclonal)Gift from David Shechter (Shechter et al., 2009)1:1000 (of serum)
AntibodyAnti-Xenopus laevis Ku70 (Rabbit polyclonal)Postow et al., 20082 µg/ml
AntibodyAnti-Xenopus laevis SRCAP (Rabbit polyclonal)This paper0.8 µg per 1 µl of beads (depletions); 12 µg/ml (WB)
AntibodyAnti-human SRCAP (Rabbit polyclonal)KerafastESL103; RRID:AB_30867430.8 µg per 1 µl of beads (depletions); 1:500 (WB)
AntibodyAnti-ZNHIT1 (Rabbit polyclonal)Proteintech16595-1-AP; RRID:AB_22203821:1000
AntibodyAnti-p400 (Rabbit polyclonal)BethylA300-541A; RRID:AB_20982081:1000
AntibodyAnti-ALFA tag (Alpaca single domain antibody purified from E. coli)NanoTag BiotechnologiesN1502-Li800-L; RRID:AB_30759851:1000
AntibodyAnti-xlUBN2 (Rabbit polyclonal)This paper1.5 µg per 1 µl of beads (depletions); 2 µg/ml (WB). Generated using the following peptide sequence: CGGQNKGDAKLPRKNR
AntibodyAnti-xKID (Rabbit polyclonal)Funabiki and Murray, 20001 µg/ml
AntibodyAnti-xIDppa2 (Rabbit polyclonal)Xue et al., 20135 µg/ml
AntibodyIRDye 800CW anti-Rabbit IgG (Goat polyclonal)LICORbio926-32211; RRID:AB_6218431:10,000
AntibodyIRDye 680RD anti-Mouse IgG (Goat polyclonal)LICORbio926-68070; RRID:AB_109565881:10,000
Antibodyanti-Rabbit IgG (Guinea Pig polyclonal)https://www.antibodies-online.com/ABIN101961; RRID:AB_107755891:100
Antibodyanti-Mouse IgG (Rabbit polyclonal)abcamab46540; RRID:AB_26148251:100
Recombinant DNA reagentHSat2 arrayThis paper. Base sequence taken from GenBank: X06199.1RMSp64
Recombinant DNA reagent601 arrayA gift from Aaron Straight (Guse et al., 2011)pAS696
Sequence-based reagentSat2R-PThis paper. Modified from the Sat2R sequence in Osakabe et al., 2015RMSp81ATCATCAGAT
TCCATTCGA
ATCCATTCGA
AAATGATTAC
ATTCGAATCC
ATTCGAAGATT
CCATTTGAGCC
TGCTCGAGCA
GGCTCAAATGG
AATCTTCGAAT
GGATTCGAATG
TAATCATTTT
CGAATGGATTCG
AATGGAATCTGA
TGAT
Sequence-based reagent601LA gift from Curt Davey (Addgene)RRID:Addgene_158572
Sequence-based reagent1HinfI_sat2RThis paperRMSp161ATCATCGTTCCAT
TCGTGACTCCAT
TCGAAAATGATTA
CATTCGTATCCAT
TCGAAGTTTCCAT
TTGAGCCTGTTCG
AAAATTCCATTTGT
GTCCAACCAATGT
TTCCATTCATTTCC
ATTCAATGTTTCCA
TTCGTATCCATTTG
GATGAT
Sequence-based reagentTn5mC-Apt1Li et al., 2021CnT-BS adapter oligoT/iMe-dC/GT/iMe-dC/GG/iMe-dC/AG/iMe-dC/GT/iMe-dC/AGATGTGTATAAGAGA/iMe-dC/AG
Sequence-based reagentTn5mC1.1-A1blockLi et al., 2021CnT-BS adapter oligo/5Phos/CTGTCTCTTATACA/3ddC/
Sequence-based reagentLi et al., 2021CnT-BS replacement oligo/5Phos//iMe-dC/TGT/iMe-dC/T/iMe-dC/TTATA/iMe-dC/A/iMe-dC/AT/iMe-dC/T/iMe-dC//iMe-dC/GAG/iMe-dC//iMe-dC//iMe-dC/A/iMe-dC/GAGA/iMe-dC//3InvdT/
Peptide, recombinant proteinpG-Tn5Soroczynski et al., 2024RRID:Addgene_198468
Peptide, recombinant proteinM.SssI CpG methyltransferaseNew England BiolabsCat# M0226
Peptide, recombinant proteinHinfINew England BiolabsCat# R0155
Peptide, recombinant proteinAmpligaseLucigen (Biosearch Technologies)A0102K
Peptide, recombinant proteinT4 DNA polymeraseThermo ScientificEP0061
Peptide, recombinant proteinNEBNext Q5U Master MixNew England BiolabsCat# M0597
Peptide, recombinant proteinKlenow Fragment (3′ → 5′ exo-)New England BiolabsCat# M0212
Peptide, recombinant proteinQ5 DNA polymeraseNew England BiolabsCat# M0491
Peptide, recombinant proteinhsH2AThis paper. Plasmids gifts from Shixin LiuGenBank: AY131971.1
Peptide, recombinant proteinhsH2A.ZThis paper. Plasmids gifts from Shixin LiuGenBank: M37583.1
Peptide, recombinant proteinhsH2BThis paper. Plasmids gifts from Shixin LiuGenBank: AF531285.1
Peptide, recombinant proteinhsH3.2This paper. Plasmids gifts from Shixin LiuGenBank: AF531307.1
Peptide, recombinant proteinhsH4This paper. Plasmids gifts from Shixin LiuGenBank: M60749.1
Commercial assay or kitNuclei EZ Prep kitMilliporeCat# NUC101-1KT
Commercial assay or kitEZ DNA Methylation-Lightning kitZymo ResearchCat# D5030
Commercial assay or kitMEGAscript SP6 transcription kitInvitrogenCat# AM1330
Commercial assay or kitM-280 Streptavidin DynabeadsInvitrogenCat# 11206D
Commercial assay or kitProtein A DynabeadsInvitrogenCat# 10008D
Commercial assay or kitCleanCap Reagent AGTriLinkCat# N-7113
Commercial assay or kitMinElute PCR Purification kitQIAGENCat# 28004
Chemical compound, drugBiotin-14-dATPJena BioscienceCat# NU-835-BIO14-S
Software, algorithmRelion v4Scheres, 2012RRID:SCR_01627
Software, algorithmCryoSPARC v4.6Structura Biotechnology IncRRID:SCR_016501
Software, algorithmTopaz v0.2Bepler et al., 2019
Software, algorithmPhenix v1.21Liebschner et al., 2019RRID:SCR_014224
Software, algorithmCoot 0.9.8.7Emsley et al., 2010RRID:SCR_014222
Software, algorithmPyMOL v2.5.7SchrödingerRRID:SCR_000305
Software, algorithmFastp v0.24.0Chen, 2023RRID:SCR_016962
Software, algorithmBismark v0.24.2Krueger and Andrews, 2011RRID:SCR_005604
Software, algorithmDESeq2 v1.42.1Love et al., 2014RRID:SCR_015687
Software, algorithmSEACR v1.3Meers et al., 2019RRID:SCR_027011
Software, algorithmmethylKit v1.28.0Akalin et al., 2012RRID:SCR_005177
Software, algorithmChIPseeker v1.38.0Yu et al., 2015RRID:SCR_021322
Software, algorithmdeepTools v3.5.5Ramírez et al., 2016RRID:SCR_016366

Additional files

Supplementary file 1

Collection and model statistics for the cryo-EM structures.

https://cdn.elifesciences.org/articles/109762/elife-109762-supp1-v1.docx
Supplementary file 2

Alignment statistics of CnT-BS sequencing libraries.

XTC reads were downsampled to 30 million reads to match sperm samples, then all raw reads were trimmed and deduplicated using fastp v0.24.0 and aligned to the Xenopus laevis genome (Xenla 10.1) or lambda genome (to assess for bisulfite conversion efficiency) using Bismark v0.24.2. Methylated CpG percentages for H2A.Z samples were determined for the top 2.5% of H2A.Z peaks by AUC (obtained using SEACR v1.3) while methylated percentages for H3 associated CpGs were conducted on regions outside of determined H2A.Z peaks. All CpGs met a cutoff of at least five reads to be counted. Methylated lambda CpG statistics were calculated from all mapped CpGs with no filtering.

https://cdn.elifesciences.org/articles/109762/elife-109762-supp2-v1.docx
Supplementary file 3

Fragment statistics of filtered genomic bins used for sequencing analysis.

A count matrix was generated from processed bam files over 1000 bp bins of the Xenopus laevis genome. Mitochondrial reads and bins containing fewer than 17 reads across less than 2samples were removed to filter out low signal areas. Replicates for each sample were averaged, and the resulting count matrix was used for genomic annotation analysis.

https://cdn.elifesciences.org/articles/109762/elife-109762-supp3-v1.docx
Supplementary file 4

Mass spectrometry validation data of generated custom anti-H2A.Z antibody.

https://cdn.elifesciences.org/articles/109762/elife-109762-supp4-v1.xlsx
Supplementary file 5

Mass spectrometry validation data of generated custom anti-SRCAP antibody.

https://cdn.elifesciences.org/articles/109762/elife-109762-supp5-v1.xlsx
MDAR checklist
https://cdn.elifesciences.org/articles/109762/elife-109762-mdarchecklist1-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Rochelle M Shih
  2. Yasuhiro Arimura
  3. Hide A Konishi
  4. Hironori Funabiki
(2026)
Impacts of DNA methylation on H2A.Z deposition and nucleosome stability
eLife 15:RP109762.
https://doi.org/10.7554/eLife.109762.3