The transcription factor BCL11A restores differentiation potential to aged oligodendrocyte progenitor cells
- Altos Labs-Cambridge Institute of Science, United Kingdom
- Wellcome-MRC Cambridge Stem Cell Institute, University of Cambridge, United Kingdom
- Department of Clinical Neurosciences, University of Cambridge, United Kingdom
- John Van Geest Centre for Brain Repair, University of Cambridge, United Kingdom
- European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Genome Campus, United Kingdom
Figures
Figure 1 with 3 supplements
Dynamic regulation of genes during oligodendrocyte lineage progression.
(A) Schematic diagram showing magnetic-activated cell sorting (MACS)-based isolation of oligodendrocyte progenitor cells (OPCs), pre-oligodendrocytes (PreOLs), and oligodendrocytes (OLs) from young rat brains (2–3 months). The schema illustrates the order in which these cell types were most effectively isolated: mature OLs were isolated first using the OL-specific marker MOG, followed by OPCs using A2B5, and finally PreOLs using O4. (B) Principal component analysis (PCA) (left) and average-linkage hierarchical clustering (right) based on global gene expression show that each cell type forms a distinct cluster. OPCs, PreOLs, and OLs were isolated from four different rats. (C) Using gSWITCH, we identified four distinct patterns of switch genes during OL lineage progression. Each coloured line represents one gene and connects its log2fold-change values across the three oligodendrocyte lineage states: OPC, PreOL, and OL. The connecting lines are used to visualise gene-wise patterns of expression change across these cell states. (B, C) GEO accession number of RNA-seq data: GSE301578. See also Supplementary file 1, Figure 1—figure supplement 1, Appendix 1, Figure 1—figure supplement 2, Figure 1—figure supplement 3A.
Figure 1—figure supplement 1
Normalised expression values of marker genes [for astrocytes, progenitor-state marker, oligodendrocyte progenitor cell (OPC), pre-oligodendrocytes (PreOL), and oligodendrocytes (OL)] from RNA-seq data (GEO accession number: GSE301578) were plotted relative to OPCs.
n=4 (young rats), mean ± SEM, * adjusted p<0.05, Benjamini–Hochberg false discovery rate (FDR) after Wald test. ns: adjusted p>0.05. See also Appendix 1.
-
Figure 1—figure supplement 1—source data 1
Numerical data underlying Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig1-figsupp1-data1-v1.xlsx
Figure 1—figure supplement 2
Schematic representation of the logic of the gSWITCH web application (for detail see ‘Materials and methods’ section).
The gSWITCH application is accessible at https://altoslabs.shinyapps.io/gSWITCH/, https://github.com/Tanay-math/gSWITCH (Ghosh, 2026a). Red circles indicate the start and the end state of a series (time or lineage stages or any other variable-dependent series). GLM fit and hypothesis testing followed by contrast analysis between start and the end state generates a subset of genes on which we apply maximum (max) or minimum (min) criteria within a closed interval while taking into account of monotonicity trend, as well as further specific contrasts between groups. This allows identification of four types of switches. Detail criteria are shown inside the boxes and the trend pattern are represented by coloured dashed-straight lines. Arc or solid curve lines indicate statistical significance for specific contrast. Adj p-value: Adjusted p-value [Benjamini–Hochberg false discovery rate (FDR) after likelihood ratio test (LRT) or Benjamini–Hochberg FDR after Wald test for specific contrast analysis]. u.d.: user defined value. Note that to run gSWITCH, RNA-seq data are required (bulk or scRNA-seq flattened to pseudo bulk), where the number of series or time points or group >3 and the replicates per time point or group >2. gSWITCH also identifies transcription factors (TFs) within the switches and provides a summary of the total number of switches and TFs per switch type.
Figure 1—figure supplement 3
Gene ontology (GO) analysis.
(A) Top over-represented GO terms for each switch type shown in Figure 1C. (B) Top over-represented GO terms for the 135 overlapping genes shown in Figure 2C, defined as genes that belong to type 3 switches and are also affected by ageing. Padj: Benjamini–Hochberg adjusted p-value. The dotted blue line indicates the significance threshold of Padj = 0.05, corresponding to −log10(Padj)=1.3. Please note that only 8 type 4 genes overlapped with differentially expressed genes in ageing. Due to this small number, we could not identify any significant GO-term enrichment, and therefore this was not plotted.
-
Figure 1—figure supplement 3—source data 1
Numerical data underlying Figure 1—figure supplement 3B.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig1-figsupp3-data1-v1.xlsx
Figure 2
Down-regulation of switch genes due to ageing.
(A) Principal component analysis (PCA) shows that aged and young oligodendrocyte progenitor cells (OPCs) are distinguishable based on global gene expression (meta-analysis of RNA-seq datasets, GEO accession number: GSE303317). (B) Volcano plot showing differentially expressed genes in aged OPCs compared to young OPCs. n=6 (aged rats), 7 (young rats), FC: fold change; Padj: adjusted p-value (Benjamini–Hochberg FDR after Wald test). (C) Venn diagram (top) showing the subset of type 3 and type 4 switch genes affected by ageing. Their expression patterns are shown in the heat map (bottom), where we observed down-regulation with ageing. *p<0.05, **p<0.001, Chi-square test (two-sided) with Yates’ correction. DE: Differentially expressed. DE gene list is accessible through GEO accession: GSE303317. See also Supplementary file 1, Figure 1—figure supplement 3B.
Figure 3 with 1 supplement
Transcription factor BCL11A-mediated network potentially affected during ageing.
(A) Transcription factor binding site enrichment analysis using type 3 and type 4 switch genes as input identified 27 transcription factors (TFs) detected in both ENCODE and ReMap2, which are ChIP-seq–based experimental databases. Among these 27 TFs, we found 5 TFs that are themselves present as type 3 or type 4 switches (TF switches extracted from gSWITCH). **p<0.001, hypergeometric test. (B) Heat map (top) showing expression (RNA-seq, GEO accession number: GSE303317) of these 5 TFs. Their differential expression in aged oligodendrocyte progenitor cells (OPCs) relative to young OPCs plotted as log2FC (bottom). FC: Fold change, n=6 (aged rats), 7 (young rats), mean ± SEM, * adjusted p-value <0.05, ** adjusted p-value <1×10⁻⁶, Benjamini–Hochberg false discovery rate (FDR) after Wald test. Note: All five TFs are classified as type 3 switches, and Bcl11a shows the strongest repression in aged OPCs, with the highest statistical significance. (C) Bcl11a, as a type 3 TF switch, shows significantly repressed expression as oligodendrocyte (OL) lineage progresses. DESeq2-normalised values relative to OPCs plotted. n=4 different rats, mean ± SEM, ** adjusted p-value <1×10⁻⁶, Benjamini–Hochberg FDR after Wald test. GEO accession number of RNA-seq data: GSE301578. See also Supplementary file 2, Supplementary file 3, Figure 3—figure supplement 1.
-
Figure 3—source data 1
Numerical data underlying Figure 3B and C.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Bcl11a expression in oligodendrocyte progenitor cells (OPCs), oligodendrocytes (OLs), and aged OPCs, as determined by RT-qPCR (reverse transcription followed by qPCR).
(A) Expression levels of Bcl11a, Pdgfra as an OPC marker, and Mbp as an OL marker were measured in OPCs and OLs and plotted relative to OPCs. (B) Expression levels of Bcl11a and Pdgfra were measured in young and aged OPCs and plotted relative to aged OPCs. (A, B) n=3 rats, mean ± SEM, * Holm-adjusted p<0.05, Welch’s t-test (unpaired, two-tailed).
-
Figure 3—figure supplement 1—source data 1
Numerical data underlying Figure 3—figure supplement 1A and B.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig3-figsupp1-data1-v1.xlsx
Figure 4
Effect of Bcl11a inhibition on oligodendrocyte progenitor cells (OPCs) proliferation and differentiation.
(A) Reverse transcription (RT)-qPCR analysis of Bcl11a expression in OPCs transfected with siRNA targeting Bcl11a. siBcl11a: siGENOME Rat Bcl11a; siControl: siGENOME non-targeting control siRNA (Dharmacon). (B) Effect on proliferation. Left: Immunofluorescence analysis using antibodies to OLIG2 and EdU detection (Click-iT protocol), followed by EdU proliferation assay. Right: Quantification of EdU+OLIG2+ cells plotted as a percentage of OLIG2+ cells. P: p-value, Student’s t-test (unpaired and two-tailed) (C) Effect on differentiation. Left: Immunofluorescence analysis using antibody to myelin basic protein (MBP), OLIG2 upon inhibition of Bcl11a in OPCs. Right: quantification of MBP+ cells were plotted as a percentage of OLIG2+ cells. (A–C) n=3 independent experiments (each time 4 P7 brains were pooled for OPC isolation). mean ± SEM. **p<0.01, Student’s t-test (unpaired, two-tailed); The symbol ‘#’ indicates cell count. (B, C) Scale bar: 22 µm.
-
Figure 4—source data 1
Numerical data underlying Figure 4A–C.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig4-data1-v1.xlsx
Figure 5 with 1 supplement
Effect of Bcl11a transient over-expression on proliferation and differentiation of aged oligodendrocyte progenitor cells (OPCs).
(A) Effect on proliferation. Left: Immunofluorescence analysis using antibodies to OLIG2 and EdU detection (Click-iT protocol), followed by EdU proliferation assay. Right: Quantification of EdU+OLIG2+ cells plotted as a percentage of OLIG2+ cells. P: p-value, Student’s t-test (unpaired, two-tailed). (B) Effect on differentiation. Left: Immunofluorescence analysis using antibodies to myelin basic protein (MBP) and OLIG2 after transfection of Bcl11a mRNA (mBcl11a) or Gfp mRNA (mGfp; control) in aged OPCs. Right: Quantification of MBP+ cells plotted as a percentage of OLIG2+ cells. *p<0.05, Student’s t-test (unpaired, two-tailed). (A, B) n=3 independent experiments (each using OPCs isolated from pooled brains of two aged rats). mean ± SEM. The symbol ‘#’ indicates cell count. Scale bar: 22 µm. See also Figure 5—figure supplement 1A and B.
-
Figure 5—source data 1
Numerical data underlying Figure 5A and B.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Fidelity of protein expression from in vitro–transcribed Bcl11a mRNA; mRNA transfection efficiency in aged oligodendrocyte progenitor cells (OPCs); and fidelity of adeno-associated virus (AAV) construct expression in the oligodendrocyte (OL) lineage and infection efficiency in aged mouse brain.
(A) Western blot analysis using antibodies to BCL11A and β-actin (ACTB), with ACTB serving as a loading control, in MCF7 cells transfected with Bcl11a mRNA or Gfp mRNA (control). The molecular weights of BCL11A and ACTB are approximmately 91 KDa and 42 KDa, respectively. (B) Immunofluorescence analysis using antibodies to OLIG2 and GFP in aged OPCs transfected with Gfp mRNA. Quantification of GFP+ OLIG2+ cells were plotted as percentage of OLIG2+ cells. n=3 independent experiments (each using OPCs isolated from pooled brains of two aged rats). mean ± SEM. Scale bar: 22 µm. (C) AAV-carrying constructs are shown in Figure 6A. Left: Immunofluorescence analysis of OLIG2 and GFP immunostaining. Right top: Quantification of OLIG2+ GFP+ cells was plotted as a percentage of GFP+ DAPI+ cells. Right bottom: quantification of OLIG2+ GFP + cells were plotted as a percentage of OLIG2+ cells. n=3 mice, mean + SEM. P: p-value, Student’s t-test (unpaired, two-tailed). Scale bar: 20 µm.
-
Figure 5—figure supplement 1—source data 1
Numerical data underlying Figure 5—figure supplement 1B and C.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig5-figsupp1-data1-v1.xlsx
-
Figure 5—figure supplement 1—source data 2
Original western blot images corresponding to Figure 5—figure supplement 1A.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig5-figsupp1-data2-v1.zip
-
Figure 5—figure supplement 1—source data 3
Original western blot images corresponding to Figure 5—figure supplement 1A, with relevant bands labelled.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig5-figsupp1-data3-v1.zip
Figure 6 with 1 supplement
Oligodendrocyte (OL) lineage specific Bcl11a expression in aged mice.
(A) Left: Sox10-driven construct carrying either Gfp alone (control) or Bcl11a linked to Gfp via a self-cleaving peptide element (P2A). This construct ensures Sox10-driven expression of both Bcl11a and Gfp. P2A: Porcine teschovirus-1 2 A peptide, bGH p(A): bovine growth hormone poly(A) signal. The adeno-associated virus (AAV) containing this construct was delivered to 18-month-old mice via tail-vein injection. Right: schematic showing the experimental timeline. (B) RNA in situ analysis of Plp1. In the lesioned area, the number of Plp1+ cells per mm² was counted and plotted. n=5–6 mice, mean ± SEM, **p<0.01, Student’s t-test (unpaired, two-tailed). Scale bar: 100 µm. The white dotted line demarcates the lesion area. See also Figure 5—figure supplement 1C, Figure 6—figure supplement 1.
-
Figure 6—source data 1
Numerical data underlying Figure 6B.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Immunofluorescence analysis using antibody to OLIG2 after oligodendrocyte (OL) lineage specific Bcl11a expression in aged mice.
The adeno-associated virus (AAV) containing the Sox10-driven construct carrying either Gfp alone (control) or Bcl11a linked to Gfp via a self-cleaving peptide element (P2A) was delivered by tail-vein injection (see Figure 6A). In the lesioned area, the number of OLIG2+ cells per mm2 was counted and plotted. In the same region, the number of Plp1⁻ OLIG2+ cells per mm² was also calculated and plotted (see Figure 6B for Plp1+ cells per mm²). n=5–6 mice, mean ± SEM, P: p-value, *p<0.05, Student’s t-test (unpaired, two-tailed). Scale bar: 100 µm. The white dotted line demarcates the lesion area.
-
Figure 6—figure supplement 1—source data 1
Numerical data underlying Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/110038/elife-110038-fig6-figsupp1-data1-v1.xlsx
Author response image 1
Plotting of FPKM values of Bcl11a (obtained from GSE52564).
mean + SEM shown along with individual data points. OPC: Oligodendrocytes progenitor cells, NFO: Newly formed oligodendrocytes, MO: myelinating oligodendrocytes. Dotted red line: linear regression line.
Tables
Table 1
Test for evolutionary selection on Bcl11a.
| Model | Description | Parameter estimates and test statistics | Interpretation |
|---|---|---|---|
| M0 | M0 (one ratio): assumes that all sites have the same dN/dS. | dN/dS=0.064 (SE: 0.0023) logL=–21196.13 | M0 suggests pervasive purifying selection |
| M3 compared with M0 | M3 (discrete): permits 3 different types of sites with different dN/dS values. Comparison of models M0 and M3 is a test of whether there is variation of selective pressures over sites, including the possibility of sites with dN/dS >1. | Compared with M0: dlogL=–20788.43 - (–21196.13)=407.7 χ2 test (4 df) indicates significant preference for M3 (p<0.00001) | LRT indicates M3 significantly preferred to M0, i.e., strong evidence of selective pressures varying over sites. All sites under purifying selection |
| M2a compared with M1a | M1a (neutral): assumes 2 types of sites, one with dN/dS <1 and one with dN/dS=1. M2a (selection): in addition to the categories in M1a, includes a third class of sites with dN/dS >1. Comparison of these models is a test of whether there are any sites with dN/dS >1. | dlogL=–20983.51- (–20983.62)=0.11 χ2 test (2 df) indicates significant preference for M1a (p=0.90) | Absence of positive selection. |
-
Note: dN: number of non-synonymous changes per non-synonymous site, dS: number of synonymous changes per synonymous site, SE: Standard error, logL: log-likelihood value, dlogL: log-likelihood difference, LRT: likelihood ratio test (2dlogL compared with appropriate χ2 distribution).
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | anti-MBP (Rat monoclonal) | Serotec | Cat# MCA409S; RRID:AB_325004 | IF (1:500 or 1:100) |
| Antibody | Anti-OLIG2 (Rabbit polyclonal) | Millipore | Cat# AB9610; RRID:AB_570666 | IF (1:1000 or 1:100) |
| Antibody | Anti-BCL-11A (Rabbit monoclonal) | Abcam | Cat# ab191401; RRID:AB_2921236 | Western blot (1:3000) |
| Antibody | Anti-beta Actin (mouse monoclonal) | Abcam | Cat# ab6276; RRID:AB_2223210 | Western blot (1:3000) |
| Antibody | Anti-GFP (chicken polyclonal) | Abcam | Cat# ab13970; RRID:AB_300798 | IF (1:1000) |
| Antibody | Cy3 AffiniPure Anti-Rat | Jackson Immuno Research | Cat# 712-165-150; RRID:AB_2340666 | IF (1:1000) |
| Antibody | Alexa Fluor 647 Anti-Rabbit | Invitrogen | Cat# A31573; RRID:AB_2536183 | IF (1:1000 or 1:500) |
| Antibody | Alexa Fluor 488 Anti-Chicken | Jackson Immuno Research | Cat# 703-546-155; RRID:AB_2340376 | IF (1:1000) |
| Antibody | Alexa Fluor 488 anti-rabbit | Invitrogen | Cat# A11008; RRID:AB_143165 | IF (1:1000) |
| Antibody | Alexa Fluor 594 anti-rabbit | Invitrogen | Cat# A11012; RRID:AB_2534079 | IF (1:1000) |
| Antibody | HRP-conjugated donkey anti-rabbit IgG secondary | Amersham/GE Healthcare | Cat# NA934; RRID:AB_772206 | Western blot (1:10000) |
| Antibody | HRP-conjugated sheep anti-mouse IgG secondary | Amersham/GE Healthcare | Cat# NA931; RRID:AB_772210 | Western blot (1:10000) |
| Commercial assay or kit | Click-iT Plus EdU Alexa Fluor 647 Imaging Kit | Thermo Fisher Scientific | Cat# C10640 | NA |
| Commercial assay or kit | pCR 2.1-TOPO TA using TOPO TA Cloning Kit | Thermo Fisher Scientific | Cat# K450001 | NA |
| Cell line (Homo sapiens) | MCF7 | ATCC | Cat# HTB-22 | NA |
| Biological sample (Rattus norvegicus) | Oligodendrocyte progenitor cells[neonatal (P7), young (2–3 months), aged (20–24 months)] | Charles River Laboratories, Margate, UK | NA | Sprague–Dawley rats. See Materials and methods |
| Strain, strain background (Mus musculus) | C57BL/6 mice | Charles River Laboratories, Margate, UK | NA | See Materials and methods |
| Software, algorithm | gSWITCH | This paper | NA | https://github.com/Tanay-math/gSWITCH; https://altoslabs.shinyapps.io/gSWITCH/ |
| Software, algorithm | Codeml | PMID:17483113 | NA | http://abacus.gene.ucl.ac.uk/software/paml.html |
| Software, algorithm | MAFFT | PMID:23329690 | RRID:SCR_011811 | https://mafft.cbrc.jp/alignment/software/ |
| Software, algorithm | PAL2NAL | PMID:16845082 | NA | https://bioconda.github.io/recipes/pal2nal/README.html |
| Software, algorithm | DESeq2 | PMID:25516281 | RRID:SCR_015687 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Software, algorithm | limma | PMID:25605792 | RRID:SCR_010943 | https://bioconductor.org/packages/release/bioc/html/limma.html |
| Software, algorithm | ChEA3 | PMID:31114921 | RRID:SCR_023159 | https://maayanlab.cloud/chea3/ |
| Software, algorithm | Salmon | PMID:28263959 | RRID:SCR_017036 | https://github.com/COMBINE-lab/salmon |
| Software, algorithm | SortMeRNA | PMID:23071270 | RRID:SCR_014402 | https://github.com/sortmerna/sortmerna |
| Software, algorithm | Trimmomatic | PMID:24695404 | RRID:SCR_011848 | http://www.usadellab.org/cms/?page=trimmomatic |
| Software, algorithm | ImageJ version 2.1.0 | PMID:22743772 | RRID:SCR_003070 | https://imagej.net |
| Sequence-based reagent | siGENOME Rat Bcl11a (305589)-SMARTpool (siRNA) | Dharmacon | Cat# M-085668-01-0010 | See Materials and methods |
| Sequence-based reagent | siGENOME non-Targeting siRNA Pool #2 (siRNA) | Dharmacon | Cat# D-001206-14-05 | See Materials and methods |
| Chemical compound, drug | Lipofectamine RNAiMAX | Thermo Fisher Scientific | Cat# 13778030 | See Materials and methods |
| Chemical compound, drug | Lipofectamine MessengerMax | Thermo Fisher Scientific | Cat# LMRNA008 | See Materials and methods |
| Recombinant DNA reagent | Sox10-cfos-Bcl11a-P2A-GFP-bGH (Plasmid) | This paper | NA | Construct for in vivo experiment. See Materials and methods |
| Recombinant DNA reagent | Sox10-cfos-GFP-bGH (Plasmid) | This paper | NA | Construct for in vivo experiment. See Materials and methods |
| Sequence-based reagent | Primers for Bcl11a (Rat): Forward: GTGACACCAGAAGATGACGA Reverse: ATTAGGGCTCCGTGTGCAG | This paper | NA | Amplicon: 131 bp |
| Sequence-based reagent | Primers for Actb (Rat): Forward: CACCATGTACCCAGGCATTG Reverse: CACACAGAGTACTTGCGCTC | This paper | NA | Amplicon: 111 bp |
| Sequence-based reagent | Primers for Hprt (Rat): Forward: CAGACTTTGCTTTCCTTGGTCA Reverse: CCAACACTTCGAGAGGTCCT | This paper | NA | Amplicon: 89 bp |
Author response table 1
Bcl11a expression difference in MOLs vs OPCs (dataset: GSE75330).
| Gene | Comparison | avg_ log_(2)FC | p_val_adj | regulation |
|---|---|---|---|---|
| Bcl11a | MOLs vs OPCs | -1.57156 | 5.55E-07 | down in MOLs |
Additional files
-
Supplementary file 1
All switches during oligodendrocyte (OL)-lineage progression.
- https://cdn.elifesciences.org/articles/110038/elife-110038-supp1-v1.xlsx
-
Supplementary file 2
Transcription factor (TF) switches during OL-lineage progression.
- https://cdn.elifesciences.org/articles/110038/elife-110038-supp2-v1.xlsx
-
Supplementary file 3
27 Transcription factors (TFs) identified by both Encode and Remap2.
- https://cdn.elifesciences.org/articles/110038/elife-110038-supp3-v1.docx
-
Supplementary file 4
Bcl11a DNA and protein sequence accession numbers for 23 vertebrate species used in this study.
- https://cdn.elifesciences.org/articles/110038/elife-110038-supp4-v1.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/110038/elife-110038-mdarchecklist1-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The transcription factor BCL11A restores differentiation potential to aged oligodendrocyte progenitor cells
eLife 15:RP110038.
https://doi.org/10.7554/eLife.110038.3
