Proteomic composition and mutual assembly of the C2a projection in vertebrate motile cilia
- Center for Cell Structure and Function, College of Life Sciences, Shandong Normal University, China
- School of Life Sciences and Medicine, Shandong University of Technology, China
- Key Laboratory of Multi-Cell Systems, Shanghai Institute of Biochemistry and Cell Biology, Center for Excellence in Molecular Cell Science, University of Chinese Academy of Sciences, Chinese Academy of Sciences, China
- Soong Ching Ling Institute of Maternity and Child Health, International Peace Maternity and Child Health Hospital, Shanghai Jiao Tong University School of Medicine, China
- Cheeloo College of Medicine, Shandong University, China
Figures
Figure 1 with 1 supplement
Loss of C2a proteins in mice leads to primary ciliary dyskinesia (PCD)-related phenotypes.
(A) Schematics of the cross-section of motile cilia and major projections associated with the C1 and C2 microtubules. The molecular model of the C2a projection (PDB: 7SOM) is superimposed onto the cryo-EM density map from Han et al., 2022. (B) Schematic strategies for the generation of Ccdc108 KO, Mycbpap KO, and Cfap70 KO mice using CRISPR/Cas9. The genomic positions of the primers used for genotyping are indicated. UTR, untranslated region; CDS, coding sequence. (C) Genotyping of WT, HET, and KO mice for each strain. (D) Immunoblotting showing the depletion efficiency in Mycbpap KO and Cfap70 KO mEPCs. GAPDH is used as a loading control. (E) Genotype distribution profiles of pups at P0 and P7 resulting from matings of HET mice with specified genotypes. Note that Mycbpap KO mice were born at Mendelian ratios but experienced early death within 1 week of birth. (F) Representative images of mice with specified genotypes at 2 weeks of age. (G) Survival curves of WT (starting number: 30), Ccdc108 KO (starting number: 18), Mycbpap KO (starting number: 10), and Cfap70 KO (starting number: 21) mice. The numbers of surviving mice for each genotype at 12 weeks of age are shown. (H) Weights of male and female WT, Ccdc108 HET, and Ccdc108 KO (survivor) mice were recorded from 1 to 8 weeks of age. Data are presented as mean ± SD (n = 6 mice per genotype). (I) Representative images of serial vibratome sections of the brains from mice with specified genotypes at 2 weeks of age. (J) Periodic Acid-Schiff (PAS) staining of the nasal cavities of mice with specified genotypes at 2 weeks of age. Magnified images are shown on the right. The asterisks indicate mucus accumulation. (K) Incidence of hydrocephalus and sinusitis in mice with specified genotypes. Hydrocephalus and sinusitis were determined as described in (I) and (J), respectively. The cell number in each column indicates the number of mice analyzed.
-
Figure 1—source data 1
PDF files containing original western blots for Figure 1C, D, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig1-data1-v1.zip
-
Figure 1—source data 2
Original files for western blot analysis displayed in Figure 1C, D.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig1-data2-v1.zip
-
Figure 1—source data 3
Plotted values in panels E, G, H, and K.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig1-data3-v1.zip
Figure 1—figure supplement 1
Mice lacking C2a proteins display phenotypes associated with primary ciliary dyskinesia (PCD).
(A–C) Real-time polymerase chain reaction (PCR) analyses showing the expression levels of Ccdc108, Mycbpap, and Cfap70 in various mouse tissues. The expression was normalized using the corresponding Gapdh as the reference gene and baseline 1 (heart) as the reference sample (ΔΔCT method). Data are from three independent biological repeats and are presented as mean ± SEM. (D) Typical images of tracheal multiciliated cells (MCCs) from WT and Ccdc108 KO mice immunostained with the indicated antibodies. Note that the staining of CCDC108 in Ccdc108 KO cells is invisible. (E) Representative images of WT and Ccdc108 KO mice at 8 weeks of age. (F) Representative images of serial vibratome sections of the brains from WT and Ccdc108 KO mice at 12 weeks of age.
-
Figure 1—figure supplement 1—source data 1
Plotted values in panels A–C.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig1-figsupp1-data1-v1.zip
Figure 2 with 1 supplement
C2a proteins are essential for the integrity of C2-related projections.
Immunofluorescence (A) and quantifications (B) of the number of basal bodies and cilia per mEPC cultured from WT, Ccdc108 KO, Mycbpap KO, and Cfap70 KO mice. Cells were immunostained with acetylated α-tubulin (ace-Tub) and CEP164 antibodies, and imaged with three-dimensional structured illumination microscopy (3D-SIM). 80 cells from 3 mice (per genotype) were scored using ImageJ. Representative frames (C) and quantifications (D) of indicated movement modes and beat frequencies of motile cilia in WT, Ccdc108 KO, Mycbpap KO, and Cfap70 KO mEPCs. Trajectories of four or five cilia in each cell are shown. mEPCs in which the majority of motile cilia displayed rotational movement were considered ‘cells with rotational cilia’. Diagrams illustrate the corresponding ciliary beat patterns. 60 cells from 3 mice (per genotype) were scored using ImageJ. Transmission electron microscopy (TEM) images and quantifications of ciliary axonemes in mEPCs serum-starved for 10 days (E, F) and in tracheal multiciliated cells (MCCs) (G, H) from WT, Ccdc108 KO, Mycbpap KO, and Cfap70 KO mice. Arrowheads indicate the positions of the C2 projections. At least 50 axonemes from 3 mice (per genotype) were scored. Data in (B, D, F, H) are presented as mean ± SD. One-way ANOVA with a Dunnett’s test was performed. *p < 0.05; **p < 0.01; ***p < 0.001; ns, not significant.
-
Figure 2—source data 1
Plotted values in panels B, D, F, and H.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig2-data1-v1.zip
Figure 2—figure supplement 1
Loss of C2a proteins leads to ultrastructural defects in the cilia axonemes.
Scanning electron microscopy (SEM) images of ependyma (A) and trachea (B) epithelia isolated from WT, Ccdc108 KO, Mycbpap KO, and Cfap70 KO mice at 2 weeks of age. (C, D) Transmission electron microscopy (TEM) images and quantifications of ciliary axonemes in Ccdc108 KO mEPCs serum-starved for 5 days. At least 50 axonemes from 3 mice (per genotype) were scored. Data are presented as mean ± SD.
-
Figure 2—figure supplement 1—source data 1
Plotted values in panel D.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig2-figsupp1-data1-v1.zip
Figure 3 with 1 supplement
CCDC108, MYCBPAP, and CFAP70 mutually interact with each other.
(A, B) Co-immunoprecipitation (co-IP) and immunoblotting showing the interaction between endogenous MYCBPAP and CFAP70. Co-IP was performed with a normal rat IgG control antibody and a rat polyclonal anti-CFAP70 antibody (A) or a normal guinea pig IgG and a guinea pig polyclonal anti-MYCBPAP antibody (B) in mouse testis lysates. (C, D) Co-IP and immunoblotting analyses in HEK293T cells exogenously expressing indicated proteins. HA-tagged proteins in (C) and GFP-tagged proteins in (D) were immunoprecipitated with anti-HA and anti-GFP agarose beads, respectively. Blots were probed with the indicated antibodies. Luci, luciferase. (E) Diagrams of CCDC108, MYCBPAP, and CFAP70 full-length (F) and truncated fragments showing their ability to interact. Interactions were determined through co-IP analyses. Numbers indicate amino acid positions. PPI, protein–protein interaction. (F–H) GST pull-down showing direct interactions using purified fragment proteins. Blots were probed with the indicated antibodies. CB, Coomassie blue staining.
-
Figure 3—source data 1
PDF files containing original western blots for Figure 3A–D and F–H, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig3-data1-v1.zip
-
Figure 3—source data 2
Original files for western blot analysis displayed in Figure 3A–D and F–H.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig3-data2-v1.zip
Figure 3—figure supplement 1
C2a proteins display mutual interactions.
(A–G) Co-immunoprecipitation (co-IP) and immunoblotting analyses in HEK293T cells exogenously expressing indicated proteins. GFP-tagged proteins in (A), (D), and (E) and HA-tagged proteins in (B), (C), (F), and (G) were immunoprecipitated with anti-GFP and anti-HA agarose beads, respectively. Blots were probed with the indicated antibodies. Luci, luciferase.
-
Figure 3—figure supplement 1—source data 1
PDF files containing original western blots for Figure 3—figure supplement 1A–G, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig3-figsupp1-data1-v1.zip
-
Figure 3—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 3—figure supplement 1A–G.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig3-figsupp1-data2-v1.zip
Figure 4
CCDC108, MYCBPAP, and CFAP70 localize to the axonemal central lumen.
Confocal (A) and three-dimensional structured illumination microscopy (3D-SIM) (B) images of mEPCs expressing GFP-tagged proteins immunostained with the indicated antibodies. Magnified images of the cilia indicated by arrowheads are shown on the right. Line-scan graphs show the immunofluorescence intensity along the positions marked by arrows in the magnified images. The right Y-axis describes the immunofluorescence intensity of GFP-CCDC108 and GFP-CFAP70, respectively. (C, D) 3D-SIM images of mEPCs immunostained with the indicated antibodies. Magnified images of the cilia indicated by arrowheads are shown on the right. Line-scan graphs show the immunofluorescence intensity along the positions marked by the two arrows in the magnified images. The right Y-axis describes the immunofluorescence intensity of ace-Tub in (D).
-
Figure 4—source data 1
Plotted values in panels B–D.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig4-data1-v1.zip
Figure 5 with 1 supplement
CCDC108, MYCBPAP, and CFAP70 are all essential for the stable docking of each C2a protein.
Representative confocal images of mEPC (A–C) and tracheal multiciliated cells (MCCs) (D–F) from WT, Ccdc108 KO, Mycbpap KO, or Cfap70 KO mice immunostained with the indicated antibodies. Note that the ciliary staining of C2a proteins was greatly reduced in KO samples. (G) Schematic diagrams of mEPC culture and motile cilia purification. (H–J) Immunoblotting and quantification showing the C2a protein levels in motile cilia (H) or mEPCs (I) derived from Ccdc108 KO, Mycbpap KO, and Cfap70 KO mEPCs. Acetylated α-tubulin (ace-Tub) and GAPDH are used as loading controls, respectively. The MYCBPAP or CFAP70 band intensity in (I) was normalized to the corresponding GAPDH intensity. Data are presented as mean ± SD. (K) Real-time polymerase chain reaction (PCR) analyses showing the expression levels of the indicated genes in Ccdc108 KO, Mycbpap KO, and Cfap70 KO mEPCs. The expression was normalized using the corresponding Gapdh as the reference gene and WT as the reference sample (ΔΔCT method). Data are from three independent biological repeats and are presented as mean ± SD. (L) Proposed model showing the absence of the C2a projection in Ccdc108 KO, Mycbpap KO, and Cfap70 KO axoneme. One-way ANOVA with a Dunnett’s test was performed. *p < 0.05; **p < 0.01; ***p < 0.001; ns, not significant.
-
Figure 5—source data 1
PDF files containing original western blots for Figure 5H, I, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig5-data1-v1.zip
-
Figure 5—source data 2
Original files for western blot analysis displayed in Figure 5H, I.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig5-data2-v1.zip
-
Figure 5—source data 3
Plotted values in panels J and K.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig5-data3-v1.zip
Figure 5—figure supplement 1
Loss of C2a proteins has no obvious impact on non-C2a ciliary proteins.
(A–C) Representative confocal images of mEPC cultured from WT, Ccdc108 KO, Mycbpap KO, or Cfap70 KO mice immunostained with the indicated antibodies. Note that the ciliary staining of SPEF1, HYDIN, and RSPH3 was unchanged in KO samples.
Figure 6 with 1 supplement
Identification of ARMC3 and MYCBP as new C2a components.
Silver staining of proteins immunoprecipitated from mouse testis lysates using a normal guinea pig IgG and a guinea pig polyclonal anti-MYCBPAP antibody (A) or a normal rat IgG control antibody and a rat polyclonal anti-CFAP70 antibody (B). The bands of MYCBPAP and CFAP70 are indicated by red arrowheads. Interactor candidates of MYCBPAP (C) and CFAP70 (D) identified by mass spectrometry analysis. Co-immunoprecipitation (co-IP) and immunoblotting showing the interactions of endogenous MYCBPAP (E) and CFAP70 (F) with ARMC3 and MYCBP. Co-IP was performed with a normal guinea pig IgG and a guinea pig polyclonal anti-MYCBPAP antibody (E) or a normal rat IgG control antibody and a rat polyclonal anti-CFAP70 antibody (F) in mouse testis lysates. (G, H) Co-IP and immunoblotting analyses in HEK293T cells exogenously expressing indicated proteins. GFP-tagged proteins were immunoprecipitated with anti-GFP agarose beads. Blots were probed with the indicated antibodies. Luci, luciferase. (I) Three-dimensional structured illumination microscopy (3D-SIM) images of mEPCs immunostained with the indicated antibodies. Magnified images of the cilia indicated by arrowheads are shown on the right. Line-scan graphs show the immunofluorescence intensity along the positions marked by two arrows in the magnified images. (J–M) Representative confocal images of mEPC from WT, Mycbpap, and Ccdc108 KO mice immunostained with the indicated antibodies.
-
Figure 6—source data 1
PDF files containing original western blots for Figure 6A, B, E–H, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig6-data1-v1.zip
-
Figure 6—source data 2
Original files for western blot analysis displayed in Figure 6A, B, E–H.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig6-data2-v1.zip
-
Figure 6—source data 3
Plotted values in panels C, D, and I.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig6-data3-v1.zip
Figure 6—figure supplement 1
Identification of ARMC3 and MYCBP as new C2a components.
(A, B) Co-immunoprecipitation (co-IP) and immunoblotting showing interactions between MYCBPAP and CFAP70, ARMC3, and MYCBP. Co-IP was performed with a normal guinea pig IgG and a guinea pig polyclonal anti-MYCBPAP antibody in lysates from mouse trachea and mEPCs. (C) Immunoblotting of mEPCs harvested at the indicated serum-starvation days for the indicated proteins. GAPDH is used as a loading control.
-
Figure 6—figure supplement 1—source data 1
PDF files containing original western blots for Figure 6—figure supplement 1A–C, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 6—figure supplement 1A–C.
- https://cdn.elifesciences.org/articles/110601/elife-110601-fig6-figsupp1-data2-v1.zip
Videos
Video 1
Ciliary motilities in representative WT, Ccdc108 KO, Mycbpap KO, or Cfap70 KO mEPCs.
Motilities of multicilia in WT, Ccdc108 KO, Mycbpap KO, or Cfap70 KO mEPCs were stained with SiR-tubulin and live imaged. Image sequences are played back at 5 frames per second.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Cfap70 | GenBank | NM_029698.1 | |
| Gene (Homo sapiens) | MYCBPAP | GenBank | BC028393.2 | |
| Gene (Mus musculus) | Ccdc108 | GenBank | NM_001039495.2 | |
| Gene (Homo sapiens) | ARMC3 | GenBank | NM_173081.5 | |
| Gene (Mus musculus) | Mycbp | GenBank | NM_019660.3 | |
| Strain, strain background (Escherichia coli) | BL-21 (DE3) | Zomanbio | ZC1209 | |
| Strain, strain background (Escherichia coli) | Stbl3 | Zomanbio | ZC108 | |
| Strain, strain background (Escherichia coli) | DH5α | Zomanbio | ZC1071 | |
| Genetic reagent (Mus musculus) | Cfap70 | GemPharmatech | T046360 | RRID:IMSR_GPT:T046360 |
| Genetic reagent (Mus musculus) | Mycbpap | Shanghai Model Organisms Center | NM-KO-201186 | RRID:IMSR_NM-KO-201186 |
| Genetic reagent (Mus musculus) | Ccdc108 | Other | Gift from Dr. Chunyu Liu (Shanghai Jiao Tong University) | |
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-11268 | RRID:CVCL_1926 |
| Cell line (Homo sapiens) | HEK293A | Thermo Fisher | R70507 | RRID:CVCL_6910 |
| Transfected construct (Mus musculus) | pDC316-GFP-Cfap70 | This paper | For adenovirus preparation | |
| Transfected construct (Mus musculus) | pDC316-GFP-Ccdc108 | This paper | For adenovirus preparation | |
| Transfected construct (Homo sapiens) | pDC316-GFP-MYCBPAP | This paper | For adenovirus preparation | |
| Transfected construct (Mus musculus) | pLV-GFP-Cfap70 | This paper | For lentivirus preparation | |
| Transfected construct (Mus musculus) | pEGFP-Ccdc108 | This paper | Construct for transfection | |
| Transfected construct (Homo sapiens) | pDEST-GFP-MYCBPAP | This paper | Construct for transfection | |
| Transfected construct (Mus musculus) | pCS2-HA-Cfap70 | This paper | Construct for transfection | |
| Transfected construct (Mus musculus) | pEDST-HA-Ccdc108 | This paper | Construct for transfection | |
| Transfected construct (Homo sapiens) | pCS2-HA-MYCBPAP | This paper | Construct for transfection | |
| Biological sample (include species here) | Primary mouse ependymal cell | Other | Freshly prepared from P0 mouse brain | |
| Antibody | Acetylated tubulin (Mouse IgG2b) | Sigma-Aldrich | T6793 | RRID:AB_477585 WB (1:5000), IF (1:500) |
| Antibody | acetylated Tubulin Monoclonal antibody (Mouse IgG1) | Proteintech | 66200-1-Ig | RRID:AB_2883533 WB (1:2000), IF (1:500) |
| Antibody | GAPDH Polyclonal antibody (Rabbit IgG) | Proteintech | 10494-1-AP | RRID:AB_2263076 WB (1:20,000) |
| Antibody | GFP Polyclonal antibody | This paper | WB (1:5000), IF (1:200) | |
| Antibody | HA Monoclonal antibody | Abmart | M20003M | RRID:AB_2864345 WB (1:10,000) |
| Antibody | ARMC3 Polyclonal antibody | Proteintech | 28418-1-AP | RRID:AB_3086049 WB (1:2000), IF (1:200) |
| Antibody | MYCBP Polyclonal antibody | Proteintech | 12022-1-AP | RRID:AB_2148722 WB (1:2000), IF (1:200) |
| Antibody | CEP164 Polyclonal antibody | Proteintech | 22227-1-AP | RRID:AB_2651175 IF (1:500) |
| Antibody | RSPH3 Polyclonal antibody | Proteintech | 17603-1-AP | RRID:AB_2181073 IF (1:200) |
| Antibody | HRP-conjugated His-Tag Monoclonal antibody | Proteintech | HRP-66005 | RRID:AB_2857904 WB (1:5000) |
| Antibody | Guinea pig anti-CEP164 Polyclonal antibody | This paper | IF (1:1000) | |
| Antibody | Guinea pig anti-MYCBPAP Polyclonal antibody | This paper | IF (1:500) | |
| Antibody | Rat anti-CFAP70 Polyclonal antibody | This paper | WB (1:1000), IF (1:500) | |
| Antibody | Rat anti-CCDC108 Polyclonal antibody | This paper | IF (1:500) | |
| Antibody | Rat anti-SPEF1 Polyclonal antibody | This paper | IF (1:1000) | |
| Antibody | Rat anti-HYDIN Polyclonal antibody | This paper | IF (1:200) | |
| Antibody | Chicken anti-ODF2 Polyclonal antibody | This paper | IF (1:1000) | |
| Antibody | Goat anti-Mouse IgG (H+L)-HRP | Thermo Fisher | G-21040 | RRID:AB_2536527 WB (1:20,000) |
| Antibody | Goat anti-Rabbit IgG (H+L)-HRP | Thermo Fisher | 31460 | RRID:AB_228341 WB (1:20,000) |
| Antibody | Goat anti-Rat IgG (H+L)-HRP | Thermo Fisher | A18739 | RRID:AB_2535516 WB (1:5000) |
| Antibody | Goat anti-Guinea Pig IgG (H+L)-HRP | Thermo Fisher | A18769 | RRID:AB_2535546 WB (1:5000) |
| Antibody | Donkey anti-Rabbit IgG (H+L)-Dylight 405 | Jackson ImmunoResearch | 711-475-152 | RRID:AB_2340616 IF (1:200) |
| Antibody | Donkey anti-Guinea Pig IgG (H+L)-Dylight 405 | Jackson ImmunoResearch | 706-475-148 | RRID:AB_2340470 IF (1:200) |
| Antibody | Donkey anti-Mouse IgG (H+L)-Dylight 405 | Jackson ImmunoResearch | 715-475-151 | RRID:AB_2340840 IF (1:200) |
| Antibody | Donkey anti-Rabbit IgG (H+L)-Alexa Fluor 488 | Thermo Fisher | A-21206 | RRID:AB_2535792 IF (1:1000) |
| Antibody | Donkey anti-Rat IgG (H+L)-Alexa Fluor 488 | Jackson ImmunoResearch | 712-545-153 | RRID:AB_2340684 IF (1:1000) |
| Antibody | Donkey anti-Guinea Pig IgG (H+L)-Alexa Fluor 488 | Jackson ImmunoResearch | 706-546-148 | RRID:AB_2340473 IF (1:1000) |
| Antibody | Goat anti-Rat IgG (H+L)-Alexa Fluor 546 | Thermo Fisher | A-11081 | RRID:AB_141738 IF (1:1000) |
| Antibody | Donkey anti-Mouse IgG (H+L)-Cy3 | Jackson ImmunoResearch | 715-165-151 | RRID:AB_2315777 IF (1:1000) |
| Antibody | Donkey anti-Guinea Pig IgG (H+L)-Alexa Fluor 647 | Jackson ImmunoResearch | 706-605-148 | RRID:AB_2340476 IF (1:1000) |
| Antibody | Donkey anti-chicken IgY-Cy3 | Jackson ImmunoResearch | 703-165-155 | RRID:AB_2340363 IF (1:1000) |
| Sequence-based reagent | Ccdc108 genotyping F1 | This paper | PCR primers | AGTAGAATCCTGGGGTTAAGTAG |
| Sequence-based reagent | Ccdc108 genotyping R1 | This paper | PCR primers | CCTGGCTGTATAGTGAAAGAAACC |
| Sequence-based reagent | Ccdc108 genotyping R2 | This paper | PCR primers | ACCCTATCAACCAACAAATGATG |
| Sequence-based reagent | Mycbpap genotyping F2 | This paper | PCR primers | CTGGACAAGCCAGGTGTCAT |
| Sequence-based reagent | Mycbpap genotyping R3 | This paper | PCR primers | CTCAGCAATCCAGGCTCCAA |
| Sequence-based reagent | Mycbpap genotyping R4 | This paper | PCR primers | TCTGGTGAGGGAGGATCTGG |
| Sequence-based reagent | Cfap70 genotyping F3 | This paper | PCR primers | TACAGCTCAAGCCACACCATCTG |
| Sequence-based reagent | Cfap70 genotyping R5 | This paper | PCR primers | AAGTTACAGAAGGCAGTGGGCTAC |
| Sequence-based reagent | Cfap70 genotyping F4 | This paper | PCR primers | GAAGGGTCTGCTGCTGGCTCTGGA |
| Sequence-based reagent | Gapdh qPCR Primer F | This paper | PCR primers | AGGTCGGTGTGAACGGATTTG |
| Sequence-based reagent | Gapdh qPCR Primer R | This paper | PCR primers | TGTAGACCATGTAGTTGAGGTCA |
| Sequence-based reagent | Ccdc108 qPCR Primer F | This paper | PCR primers | CTGGATCTGAAGCTGGACAC |
| Sequence-based reagent | Ccdc108 qPCR Primer R | This paper | PCR primers | CGTTAGTGTGAGGTTCTCGT |
| Sequence-based reagent | Mycbpap qPCR Primer F | This paper | PCR primers | CTAGCATAGGAAAGAAGAGTGTGG |
| Sequence-based reagent | Mycbpap qPCR Primer R | This paper | PCR primers | CATCACTGCCTGTCTGAAGTC |
| Sequence-based reagent | Cfap70 qPCR Primer F | This paper | PCR primers | CGCTTTCTGTCTCCTCACTG |
| Sequence-based reagent | Cfap70 qPCR Primer R | This paper | PCR primers | AGAACAATCCGAGTAAAGTCCA |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | |
| Software, algorithm | Prism 10 | GraphPad Software | RRID:SCR_002798 | |
| Software, algorithm | SnapGene | GraphPad Software | RRID:SCR_015052 | |
| Other |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Proteomic composition and mutual assembly of the C2a projection in vertebrate motile cilia
eLife 15:RP110601.
https://doi.org/10.7554/eLife.110601.3
