1. Immunology and Inflammation
Download icon

CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells

  1. Xiaomei Yuan
  2. Bi-Huei Yang
  3. Yi Dong
  4. Asami Yamamura
  5. Wenxian Fu  Is a corresponding author
  1. University of California, United States
Research Article
Cite this article as: eLife 2017;6:e29540 doi: 10.7554/eLife.29540
8 figures, 1 table and 1 additional file

Figures

Figure 1 with 3 supplements
CRIg+TRMs form a protective barrier to prevent tissue autoimmune infiltration and activation.

(A) The distribution of CRIg+ TRMs within the pancreas. Immunostaining of pancreatic frozen sections of 10-week-old NOD mice. (left) Representative images depicting an intact (upper) and an insulitic (lower) islet, respectively. Red: CRIg; Blue: DAPI. The border of the islet was marked by dotted lines; immune infiltration was highlighted by higher density of DAPI+ dots (n = 9 for intact and n = 8 for insulitic). Bar, 50 um. (right) The numbers of CRIg+ TRMs per islet counted from immunostaining sections of pancreas as in (A). Islets were categorized into intact (free from infiltration) and insulitic groups. (B) The severity of insulitis in 10-week-old NOD and NOD/CRIg KO mice. Hematoxylin and eosin staining of pancreatic paraffin sections. Arrowheads depict massive immune infiltration. Bar, 50 um. (C) Flow cytometric analyses of digested pancreases of NOD/CRIg KO mice and littermate controls (n = 7 in each group). (Left) The percentages of pancreatic Treg cells in age-matched NOD and NOD/CRIg KO mice (mixed of both females and males). (Right) The ratio between Treg cells and CD8+ T cells (n = 7 in each group). (D) The production of IFN-γ in CD4+ Tconv and CD8+ T cells. Pancreatic digestions were the same as in (C). Data are representative of three (A, B) or four (C, D) experiments. Student’s t-test was used. *p<0.05; **p<0.01; ***p<0.001.

https://doi.org/10.7554/eLife.29540.002
Figure 1—figure supplement 1
Tissue-distribution of CRIg+ TRMs.

(A) Immunostaining for CRIg on frozen sections of the pancreas, liver, small and large intestines and lung from 7-week-old B6 mice. lower panel: second Ab only. LP, lamina propria. Bar: 50 um. (B) Flow cytometric analyses of CRIg expression in different tissues. The strain and age of the mice were the same as in (A). Bar: 50 um. Data are representative of at least three experiments. (C) The expression of CRIg in human pancreas. Red, CRIg; green, insulin. Dotted lines depicted islets. Data are representative of four human pancreases. (D) Flow cytometric analyses of CRIg in lymphoid-lineage cells. None of these cells expresses CRIg.

https://doi.org/10.7554/eLife.29540.003
Figure 1—figure supplement 2
CRIg deficiency does not affect T cells in lymphoid organs.

(A) The percentages of Treg cells in age-matched wildtype and CRIg KO mice (mixed of both females and males) in spleen and pancreatic draining LNs (panLNs). (B) The ratios between Treg cells and CD8+ T cells in age-matched wildtype and CRIg KO mice (mixed of both females and males) in spleen and panLNs. (C) The production of IFN-γ in CD4+ Tconv from spleen or panLNs of wildtype and CRIg KO mice. (D) The production of IFN-γ in CD8+ T cells from spleen or panLNs of wildtype and CRIg KO mice. Data are representative of four experiments. Student’s t-test was used. n.s., non-significant. WT, wildtype; KO, CRIg knockout.

https://doi.org/10.7554/eLife.29540.004
Figure 1—figure supplement 3
Cell-cell contact between CRIg+TRMs and T cells in pancreas.

(A) Cell-cell contact between CRIg+ macrophages (green) and islet-infiltrating CD4 T cells (red). Arrowheads, CD4+ T cells; long arrows, CRIg+ TRMs. Bar, 50 um.

https://doi.org/10.7554/eLife.29540.005
Figure 2 with 4 supplements
CRIg suppresses T cell activation.

(A) CFSE-labeled CD4+ CD25- Tconv cells were stimulated with anti-CD3/CD28. Plate-bound CRIg-Ig, or control Ig, was added either all time during T cell culture (3 d), or only the first 24 hr, or the late 48 hr. T cell proliferation was measured by CFSE dilution. (B) The expression of early T cell activation markers-CD69 and CD25 in cultured Tconv cells with plate-bound control Ig, or CRIg-Ig. (C) The phosphorylation of early T cell activation cascade proteins. CD4+ CD25- Tconv cells were activated in vitro with anti-CD3/CD28 in the presence of plate-bound control Ig, or CRIg-Ig. (D) The binding of CRIg to activated T cells. CD4+ CD25- Tconv cells were activated in vitro by anti-CD3/CD28 for various lengths of time (12 hr, 24 hr and 72 hr). At each time-point of T cell activation, various concentrations of biotinylated control Ig or CRIg-Ig were incubated with T cells at 37°C for 1 hr. The binding of biotin-labeled Ig proteins was detected using streptavidin-conjugated antibody. (left) Representative histograms of SA-PercpCy5.5 MFIs depicting the binding intensities of biotinylated proteins (25 ug/ml) bound to T cells. (right) Statistical data showing fold-changes of SA-PercpCy5.5 MFIs between CRIg-Ig and control Ig at each time-point and each concentration. P values were calculated by comparing the binding intensities between biotin-CRIg-Ig and biotin-control-Ig. The data are representative from five (A), three (B), and four (C, D) experiments. Student’s t-test was used. *p<0.05; **p<0.01; ***p<0.001, n.s., non-significant.

https://doi.org/10.7554/eLife.29540.006
Figure 2—figure supplement 1
The suppressive effect of CRIg on T cells is complement-independent.

(A) CFSE-labeled CD4+ Foxp3(GFP)Tconv cells were stimulated with anti-CD3/CD28, in the presence of plate-coated control Ig, or CRIg-Ig. Soluble anti-CRIg mAb (clone 14G8) was added. T cell proliferation was analyzed by CFSE dilutions after 3 days. (B) CRIg can attenuate TCR signaling in serum-free condition (deprived of complements). Arrow heads depict the suppression of phosphorylation of each respective TCR signaling cascade proteins. Data are representative of four (A) and three (B) experiments. Student’s t-test was used. n.s., non-significant; ***p<0.001.

https://doi.org/10.7554/eLife.29540.007
Figure 2—figure supplement 2
Plate-bound anti-CRIg mAb augments the effect of CRIg-Ig in T cells.

CTV-labeled CD4+ Foxp3(GFP)- Tconv cells were stimulated with anti-CD3/CD28, in the presence of plate-coated isotype-matched control mAb, or anti-CRIg-Ig (17C9) (with various concentrations as indicated). Soluble CRIg-Ig was added (5 ug/ml) into the culture medium. After 3 days of culture, cell proliferation was measured by CTV dilution. Numbers depicted proportions of divided cells. Data are representative of three independent experiments.

https://doi.org/10.7554/eLife.29540.008
Figure 2—figure supplement 3
The binding of CRIg to activated Treg cells and differential suppression of CRIg-Ig for Tconv and Treg cells.

(A) CD4+ CD25+ Treg cells were activated in vitro by anti-CD3/CD28 for various lengths of time (12 hr, 24 hr and 72 hr). At each time-point of activation, various concentrations of biotinylated control Ig or CRIg-Ig were incubated with T cells at 37°C for 1 hr. The binding of biotin-labeled Ig proteins to Foxp3(GFP)+ Treg cells was detected using streptavidin-conjugated antibody. (left) Representative histograms of SA-PercpCy5.5 MFIs depicting the binding intensities of biotinylated proteins (25 ug/ml) bound to Treg cells. (right) Statistical data showing fold-changes of SA-PercpCy5.5 MFIs between CRIg-Ig and control Ig at each time-point and each concentration. P values were calculated by comparing the binding intensities of Biotin-CRIg-Ig to Biotin-control-Ig. *p<0.05. (B) Tconv and Treg cells were labeled with CFSE and cultured under the same condition (anti-CD3/CD28, IL-2 with the presence of plate-coated CRIg-Ig or control Ig. Cell proliferation was measured after 3 days of culture. Data were representative of three experiments.

https://doi.org/10.7554/eLife.29540.009
Figure 2—figure supplement 4
Ig fusion proteins of CTLA4, PD-1, VISTA, CD226 and TIGIT do not abolish the suppression of CRIg-Ig in T cells.

CTV-labeled CD4+ Foxp3(GFP)- Tconv cells were stimulated with anti-CD3/CD28, in the presence of plate-coated control Ig, or CRIg-Ig (5 ug/ml). Soluble Ig fusion proteins for CTLA-4, PD-1, VISTA, CD226 and TIGIT (from R and D) were added at indicated concentrations. T cell proliferation was analyzed by CTV dilutions at day 3. Shown are representative of three experiments.

https://doi.org/10.7554/eLife.29540.010
Figure 3 with 2 supplements
CRIg promotes iTreg generation in vitro.

(A) (left) Representative FACS plots depicting the generation of iTreg cells in the presence of CRIg-Ig, or control Ig, under various concentrations of TGF-β. (right) Statistics of multiple experiments. (B) Tconv cells were cultured in the condition of anti-CD3/CD28 and IL-2, anti-TGF-β neutralizing antibody (clone 1D11) and either control Ig, or CRIg-Ig. (C) Total splenocytes from 8-week-old NOD/BDC2.5/Thy1.1 mice were labeled with CTV and cultured with BDC2.5 mimotope (100 ng/ml) for 3 days. The generation of Treg cells were analyzed by intracellular Foxp3 staining. (D) iTreg generation in vitro as in (C) with the inclusion of CRIg+ or CRIg- macrophages, sorted from peritoneal cavity. (E) Purified CD4+Foxp3 (GFP)- T cells from NOD/BDC2.5/Foxp3GFP/Thy1.1 mice were transferred into 4-week-old NOD mice, followed by i.p. injection of CRIg-Ig, or control Ig every other day for 2 weeks. (F) Purified CD4+Foxp3 (GFP)- T cells from NOD/BDC2.5/Foxp3GFP/Th1.1 mice were transferred into 4-week-old NOD or NOD/CRIg KO mice. The generation of Foxp3(GFP)+ cells in pancreatic islets, panLNs and inguinal LNs(ILNs) was analyzed 2 weeks after the transfer. (G) Flow cytometric analyses of HeliosTreg cells from pancreas, colon and lung of NOD/CRIgKO and wildtype controls. (H, I) Purified CD4+ Foxp3(GFP)- T cells were cultured with either control Ig or CRIg-Ig for 18 hr and analyzed for the phosphorylation of AKT (H) and ribosomal protein S6 (I). Dotted line, control Ig; solid line, CRIg-Ig. Data are representative of five (A), three (B–I) experiments. Student’s t-test was used. n.s., non-significant. *p<0.05; ***p<0.001; ****p<0.0001. Ctl, control; KO, CRIg knockout.

https://doi.org/10.7554/eLife.29540.011
Figure 3—figure supplement 1
CRIg-Ig does not enhance TGF-β induced phosphorylation of Smad2/3.

CD4+ CD25- cells were sorted and cultured with 0.2% of fetal bovine serum under iTreg differentiation condition. Phosphorylation of Smad2/3 was detected 2 hr after TGF-β stimulation by flow cytometry. Data are representative of three experiments. n.s., non-significant.

https://doi.org/10.7554/eLife.29540.012
Figure 3—figure supplement 2
Experimental design and FACS profiles of in vivo pTreg generation promoted by CRIg-Ig.

(A) Schematic diagram depicting the experimental design. (B) Representative FACS profiles of gating strategy showing the engraftments of transferred T cells and the proportions of GFP+ cells. The top-right panel was negative control for GFP gating.

https://doi.org/10.7554/eLife.29540.013
Figure 4 with 1 supplement
CRIg stabilizes Foxp3 expression in TGF−β induced iTreg cells.

(A) Experimental setting. (B) The fraction of Foxp3 positivity and the division of recultured iTreg cells. Left, representative FACS plots; right, the statistics of multiple experiments (n = 7). (C) The percentage of cells retaining Foxp3 expression in each cell division. (D) The MFI of Foxp3 protein in each generation of cell division. (E) The methylation percentage at each CpG motif in Foxp3 CNS2 of control iTreg (grey bars), or CRIg iTreg cells (black bars) (see Figure 4—source data 1) (F) In vitro differentiated iTreg cells were restimulated with anti-CD3/CD28, and various concentrations of IL-2, in the presence of CRIg-Ig, or control Ig. The fraction of cells retaining Foxp3 expression was analyzed after 3 days. (G) The expression of IL-2Rβ in control and CRIg iTreg cells after 3 days of culture. (H) The phosphorylation of STAT5 in control and CRIg iTreg cells. Data are representative of seven (B–D), two (E), and three (F–H) experiments, respectively. Student’s t-test was used. *p<0.05; **p<0.01; ***p<0.001.

https://doi.org/10.7554/eLife.29540.014
Figure 4—source data 1

The methylation percentage at each CpG motif in Foxp3 CNS2 of control iTreg cells, CRIg iTreg cells and ex vivo Treg cells (associated with Figure 4E).

https://doi.org/10.7554/eLife.29540.016
Figure 4—figure supplement 1
CRIg enhances iTreg suppressive function.

In an in vitro Treg suppression assay, responder T (Tresp) cells were labeled with CTV and cocultured with indicated ratios of control iTreg or CRIg-induced iTreg cells. The proliferation of responder T cells was analyzed after 3 days. Data are representative of three experiments.

https://doi.org/10.7554/eLife.29540.015
CRIg stabilizes adoptively transferred iTreg cells in vivo.

(A) Experimental design. (B, C) One week later, the transferred cells were isolated from spleen (B) and pancreatic islets (C) and were analyzed for the expression of Foxp3. Control iTreg cells, Thy1.1Thy1.2+; CRIg iTreg cells, Thy1.1Thy1.2-. Data are representative of two independent experiments with 9 mice in total. Student’s t-test was used. ***p<0.001.

https://doi.org/10.7554/eLife.29540.017
Figure 6 with 3 supplements
CRIg restores immune tolerance in pancreatic islets of NOD mice.

The ratios of Treg/Tconv cells, and Treg/CD8+ T cells in the pancreas (A) and panLNs (B) of control (n = 14) and CRIg-Ig/anti-CRIg treated mice (n = 16). The expression of Helios (C) and ICOS (D) in Treg cells from pancreatic islets of control (n = 7 in C, n=3 in D) and CRIg-Ig/anti-CRIg (labeled as CRIg/mAb in the figure panels, n = 8 in C, n=4 in D) treated mice. The production of IFN-γ (E) and IL-17 (F) in CD4+ Tconv cells from pancreatic islets in control Ig (n = 5) and CRIg-Ig/anti-CRIg (n = 6) treated mice. Data are representative of six (A, B), three (C), and two (D–F) experiments, respectively. Student’s t-test was used. n.s., non-significant; *p<0.05; **p<0.01; ***p<0.001.

https://doi.org/10.7554/eLife.29540.018
Figure 6—figure supplement 1
Cross-linking CRIg with anti-CRIg mAb enhances iTreg generation.

CD4GFP(Foxp3)- Tconv cells were sorted, labeled with CTV, and cultured in iTreg differentiation condition (anti-CD3/CD28, TGF-β and IL-2) with plate-bound control Ig or CRIg-Ig. Soluble isotype mAb or anti-CRIg mAb (17C9) was added. After 3 days, cultured cells were analyzed for their expression of Foxp3 (GFP) and the dilution of CTV. Data are representative of three experiments.

https://doi.org/10.7554/eLife.29540.019
Figure 6—figure supplement 2
Anti-CRIg mAb prolongs in vivo half-life of CRIg-Ig.

ELISA of serum CRIg-Ig concentrations at different time-points. 10-week-old NOD mice were treated with one-dose of CRIg-Ig (3.5 mg/kg), or CRIg-Ig (3.5mg/kg) plus anti-CRIg (clone 17C9, 7 mg/kg). Small amounts of blood were collected at various time-points post treatment. CRIg-Ig concentrations were measured by ELISA using different isotypes of anti-CRIg mAbs that recognized different epitopes of CRIg. Data are representative of three independent experiments. Student’s t-test was used. *p<0.05; **p<0.01.

https://doi.org/10.7554/eLife.29540.020
Figure 6—figure supplement 3
In vivo modulation of CRIg in NOD mice.

(A) anti-CRIg mAb treatment does not affect Treg cell abundance in NOD mice. 10-week-old prediabetic female NOD mice from the same litter were randomly grouped and i.p. injected with either control isotype mAb or anti-CRIg mAb twice a week for two weeks. Treg cells isolated from spleen, panLNs and pancreatic islets were analyzed. (B) The ratios of Treg cells to Tconv cells and Treg cells to CD8+ T cells in the spleen of control and CRIg-Ig/anti-CRIg treated mice. Data are representative of two (a) and six (b) experiments. Student’s t-test was used. n.s., non-significant.

https://doi.org/10.7554/eLife.29540.021
Figure 7 with 1 supplement
The expression of CRIg in TRMs is influenced by environmental factors.

(A) The expression of CRIg in liver Kupffer cells of adult (7 weeks of age) and neonatal (day one post birth) B6 mice. Green, F4/80; Red, CRIg. (B) The expression of CRIg in pancreatic islets of adult (10 weeks of age) and neonatal (day seven post birth) NOD mice. Green, F4/80; Red, CRIg. (C) Longitudinal analysis of CRIg expression in peritoneal F4/80hi TRMs of NOD mice. Red: females; Blue, males. Dotted green line depicts the time of weaning. (D–F) The percentages and the MFI of CRIg expression in TRMs from peritoneal cavity (D), pancreatic islets (E) and colon (F) of control and antibiotics treated B6 mice, respectively. (G) The expression of retinoic acid receptors in CRIg+ and CRIg- TRMs isolated from peritoneal cavity of 7 weeks old B6 mice. (H) CRIg+ macrophages were isolated from peritoneal cavity and cultured in vitro in the presence or absence of ATRA. The expression of CRIg in cultured cells were analyzed 3 days later. blue line, no ATRA; red line, with ATRA. (I, J) In vivo treatment of 7 weeks old B6 mice with an inverse pan-RA agonist BMS 493 to block RA signaling. The expression of CRIg in TRMs from peritoneal cavity (I) and pancreatic islets (J) was analyzed 3 days later. Data are representative of three (A, B, D–J), and more than five (C) experiments, respectively. Student’s t-test was used. n.s., non-significant; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. w/o, without.

https://doi.org/10.7554/eLife.29540.022
Figure 7—figure supplement 1
RA signaling is involved in CRIg expression in TRMs.

(A) Longitudinal analysis of CRIg expression in peritoneal resting TRMs from B6 mice. circle: females; square, males. Dotted green line depicts the time of weaning. (B) CRIg- peritoneal resting macrophages were sorted and cultured in vitro with ATRA and the expression of CRIg was analyzed after 3 days. blue line, no ATRA; red line, with ATRA. (C) CRIg+ macrophages (3 × 104) were sorted from peritoneal cavity of CD45.1+ B6 mice and transferred into 7 weeks old B6 mice. The recipient mice were treated with control PBS or an inverse pan-RA agonist BMS 493 to block RA signaling. The expression of CRIg was analyzed 3 days later. Blue, BMS 493; Red, DMSO.

https://doi.org/10.7554/eLife.29540.023

Tables

Key resources table
Reagent type
(species)
or resources
DesignationSource or referenceIdentifiersAdditional information
strain, strain background (Mus musculus)C57BL/6 (B6) mice The Jackson
Laboratory
RRID:IMSR_JAX:000664
strain, strain background (Mus musculus)NOD miceMathis-Benoist
laboratory
RRID:IMSR_JAX:001976
strain, strain background (Mus musculus)NOD/Foxp3GFP miceThe Jackson
Laboratory
RRID:IMSR_JAX:025097
strain, strain background (Mus musculus)B6/CD45.1 miceDr. Li-Fan Lu, UCSDRRID:IMSR_JAX:002014
strain, strain background (Mus musculus)NOD/BDC2.5
/Thy1.1 mice
Mathis-Benoist
laboratory
strain, strain background (Mus musculus)NOD/BDC2.5
/Foxp3GFP
/Thy1.1 mice
this paperNOD/BDC2.5/Foxp3GFP/
Thy1.1 mice were generated by crossing
NOD/BDC2.5/Thy1.1 mice to NOD/
Foxp3GFP mice.
strain, strain background (Mus musculus)NOD/BDC2.5
/Foxp3GFP
/Thy1.1/Thy1.2 mice
this paperNOD/BDC2.5/Foxp3GFP/
Thy1.1/Thy1.2
mice were generated by crossing
NOD/BDC2.5/Thy1.1 mice to NOD/Foxp3GFP mice.
strain, strain background (Mus musculus)B6/CRIg KO miceGenentechPMID: 16530040
strain, strain background (Mus musculus)NOD/CRIg KO micethis paperNOD/CRIg-/- mice were
generated by crossing B6/CRIg-/-
mice onto a NOD background for more
than 10 generations.
biological sample (Mus musculus)pancreasotherprepared from NOD mice
biological sample (Mus musculus)colon lamina
propria
otherprepared from
NOD orB6 mice
biological sample (Mus musculus)peritoneal
cavity cells
otherprepared from
NOD or B6 mice
biological sample (Mus musculus)lungotherprepared from NOD or B6 mice
biological sample (Mus musculus)liverotherprepared from NOD or B6 mice
biological sample (Mus musculus)serumotherprepared from
NOD mice
biological sample (Mus musculus)panLNsotherpancreatic
draining lymph
nodes from NOD mice
biological sample (Mus musculus)ILNsotherInguinal
lymph nodes from
NOD or B6 mice
biological sample (Mus musculus)spleenotherprepared from
NOD or B6 mice
biological sample (Mus musculus)macrophagesotherdefined as F4/80+
or F4/80+ CD11b+ cells
biological sample (Mus musculus)Treg cellsotherdefined as CD4+
Foxp3+ T cells
biological sample (Mus musculus)Tconv cellsotherdefined as CD4+
Foxp3- T cells
antibodyUltra-LEAF Purified
anti-mouse CD3ε (Armenian hamster
monoclonal)
BioLegendRRID:AB_11149115clone: 145–2C11
antibodyUltra-LEAF Purified
anti-mouse CD28 (Syrian hamster
monoclonal)
BioLegendRRID:AB_11150408clone: 37.51
antibodyanti-gp120
(mouse monoclonal)
Genentechcontrol Ig in this paper PMID: 16530040
antibodyanti-CRIg
Genentechclone: 14G8 (mouse monoclonal;
PMID: 19017980);
clone: 17C9 (rat monoclonal;
PMID: 16530040)
antibodyanti-TGF-β 1, 2, 3
(mouse monoclonal)
R and D SystemsRRID:AB_357931clone: 1D11
antibodyanti-CD16/CD32
(rat SD
monoclonal)
BD BiosciencesRRID:AB_394656clone: 2.4G2
antibodyanti-CRIg
(mouse monoclonal)
this paperBiotinylated anti-CRIg (clone: 14G8) prepared
by our laboratory
antibodyanti-CD45
(rat monoclonal)
BioLegendRRID:AB_312981clone: 30-F11
antibodyanti-CD45.1
(mouse monoclonal)
BioLegendRRID:AB_893346clone: A20
antibodyanti-CD45.2
(mouse monoclonal)
BioLegendRRID:AB_389211clone: 104
antibodyanti-TCRβ
(Armenian hamster
monoclonal)
BioLegendRRID:AB_493344clone: H57-597
antibodyanti-CD4
(rat monoclonal)
BioLegendRRID:AB_312719; RRID:AB_312713; RRID:AB_312715clone: RM4-5
antibodyanti-CD8α
(rat monoclonal)
BioLegendRRID:AB_312747; RRID:AB_312761clone: 53–6.7
antibodyanti-Thy1.1
(mouse monoclonal)
BioLegendRRID:AB_961437clone: OX-7
antibodyanti-Thy1.2
(rat monoclonal)
BioLegendRRID:AB_492888clone: 30-H12
antibodyanti-Helios (Armenian hamster monoclonal)BioLegendRRID:AB_10660749clone: 22F6
antibodyanti-ICOS (rat monoclonal)ebioscienceRRID:AB_2573563clone: 7E.17G9
antibodyanti-CD122 (rat monoclonal)BioLegendRRID:AB_313226clone: 5H4
antibodyanti-CD25 (rat monoclonal)BioLegendRRID:AB_312857; RRID:AB_312865clone: PC61
antibodyanti-CD69 (Armenian hamster monoclonal)BioLegendRRID:AB_2260065clone: H1.2F3
antibodyanti-CDF4/80 (rat monoclonal)BioLegendRRID:AB_893481clone: BM8
antibodyanti-CD11b (rat monoclonal)BioLegendRRID:AB_312791; RRID:AB_755986clone: M1/70
antibodyanti-CD11c (Armenian hamster monoclonal)BioLegendRRID:AB_313777clone: N418
antibodyanti-CD19 (rat monoclonal)BioLegendRRID:AB_313643clone: 6D5
antibodyanti-NKp46 (rat monoclonal)BioLegendRRID:AB_2235755clone: 29A1.4
antibodyanti-IL-17 (rat monoclonal)BioLegendRRID:AB_536018clone: TC11-18H10.1
antibodyanti-IFN-γ
(rat monoclonal)
BioLegendRRID:AB_315402clone: XMG1.2
antibodyanti-Foxp3
(rat monoclonal)
ebioscienceRRID:AB_1518812clone: FJK-16s
antibodyanti-phospho
ZAP70/SykTyr319/Tyr352 (mouse monoclonal)
ebioscienceRRID:AB_2572664clone: n3kobu5
antibodyanti-phospho
ERK1/2Thr202/Tyr204 (mouse monoclonal)
BioLegendRRID:AB_2629710clone: 6B8B69
antibodyanti-phospho AKT1Ser473 (mouse monoclonal)ebioscienceRRID:AB_2573309clone: SDRNR
antibodyanti-phospho
S6Ser235, Ser236 (mouse monoclonal)
ebioscienceRRID:AB_2572666clone: cupk43k
antibodyanti-phospho STAT5 (mouse monoclonal)BD BiosciencesRRID:AB_10894188clone: 47/Stat5(pY694)
antibodyanti-phospho Smad2 (pS465/pS467)/
Smad3 (pS423/pS425) (mouse monoclonal)
BD BiosciencesRRID:AB_2716578clone: O72-670
antibodyPerCP/Cy5.5-streptavidinBioLegendRRID:AB_2716577
recombinant DNA reagentpCR 2.1-TOPO (vector)InvitrogenCAT#: K204040
sequence-based reagentFoxp3 Intron1Eton BioscienceForward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC
sequence-based reagentFoxp3 TSDREton BioscienceForward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA
sequence-based reagentRaraEton BioscienceForward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG
sequence-based reagentRarbEton BioscienceForward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG
sequence-based reagentRargEton BioscienceForward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG
sequence-based reagentOligo(dT)12-18 PrimerInvitrogenCAT#: 18418012
peptide, recombinant proteinCRIg-IgGenentechPMID: 16530040
peptide, recombinant proteinBiotinylated CRIg-Igthis paperprepared by our
laboratory
peptide, recombinant proteincontrol IgGenentechPMID: 16530040
peptide, recombinant proteinBiotinylated
control Ig
this paperprepared by our laboratory
peptide, recombinant proteinCTLA-4 IgR and D SystemsCAT#: 434-CT-200/CF
peptide, recombinant proteinPD-1 IgR and D SystemsCAT#: 1021-PD-100
peptide, recombinant proteinVISTA IgR and D SystemsCAT#: 7005-B7-050
peptide, recombinant proteinCD226 IgR and D SystemsCAT#: 4436-DN-050
peptide, recombinant proteinTIGIT IgR and D SystemsCAT#: 7267-TG-050
peptide, recombinant proteinBDC2.5 mimotopeAnaSpecCAT#: AS-63774Sequence: RTRPLWVRME
peptide, recombinant proteinRecombinant
Murine IL-2
PeproTechCAT#: 212–12
peptide, recombinant proteinRecombinant Human
TGF-β1
PeproTechCAT#: 100–21
commercial assay or kitACK lysing bufferLonzaCAT#: 10-548E
commercial assay or kitAnti-PE microBeadsMiltenyi BiotecCAT#: 130-048-801
commercial assay or kitLIVE/DEAD fixable
dead cell stain kits
InvitrogenCAT#: L34972; CAT#: L34966
commercial assay or kitFoxp3/Transcription
factorstaining buffer set
ebioscienceCAT#: 00-5523-00
commercial assay or kitPhosflow
Lyse/Fix buffer
BD BiosciencesCAT#: 558049
commercial assay or kitPhosflow
Perm buffer III
BD BiosciencesCAT#: 558050
commercial assay or kitPercollGE Healthcare Life ScienceCAT#: 17-0891-01
commercial assay or kitNucleoSpin
Tissue XS
Macherey-NagelCAT#: 740901.50
commercial assay or kitEZ DNA
Methylaiton Kit
Zymo ResearchCAT#: D5001
commercial assay or kitHotStarTaq
DNA Polymerase
QIAGENCAT#: 203203
commercial assay or kitTOPO TA Cloning KitInvitrogenCAT#: K204040
commercial assay or kitTRIzol ReagentInvitrogenCAT#: 15596026
commercial assay or kitSuperScript III
Reverse Transcriptase
InvitrogenCAT#: 18080044
commercial assay or kitSYBR Green
PCR Master Mix
Applied BiosystemsCAT#: 4309155
chemical compound, drugCollagenase PRocheCAT#: 11249002001
chemical compound, drugCollagenase DRocheCAT#: 11088882001
chemical compound, drugDNase ISigma-AldrichCAT#: DN25-1G
chemical compound, drugATRASigma-AldrichCAT#: R2625-50MG
chemical compound, drugBMS 493Sigma-AldrichCAT#: B6688-5MG
chemical compound, drugVancomycinAcros OrganicsCAT#: 296990010
chemical compound, drugMetronidazoleAcros OrganicsCAT#: 210340050
chemical compound, drugNeomycinFisher ScientificCAT#: BP266925
chemical compound, drugAmpicillinSigma-AldrichCAT#: A0166-25G
chemical compound, drugPMASigma-AldrichCAT#: P1585-1MG
chemical compound, drugIonomycinSigma-AldrichCAT#: I0634-1MG
chemical compound, drugBrefeldin A solutionBioLegendCAT#: 420601
chemical compound, drugFisher Healthcare
Tissue-Plus O.C.T Compound
Fisher ScientificCAT#: 23-730-571
chemical compound, drugAvidin, HRP conjugateInvitrogenCAT#: 434423
chemical compound, drug1-Step Ultra TMB-ELISA
Substrate Solution
Thermo ScientificCAT#: 34028
chemical compound, drugStop Solution for
TMB Substrates
Thermo ScientificCAT#: N600
chemical compound, drugDAPIInvitrogenCAT#: D1306
software, algorithmFlowJoFlowJo, LLCRRID:SCR_008520
software, algorithmImageJNIHRRID:SCR_003070
software, algorithmBISMA softwareotherRRID:SCR_000688public website, BDPC DNA methylation analysis platform

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)