Figures and data in CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells

Version of Record: December 13, 2017
Accepted Manuscript: November 24, 2017

Download
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
- Article PDF
- Figures PDF
Open citations (links to open the citations from this article in various online reference manager services)
- Mendeley
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Xiaomei Yuan

Bi-Huei Yang

Yi Dong

Asami Yamamura

Wenxian Fu

(2017)
CRIg, a tissue-resident macrophage specific immune checkpoint molecule, promotes immunological tolerance in NOD mice, via a dual role in effector and regulatory T cells

eLife 6:e29540.

https://doi.org/10.7554/eLife.29540
- Download BibTeX
- Download .RIS
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Figures
Tables
Additional files

8 figures, 1 table and 1 additional file

Figures

Figure 1 with 3 supplements

Download asset Open asset

CRIg⁺TRMs form a protective barrier to prevent tissue autoimmune infiltration and activation.

(A) The distribution of CRIg⁺ TRMs within the pancreas. Immunostaining of pancreatic frozen sections of 10-week-old NOD mice. (left) Representative images depicting an intact (upper) and an …
https://doi.org/10.7554/eLife.29540.002

Figure 1—figure supplement 1

Download asset Open asset

Tissue-distribution of CRIg⁺ TRMs.

(A) Immunostaining for CRIg on frozen sections of the pancreas, liver, small and large intestines and lung from 7-week-old B6 mice. lower panel: second Ab only. LP, lamina propria. Bar: 50 um. (B) …
https://doi.org/10.7554/eLife.29540.003

Figure 1—figure supplement 2

Download asset Open asset

CRIg deficiency does not affect T cells in lymphoid organs.

(A) The percentages of Treg cells in age-matched wildtype and CRIg KO mice (mixed of both females and males) in spleen and pancreatic draining LNs (panLNs). (B) The ratios between Treg cells and CD8⁺…
https://doi.org/10.7554/eLife.29540.004

Figure 1—figure supplement 3

Download asset Open asset

Cell-cell contact between CRIg⁺TRMs and T cells in pancreas.

(A) Cell-cell contact between CRIg⁺ macrophages (green) and islet-infiltrating CD4 T cells (red). Arrowheads, CD4⁺ T cells; long arrows, CRIg⁺ TRMs. Bar, 50 um.

https://doi.org/10.7554/eLife.29540.005

Figure 2 with 4 supplements

Download asset Open asset

CRIg suppresses T cell activation.

(A) CFSE-labeled CD4⁺ CD25^- Tconv cells were stimulated with anti-CD3/CD28. Plate-bound CRIg-Ig, or control Ig, was added either all time during T cell culture (3 d), or only the first 24 hr, or the …
https://doi.org/10.7554/eLife.29540.006

Figure 2—figure supplement 1

Download asset Open asset

The suppressive effect of CRIg on T cells is complement-independent.

(A) CFSE-labeled CD4⁺ Foxp3(GFP)^-Tconv cells were stimulated with anti-CD3/CD28, in the presence of plate-coated control Ig, or CRIg-Ig. Soluble anti-CRIg mAb (clone 14G8) was added. T cell …
https://doi.org/10.7554/eLife.29540.007

Figure 2—figure supplement 2

Download asset Open asset

Plate-bound anti-CRIg mAb augments the effect of CRIg-Ig in T cells.

CTV-labeled CD4⁺ Foxp3(GFP)^- Tconv cells were stimulated with anti-CD3/CD28, in the presence of plate-coated isotype-matched control mAb, or anti-CRIg-Ig (17C9) (with various concentrations as …
https://doi.org/10.7554/eLife.29540.008

Figure 2—figure supplement 3

Download asset Open asset

The binding of CRIg to activated Treg cells and differential suppression of CRIg-Ig for Tconv and Treg cells.

(A) CD4⁺ CD25⁺ Treg cells were activated in vitro by anti-CD3/CD28 for various lengths of time (12 hr, 24 hr and 72 hr). At each time-point of activation, various concentrations of biotinylated …
https://doi.org/10.7554/eLife.29540.009

Figure 2—figure supplement 4

Download asset Open asset

Ig fusion proteins of CTLA4, PD-1, VISTA, CD226 and TIGIT do not abolish the suppression of CRIg-Ig in T cells.

CTV-labeled CD4⁺ Foxp3(GFP)^- Tconv cells were stimulated with anti-CD3/CD28, in the presence of plate-coated control Ig, or CRIg-Ig (5 ug/ml). Soluble Ig fusion proteins for CTLA-4, PD-1, VISTA, …
https://doi.org/10.7554/eLife.29540.010

Figure 3 with 2 supplements

Download asset Open asset

CRIg promotes iTreg generation in vitro.

(A) (left) Representative FACS plots depicting the generation of iTreg cells in the presence of CRIg-Ig, or control Ig, under various concentrations of TGF-β. (right) Statistics of multiple …
https://doi.org/10.7554/eLife.29540.011

Figure 3—figure supplement 1

Download asset Open asset

CRIg-Ig does not enhance TGF-β induced phosphorylation of Smad2/3.

CD4⁺ CD25^- cells were sorted and cultured with 0.2% of fetal bovine serum under iTreg differentiation condition. Phosphorylation of Smad2/3 was detected 2 hr after TGF-β stimulation by flow …
https://doi.org/10.7554/eLife.29540.012

Figure 3—figure supplement 2

Download asset Open asset

Experimental design and FACS profiles of in vivo pTreg generation promoted by CRIg-Ig.

(A) Schematic diagram depicting the experimental design. (B) Representative FACS profiles of gating strategy showing the engraftments of transferred T cells and the proportions of GFP⁺ cells. The …
https://doi.org/10.7554/eLife.29540.013

Figure 4 with 1 supplement

Download asset Open asset

CRIg stabilizes Foxp3 expression in TGF−β induced iTreg cells.

(A) Experimental setting. (B) The fraction of Foxp3 positivity and the division of recultured iTreg cells. Left, representative FACS plots; right, the statistics of multiple experiments (n = 7). (C) …
https://doi.org/10.7554/eLife.29540.014

Figure 4—source data 1 The methylation percentage at each CpG motif in Foxp3 CNS2 of control iTreg cells, CRIg iTreg cells and ex vivo Treg cells (associated with Figure 4E).: https://doi.org/10.7554/eLife.29540.016
Download elife-29540-fig4-data1-v2.xlsx

Figure 4—figure supplement 1

Download asset Open asset

CRIg enhances iTreg suppressive function.

In an in vitro Treg suppression assay, responder T (Tresp) cells were labeled with CTV and cocultured with indicated ratios of control iTreg or CRIg-induced iTreg cells. The proliferation of …
https://doi.org/10.7554/eLife.29540.015

Figure 5

Download asset Open asset

CRIg stabilizes adoptively transferred iTreg cells in vivo.

(A) Experimental design. (**B, C**) One week later, the transferred cells were isolated from spleen (B) and pancreatic islets (C) and were analyzed for the expression of Foxp3. Control iTreg cells, …
https://doi.org/10.7554/eLife.29540.017

Figure 6 with 3 supplements

Download asset Open asset

CRIg restores immune tolerance in pancreatic islets of NOD mice.

The ratios of Treg/Tconv cells, and Treg/CD8⁺ T cells in the pancreas (A) and panLNs (B) of control (n = 14) and CRIg-Ig/anti-CRIg treated mice (n = 16). The expression of Helios (C) and ICOS (D) in …
https://doi.org/10.7554/eLife.29540.018

Figure 6—figure supplement 1

Download asset Open asset

Cross-linking CRIg with anti-CRIg mAb enhances iTreg generation.

CD4⁺GFP(Foxp3)^- Tconv cells were sorted, labeled with CTV, and cultured in iTreg differentiation condition (anti-CD3/CD28, TGF-β and IL-2) with plate-bound control Ig or CRIg-Ig. Soluble isotype …
https://doi.org/10.7554/eLife.29540.019

Figure 6—figure supplement 2

Download asset Open asset

Anti-CRIg mAb prolongs in vivo half-life of CRIg-Ig.

ELISA of serum CRIg-Ig concentrations at different time-points. 10-week-old NOD mice were treated with one-dose of CRIg-Ig (3.5 mg/kg), or CRIg-Ig (3.5mg/kg) plus anti-CRIg (clone 17C9, 7 mg/kg). …
https://doi.org/10.7554/eLife.29540.020

Figure 6—figure supplement 3

Download asset Open asset

In vivo modulation of CRIg in NOD mice.

(A) anti-CRIg mAb treatment does not affect Treg cell abundance in NOD mice. 10-week-old prediabetic female NOD mice from the same litter were randomly grouped and i.p. injected with either control …
https://doi.org/10.7554/eLife.29540.021

Figure 7 with 1 supplement

Download asset Open asset

The expression of CRIg in TRMs is influenced by environmental factors.

(A) The expression of CRIg in liver Kupffer cells of adult (7 weeks of age) and neonatal (day one post birth) B6 mice. Green, F4/80; Red, CRIg. (B) The expression of CRIg in pancreatic islets of …
https://doi.org/10.7554/eLife.29540.022

Figure 7—figure supplement 1

Download asset Open asset

RA signaling is involved in CRIg expression in TRMs.

(A) Longitudinal analysis of CRIg expression in peritoneal resting TRMs from B6 mice. circle: females; square, males. Dotted green line depicts the time of weaning. (B) CRIg^- peritoneal resting …
https://doi.org/10.7554/eLife.29540.023

Author response image 1

Download asset Open asset

Tables

Key resources table

Reagent type (species) or resources	Designation	Source or reference	Identifiers	Additional information
strain, strain background (Mus musculus)	C57BL/6 (B6) mice	The Jackson Laboratory	RRID:IMSR_JAX:000664
strain, strain background (Mus musculus)	NOD mice	Mathis-Benoist laboratory	RRID:IMSR_JAX:001976
strain, strain background (Mus musculus)	NOD/Foxp3^GFPmice	The Jackson Laboratory	RRID:IMSR_JAX:025097
strain, strain background (Mus musculus)	B6/CD45.1 mice	Dr. Li-Fan Lu, UCSD	RRID:IMSR_JAX:002014
strain, strain background (Mus musculus)	NOD/BDC2.5 /Thy1.1 mice	Mathis-Benoist laboratory
strain, strain background (Mus musculus)	NOD/BDC2.5 /Foxp3^GFP /Thy1.1 mice	this paper		NOD/BDC2.5/Foxp3^GFP/ Thy1.1 mice were generated by crossing NOD/BDC2.5/Thy1.1 mice to NOD/ Foxp3^GFP mice.
strain, strain background (Mus musculus)	NOD/BDC2.5 /Foxp3^GFP /Thy1.1/Thy1.2 mice	this paper		NOD/BDC2.5/Foxp3^GFP/ Thy1.1/Thy1.2 mice were generated by crossing NOD/BDC2.5/Thy1.1 mice to NOD/Foxp3^GFP mice.
strain, strain background (Mus musculus)	B6/CRIg KO mice	Genentech		PMID: 16530040
strain, strain background (Mus musculus)	NOD/CRIg KO mice	this paper		NOD/CRIg^-/- mice were generated by crossing B6/CRIg^-/- mice onto a NOD background for more than 10 generations.
biological sample (Mus musculus)	pancreas	other		prepared from NOD mice
biological sample (Mus musculus)	colon lamina propria	other		prepared from NOD orB6 mice
biological sample (Mus musculus)	peritoneal cavity cells	other		prepared from NOD or B6 mice
biological sample (Mus musculus)	lung	other		prepared from NOD or B6 mice
biological sample (Mus musculus)	liver	other		prepared from NOD or B6 mice
biological sample (Mus musculus)	serum	other		prepared from NOD mice
biological sample (Mus musculus)	panLNs	other		pancreatic draining lymph nodes from NOD mice
biological sample (Mus musculus)	ILNs	other		Inguinal lymph nodes from NOD or B6 mice
biological sample (Mus musculus)	spleen	other		prepared from NOD or B6 mice
biological sample (Mus musculus)	macrophages	other		defined as F4/80⁺ or F4/80⁺ CD11b⁺ cells
biological sample (Mus musculus)	Treg cells	other		defined as CD4⁺ Foxp3⁺ T cells
biological sample (Mus musculus)	Tconv cells	other		defined as CD4⁺ Foxp3^- T cells
antibody	Ultra-LEAF Purified anti-mouse CD3ε (Armenian hamster monoclonal)	BioLegend	RRID:AB_11149115	clone: 145–2C11
antibody	Ultra-LEAF Purified anti-mouse CD28 (Syrian hamster monoclonal)	BioLegend	RRID:AB_11150408	clone: 37.51
antibody	anti-gp120 (mouse monoclonal)	Genentech		control Ig in this paper PMID: 16530040
antibody	anti-CRIg	Genentech		clone: 14G8 (mouse monoclonal; PMID: 19017980); clone: 17C9 (rat monoclonal; PMID: 16530040)
antibody	anti-TGF-β 1, 2, 3 (mouse monoclonal)	R and D Systems	RRID:AB_357931	clone: 1D11
antibody	anti-CD16/CD32 (rat SD monoclonal)	BD Biosciences	RRID:AB_394656	clone: 2.4G2
antibody	anti-CRIg (mouse monoclonal)	this paper		Biotinylated anti-CRIg (clone: 14G8) prepared by our laboratory
antibody	anti-CD45 (rat monoclonal)	BioLegend	RRID:AB_312981	clone: 30-F11
antibody	anti-CD45.1 (mouse monoclonal)	BioLegend	RRID:AB_893346	clone: A20
antibody	anti-CD45.2 (mouse monoclonal)	BioLegend	RRID:AB_389211	clone: 104
antibody	anti-TCRβ (Armenian hamster monoclonal)	BioLegend	RRID:AB_493344	clone: H57-597
antibody	anti-CD4 (rat monoclonal)	BioLegend	RRID:AB_312719; RRID:AB_312713; RRID:AB_312715	clone: RM4-5
antibody	anti-CD8α (rat monoclonal)	BioLegend	RRID:AB_312747; RRID:AB_312761	clone: 53–6.7
antibody	anti-Thy1.1 (mouse monoclonal)	BioLegend	RRID:AB_961437	clone: OX-7
antibody	anti-Thy1.2 (rat monoclonal)	BioLegend	RRID:AB_492888	clone: 30-H12
antibody	anti-Helios (Armenian hamster monoclonal)	BioLegend	RRID:AB_10660749	clone: 22F6
antibody	anti-ICOS (rat monoclonal)	ebioscience	RRID:AB_2573563	clone: 7E.17G9
antibody	anti-CD122 (rat monoclonal)	BioLegend	RRID:AB_313226	clone: 5H4
antibody	anti-CD25 (rat monoclonal)	BioLegend	RRID:AB_312857; RRID:AB_312865	clone: PC61
antibody	anti-CD69 (Armenian hamster monoclonal)	BioLegend	RRID:AB_2260065	clone: H1.2F3
antibody	anti-CDF4/80 (rat monoclonal)	BioLegend	RRID:AB_893481	clone: BM8
antibody	anti-CD11b (rat monoclonal)	BioLegend	RRID:AB_312791; RRID:AB_755986	clone: M1/70
antibody	anti-CD11c (Armenian hamster monoclonal)	BioLegend	RRID:AB_313777	clone: N418
antibody	anti-CD19 (rat monoclonal)	BioLegend	RRID:AB_313643	clone: 6D5
antibody	anti-NKp46 (rat monoclonal)	BioLegend	RRID:AB_2235755	clone: 29A1.4
antibody	anti-IL-17 (rat monoclonal)	BioLegend	RRID:AB_536018	clone: TC11-18H10.1
antibody	anti-IFN-γ (rat monoclonal)	BioLegend	RRID:AB_315402	clone: XMG1.2
antibody	anti-Foxp3 (rat monoclonal)	ebioscience	RRID:AB_1518812	clone: FJK-16s
antibody	anti-phospho ZAP70/Syk^{Tyr319/Tyr352} (mouse monoclonal)	ebioscience	RRID:AB_2572664	clone: n3kobu5
antibody	anti-phospho ERK1/2^{Thr202/Tyr204} (mouse monoclonal)	BioLegend	RRID:AB_2629710	clone: 6B8B69
antibody	anti-phospho AKT1^Ser473 (mouse monoclonal)	ebioscience	RRID:AB_2573309	clone: SDRNR
antibody	anti-phospho S6^{Ser235, Ser236} (mouse monoclonal)	ebioscience	RRID:AB_2572666	clone: cupk43k
antibody	anti-phospho STAT5 (mouse monoclonal)	BD Biosciences	RRID:AB_10894188	clone: 47/Stat5(pY694)
antibody	anti-phospho Smad2 (pS465/pS467)/ Smad3 (pS423/pS425) (mouse monoclonal)	BD Biosciences	RRID:AB_2716578	clone: O72-670
antibody	PerCP/Cy5.5-streptavidin	BioLegend	RRID:AB_2716577
recombinant DNA reagent	pCR 2.1-TOPO (vector)	Invitrogen	CAT#: K204040
sequence-based reagent	Foxp3 Intron1	Eton Bioscience		Forward: ATTTGAATTGGATATGGTTTGT; Reverse: AACCTTAAACCCCTCTAACATC
sequence-based reagent	Foxp3 TSDR	Eton Bioscience		Forward: GTTTGTGTTTTTGAGATTTTAAAAT; Reverse: AACCAACTTCCTACACTATCTATTA
sequence-based reagent	Rara	Eton Bioscience		Forward: CCAGTCAGTGGTTACAGCACA; Reverse: TAGTGGTAGCCGGATGATTTG
sequence-based reagent	Rarb	Eton Bioscience		Forward: ACATGATCTACACTTGCCATCG; Reverse: TGAAGGCTCCTTCTTTTTCTTG
sequence-based reagent	Rarg	Eton Bioscience		Forward: CATTTGAGATGCTGAGCCCTA; Reverse: GCTTATAGACCCGAGGAGGTG
sequence-based reagent	Oligo(dT)_12-18 Primer	Invitrogen	CAT#: 18418012
peptide, recombinant protein	CRIg-Ig	Genentech		PMID: 16530040
peptide, recombinant protein	Biotinylated CRIg-Ig	this paper		prepared by our laboratory
peptide, recombinant protein	control Ig	Genentech		PMID: 16530040
peptide, recombinant protein	Biotinylated control Ig	this paper		prepared by our laboratory
peptide, recombinant protein	CTLA-4 Ig	R and D Systems	CAT#: 434-CT-200/CF
peptide, recombinant protein	PD-1 Ig	R and D Systems	CAT#: 1021-PD-100
peptide, recombinant protein	VISTA Ig	R and D Systems	CAT#: 7005-B7-050
peptide, recombinant protein	CD226 Ig	R and D Systems	CAT#: 4436-DN-050
peptide, recombinant protein	TIGIT Ig	R and D Systems	CAT#: 7267-TG-050
peptide, recombinant protein	BDC2.5 mimotope	AnaSpec	CAT#: AS-63774	Sequence: RTRPLWVRME
peptide, recombinant protein	Recombinant Murine IL-2	PeproTech	CAT#: 212–12
peptide, recombinant protein	Recombinant Human TGF-β1	PeproTech	CAT#: 100–21
commercial assay or kit	ACK lysing buffer	Lonza	CAT#: 10-548E
commercial assay or kit	Anti-PE microBeads	Miltenyi Biotec	CAT#: 130-048-801
commercial assay or kit	LIVE/DEAD fixable dead cell stain kits	Invitrogen	CAT#: L34972; CAT#: L34966
commercial assay or kit	Foxp3/Transcription factorstaining buffer set	ebioscience	CAT#: 00-5523-00
commercial assay or kit	Phosflow Lyse/Fix buffer	BD Biosciences	CAT#: 558049
commercial assay or kit	Phosflow Perm buffer III	BD Biosciences	CAT#: 558050
commercial assay or kit	Percoll	GE Healthcare Life Science	CAT#: 17-0891-01
commercial assay or kit	NucleoSpin Tissue XS	Macherey-Nagel	CAT#: 740901.50
commercial assay or kit	EZ DNA Methylaiton Kit	Zymo Research	CAT#: D5001
commercial assay or kit	HotStarTaq DNA Polymerase	QIAGEN	CAT#: 203203
commercial assay or kit	TOPO TA Cloning Kit	Invitrogen	CAT#: K204040
commercial assay or kit	TRIzol Reagent	Invitrogen	CAT#: 15596026
commercial assay or kit	SuperScript III Reverse Transcriptase	Invitrogen	CAT#: 18080044
commercial assay or kit	SYBR Green PCR Master Mix	Applied Biosystems	CAT#: 4309155
chemical compound, drug	Collagenase P	Roche	CAT#: 11249002001
chemical compound, drug	Collagenase D	Roche	CAT#: 11088882001
chemical compound, drug	DNase I	Sigma-Aldrich	CAT#: DN25-1G
chemical compound, drug	ATRA	Sigma-Aldrich	CAT#: R2625-50MG
chemical compound, drug	BMS 493	Sigma-Aldrich	CAT#: B6688-5MG
chemical compound, drug	Vancomycin	Acros Organics	CAT#: 296990010
chemical compound, drug	Metronidazole	Acros Organics	CAT#: 210340050
chemical compound, drug	Neomycin	Fisher Scientific	CAT#: BP266925
chemical compound, drug	Ampicillin	Sigma-Aldrich	CAT#: A0166-25G
chemical compound, drug	PMA	Sigma-Aldrich	CAT#: P1585-1MG
chemical compound, drug	Ionomycin	Sigma-Aldrich	CAT#: I0634-1MG
chemical compound, drug	Brefeldin A solution	BioLegend	CAT#: 420601
chemical compound, drug	Fisher Healthcare Tissue-Plus O.C.T Compound	Fisher Scientific	CAT#: 23-730-571
chemical compound, drug	Avidin, HRP conjugate	Invitrogen	CAT#: 434423
chemical compound, drug	1-Step Ultra TMB-ELISA Substrate Solution	Thermo Scientific	CAT#: 34028
chemical compound, drug	Stop Solution for TMB Substrates	Thermo Scientific	CAT#: N600
chemical compound, drug	DAPI	Invitrogen	CAT#: D1306
software, algorithm	FlowJo	FlowJo, LLC	RRID:SCR_008520
software, algorithm	ImageJ	NIH	RRID:SCR_003070
software, algorithm	BISMA software	other	RRID:SCR_000688	public website, BDPC DNA methylation analysis platform