GIPC proteins negatively modulate Plexind1 signaling during vascular development
- New York University Langone Medical Center, United States
- New York University School of Medicine, United States
Figures
Figure 1
PLXND1’s C-terminal GBM and GIPC's GH1 and PDZ domains are the key molecular determinants of the PLXND1-GIPC interaction.
(A) Diagrams of the wild-type (WT) and truncated V5-tagged (red) forms of the cytosolic tail of murine PLXND1 (V5-C-mPLXND1) used for co-immunoprecipitation experiments. Color-coding is used to …
Figure 2 with 2 supplements
The plxnd1skt6 allele encodes a functional Plxnd1 receptor putatively impaired in GIPC binding, and its homozygosity induces angiogenesis deficits with low frequency.
(A, B) Diagrams of the cytosolic tails of the zebrafish Plxnd1 proteins encoded by the WT (A) and plxnd1skt6 mutant (B) alleles including their C-terminal amino acid sequences. Color-coding is used …
Figure 2—figure supplement 1
Penetrance and expressivity of Se-DLAV truncations in plxnd1skt6 mutants at 32 hpf.
(A) Penetrance bar graph. Percentage of embryos of the indicated genotypes with Se-DLAV truncations (gray; a summation of the ‘minimal,’ ‘moderate,’ and ‘maximal’ categories) and with non-truncated …
Figure 2—figure supplement 2
A Plxnd1 form deficient in GIPC binding because of deletion of the receptor’s GBM (Plxnd1ΔGBM) is active in vivo.
(A, B) Diagrams of the GAL4-responsive constructs used for forced endothelial expression in plxnd1fov01b; Tg(fli1a:GAL4FF)ubs4; Tg(flt1:nls-mCherry)skt7 embryos. (A) Construct for expression of the …
Figure 3 with 1 supplement
plxnd1skt6 mutants are hypersensitive to the antiangiogenic drug SU5416.
(A–D) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. …
Figure 3—figure supplement 1
Penetrance and expressivity of Se-DLAV truncations in DMSO-treated and SU5416-treated WT and embryos and plxnd1skt6 mutants at 32 hpf.
(A) Penetrance bar graph. Percentage of embryos of the indicated combinations of genotypes and treatments with Se-DLAV truncations (gray; a summation of the ‘minimal,’ ‘moderate,’ and ‘maximal’ …
Figure 4 with 3 supplements
gipc mutants display angiogenesis deficits.
(A) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. …
Figure 4—figure supplement 1
GIPC proteins encoded by both the wild-type and mutant gipc1, gipc2, and gipc3 alleles.
In the mutant proteins, the red bar denotes novel amino acid sequences resulting from mutagenic frameshift(s). See Supplementary file 1 and Supplementary file 8. Related to Figure 4.
Figure 4—figure supplement 2
Angiogenesis deficits of gipc1skt1 and gipc2 skt3/skt4 mutants at 32 hpf.
(A–C) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. …
Figure 4—figure supplement 3
Penetrance and expressivity of Se truncations in gipc mutants at 32 hpf.
(A) Penetrance bar graph. Percentage of embryos of the indicated genotypes with Se truncations (gray; a summation of the ‘severe,’ ‘medium,’ and, ‘weak’ categories) and with non-truncated Se (black; …
Figure 5 with 1 supplement
plxnd1 heterozygosity suppresses the angiogenesis deficits of gipc1skt1(MZ) mutants.
(A, B) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. …
Figure 5—figure supplement 1
Penetrance and expressivity of Se-DLAV truncations in gipc1skt1(MZ) and gipc1skt1(MZ); plxnd1fov01b/+ embryos at 32 hpf.
(A) Penetrance bar graph. Percentage of embryos of the indicated genotypes with Se-DLAV truncations (gray; a summation of the ‘minimal,’ ‘moderate,’ and ‘maximal’ categories) and with non-truncated …
Figure 6
Removal of plxnd1 activity from gipc1skt1(MZ); gipc2skt4(MZ) maternal-zygotic (MZ) double mutants yields a phenotype similar to that of plxnd1 nulls.
(A–D) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. …
Figure 7 with 4 supplements
GIPC depletion potentiates SEMA3E-induced, PLXND1-dependent ERK inactivation in HUVEC/TERT2 cells.
(A–D) Representative Western blot of active ERK1/2 (pERK) and total ERK1/2 (ERKTotal) from total cell lysates of HUVEC/TERT2 cells under the four conditions (shRNA and gRNA combinations) and the …
Figure 7—figure supplement 1
GIPC depletion potentiates SEMA3E-induced, PLXND1-dependent ERK inactivation in HUVEC/TERT2 cells.
(A, B) Bar graphs. Means of percentual relative ERK activity (pERK/ERKTotal) under the described conditions and SEMA3E treatments. Error bars, ± SEM. Relative ERK activity. (A) Conditions: control …
Figure 7—figure supplement 2
Efficient shRNA-mediated knockdown of GIPCs and CRISPR/Cas9-mediated knockout of PLXND1 in HUVEC/TERT2 cells.
(A–H) Western blots for GIPC1-2, PLXND1, and GAPDH (loading control) from TCLs of stable cells demonstrating the effective decrease of GIPC1-2 and PLXND1 levels. (A–D) TCLs from non-targeting gRNA#1 …
Figure 7—figure supplement 3
GIPC knockdowns potentiate the SEMA3E-induced/PLXND1-dependent cell collapse of primary HUVEC.
(A–F). Representative fluorescent images of HUVEC morphology in cell collapse experiments under the following conditions. No ligand (A–C; top) or 45 min stimulation with 10 nM of SEMA3E (D–F; …
Figure 7—figure supplement 4
Efficient shRNA-mediated GIPC (GIPC1, GIPC2, and GIPC3) and PLXND1 knockdowns in primary HUVEC used for cell collapse experiments.
Western blots for GIPC1, GIPC2, PLXND1, and GAPDH (loading control) from TCLs of cells infected with the indicated shRNA lentiviral particles. Note the effective decrease of GIPC1-2 and PLXND1 …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Danio rerio) | Tg(kdrl:HsHRAS-mCherry)s896 | DOI:10.1101/gad.1629408 | ZFIN ID: ZDB- ALT-081212–4 | Transgenic insertion |
| Genetic reagent (Danio rerio) | Tg(fli1a:EGFP)y1 | PMID:12167406 | ZFIN ID: ZDB- ALT-011017–8 | Transgenic insertion |
| Genetic reagent (Danio rerio) | Tg(fli1a:GAL4FF)ubs4 | DOI:10.1016/j.devcel. 2011.06.033 | ZFIN ID: ZDB- ALT-110921–1 | Transgenic insertion |
| Genetic reagent (Danio rerio) | Tg(flt1:nlsmCherry)skt7 | This paper | Transgenic insertion. Made using Torres-Vázquez lab plasmid #1208 | |
| Genetic reagent (Danio rerio) | gipc1skt1 | This paper | Putative null mutant allele | |
| Genetic reagent (Danio rerio) | gipc1skt2 | This paper | Putative null mutant allele | |
| Genetic reagent (Danio rerio) | gipc2skt3 | This paper | Putative null mutant allele | |
| Genetic reagent (Danio rerio) | gipc2skt4 | This paper | Putative null mutant allele | |
| Genetic reagent (Danio rerio) | gipc3skt5 | This paper | Putative null mutant allele | |
| Genetic reagent (Danio rerio) | plxnd1fov01b | PMID: 11861480 DOI:10.1016/j.devcel. 2004.06.008 | ZFIN ID: ZDB-ALT -010621–6 | Null mutant allele (point mutation) |
| Genetic reagent (Danio rerio) | plxnd1skt6 | This paper | Hypermorphic mutant allele | |
| Cell line (Cercopithecus aethiops) | COS-7 (Monkey Kidney Fibroblasts) | American Type Culture Collection | Cat. #CRL-1651. RRID:CVCL_0224 | https://www.atcc.org/products/All/CRL-1651.aspx |
| Cell line (Homo sapiens) | HUVEC/TERT2 (Immortalized Human Umbilical Vein Endothelial Cells) | American Type Culture Collection | Cat. #CRL-4053. RRID:CVCL_9Q53 | https://www.atcc.org/Products/All/CRL-4053.aspx |
| Cell line (Homo sapiens) | HUVEC (Normal Primary Human Umbilical Vein Endothelial Cells) | Lifeline Cell Technology | Cat. #FC-0003 | https://www.lifelinecelltech.com/shop/cells/human-endothelial-cells/umbilical-vein-endothelial-cells/huvec-fc-0003/ |
| Cell line (Homo sapiens) | Non-targeting gRNA1. Pool of HUVEC/TERT2 cells. | This paper | Derived from HUVEC/TERT 2 cell line (ATCC CRL4053). Cells were grown under blasticidin (4 μg/ml) selection and used between 7th and 10th passages. Cells stably coexpress Cas9 nuclease and non-targeting gRNA1 (from Torres-Vázquez lab plasmid #1859) | |
| Cell line (Homo sapiens) | Non-targeting gRNA2. Pool of HUVEC/TERT2 cells. | This paper | Derived from HUVEC/TERT 2 cell line (ATCC CRL4053). Cells were grown under blasticidin (4 μg/ml) selection and used between 7th-10th passages. Cells are stably coexpressing Cas9 nuclease and non- targeting gRNA2 (from Torres-Vázquez lab plasmid #1860) | |
| Cell line (Homo sapiens) | PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. | This paper | Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (ATCC CRL4053). Cells were grown under blasticidin (4 μg/ml) selection and used between 7th-10th passages. Cells are stably coexpressing Cas9 nuclease and PLXND1 gRNA KO1 (from Torres-Vázquez lab plasmid #1846) | |
| Cell line (Homo sapiens) | PLXND1 gRNA KO2. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. | This paper | Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (ATCC CRL4053). Cells were grown under blasticidin (4 μg/ml) selection and used between 7th-10th passages. Cells are stably coexpressing Cas9 nuclease and PLXND1 gRNA KO2 (from Torres-Vázquez lab plasmid # 1847) | |
| Cell line (Homo sapiens) | HEK293T (embryonic kidney cells) | Matthias Stadtfeld lab, NYU | ||
| Recombinant DNA reagent | V5-C-mPLXND1WT | This paper | Torres-Vázquez lab plasmid #862. Vector backbone: pcDNA3.1/ nV5-DEST-V5 | |
| Recombinant DNA reagent | V5-C-mPLXND1ΔCYSEA | This paper | Torres-Vázquez lab plasmid #863. Vector backbone: pcDNA3.1/ nV5-DEST-V5 | |
| Recombinant DNA reagent | V5-C-mPLXND1ΔGBM | This paper | Torres-Vázquez lab plasmid #1774. Vector backbone: pcDNA3.1/ nV5-DEST-V5 | |
| Recombinant DNA reagent | FLAG-mGIPC1WT | DOI:10.1091/mbc.12.3.615 | Torres-Vázquez lab plasmid #864. Vector backbone: pFLAG-CMV1 | |
| Recombinant DNA reagent | FLAG-mGIPC1GH1 | DOI:10.1091/mbc.12.3.615 | Torres-Vázquez lab plasmid #868. Vector backbone: pFLAG-CMV2 | |
| Recombinant DNA reagent | FLAG-mGIPC1PDZ | DOI:10.1091/mbc.12.3.615 | Torres-Vázquez lab plasmid #866. Vector backbone: pFLAG-CMV3 | |
| Recombinant DNA reagent | 2xHA-Plxnd1WT | This paper | GAL4-responsive, Gateway and IRES-based bicistronic vector for Tol2- mediated zebrafish transgenesis. Torres-Vázquez lab plasmid #1414 | |
| Recombinant DNA reagent | 2xHA-Plxnd1ΔGBM | This paper | GAL4-responsive, Gateway and IRES-based bicistronic vector for Tol2-mediated zebrafish transgenesis. Torres-Vázquez lab plasmid #1685 | |
| Recombinant DNA reagent | lentiCRISPR v2-Blast | Addgene | Cat. #83480 | A gift from Mohan Babu. https://www.addgene.org/83480/ |
| Recombinant DNA reagent | Non-targeting gRNA1 | This paper | Torres-Vázquez lab plasmid #1859. Vector backbone: lentiCRISPR v2-Blast | |
| Recombinant DNA reagent | Non-targeting gRNA2 | This paper | Torres-Vázquez lab plasmid #1860. Vector backbone: lentiCRISPR v2-Blast | |
| Recombinant DNA reagent | PLXND1-KO1 | This paper | Torres-Vázquez lab plasmid #1846. Vector backbone: lentiCRISPR v2-Blast | |
| Recombinant DNA reagent | PLXND1-KO2 | This paper | Torres-Vázquez lab plasmid #1847. Vector backbone: lentiCRISPR v2-Blast | |
| Recombinant DNA reagent | Control shRNA Lentiviral Particles-A (Non-targeting control shRNA) | Santa Cruz Biotechnology | Cat. #sc-108080 | Encodes a non-targeting shRNA sequence, will not lead to the specific degradation of any known cellular mRNA |
| Recombinant DNA reagent | GIPC shRNA (h) Lentiviral Particles | Santa Cruz Biotechnology | Cat. #sc-35475-V | shRNA pool (three target-specific constructs against human GIPC1 that encode 19–25 nt (plus hairpin) shRNAs). Target sequences (sense sequences 5’ to 3’): (1) CUGACGAGUUCGUCUUUGA (2) CCACCACUUUCCACCAUCA (3) CUGAAUUUGCUGUCUUGAA |
| Recombinant DNA reagent | GIPC2 shRNA (h) Lentiviral Particles | Santa Cruz Biotechnology | Cat. # sc-75132-V | shRNA pool (three target-specific constructs against human GIPC2 that encode 19–25 nt (plus hairpin) shRNAs). Target sequences (sense sequences 5’ to 3’): (1) CAGACGAAUUUGUCUUUGA (2) GGACACCUUUACUAACUCU (3) CCAACUUUCUCUCUUUGUA |
| Recombinant DNA reagent | GIPC3 shRNA (h) Lentiviral Particles | Santa Cruz Biotechnology | Cat. #sc-62376-V | shRNA pool (three target-specific constructs against human GIPC3 that encode 19–25 nt (plus hairpin) shRNAs). Target sequences (sense sequences 5’ to 3’): (1) CCUUCAUCAAGAGAAUCAA (2) GGAGUUUGCACGCUGUUUA (3) GACAAGUUCCUCUCUAGAA |
| Recombinant DNA reagent | Plexin-D1 shRNA (h) Lentiviral Particles | Santa Cruz Biotechnology | Cat. #sc-45585-V | shRNA pool (three target-specific constructs against human PLXND1 that encode 19–25 nt (plus hairpin) shRNAs). Target sequences (sense sequences 5’ to 3’): (1) GUCAAGAUAGGCCAAGUAA (2) CCAUGAGUCUCAUAGACAA (3) CCACAGACAGUUUCAAGUA |
| Sequenced-based reagent | plxnd13207-3462 morpholino | DOI:10.1016/j.devcel. 2004.06.008 | Validated splice-blocking morpholino against zebrafish plxnd1. Synthesized by GENE TOOLS, LLC). Sequence (5’ to 3’): CACACACACTCACGTTGATGATGAG | |
| Antibody | Chicken anti-GFP | Invitrogen | Cat. #A10262 | IF (1:1,000); zebrafish |
| Antibody | Sheep anti-mCherry | Holger Knaut lab, NYU | IF (1:1,000); zebrafish. Custom made antibody | |
| Antibody | Mouse anti-pFAK Tyr397 | Millipore | Cat. #05–1140 | IF (1:1,000); zebrafish |
| Antibody | Rabbit anti-GIPC1 | Proteintech Group | Cat. #14822–1-AP. RRID:AB_2263269 | WB (1:3,000). This antibody detects GIPC1, GIPC2, and GIPC3 (our data) |
| Antibody | Rabbit anti-GIPC2 | Abcam | Cat. #ab175272 | WB (1:5,000). This antibody detects GIPC1 and GIPC2 (our data) |
| Antibody | Rabbit anti-GIPC3 | Abcam | Cat. #ab186426 | WB (1:5000). This antibody is specific for GIPC3 (our data). Validated against HeLa TCL (positive control; a gift from Mamta Tahiliani’s lab, NYU) |
| Antibody | Mouse anti-PLXND1 | R and D Systems | Cat. #MAB41601 Clone #752815 | WB (1:250). Lyophilized reagent reconstituted in 200 μl of sterile PBS (GIBCO, Cat. #10010–023) |
| Antibody | Rabbit anti-Phospho- p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) XPTM | Cell Signaling Technology | Cat. #4370S. RRID:AB_2315112 | WB (1:20,000) |
| Antibody | Mouse anti-p44/42 MAPK (Erk1/2) (L34F12) | Cell Signaling Technology | Cat. #4696S | WB (1:10,000) |
| Antibody | Rabbit anti-GAPDH (D16H11) | Cell Signaling Technology | Cat. #5174P. RRID:AB_10622025 | WB (1:20,000) |
| Antibody | Mouse anti-FLAG M2 | SIGMA-ALDRICH | Cat. #F3165, clone M2. RRID:AB_259529 | WB (1:20,000) |
| Antibody | Rabbit anti-V5-Tag (D3H8Q) | Cell Signaling Technology | Cat. #13202S. RRID:AB_2687461 | WB (1:10,000) |
| Peptide, recombinant protein | Human Semaphorin 3E | R and D Systems | Cat. #3239-S3B | Working concentration of 2 nM (prepared in 1xPBS with 0.1%BSA (SIGMA_ALDRICH, Cat.A8022) |
| Chemical compound, drug | SU5416 | SIGMA-ALDRICH | Cat. #S8442 | Working concentration of 0.2 μM in fish water. From 10.5 mM stock solution in DMSO (SIGMA-ALDRICH, Cat. #D8418) |
| Chemical compound, drug | Gelatin, from porcine skin | SIGMA-ALDRICH | Cat. # G1890-100G | Working concentration of 0.1% (prepared in distilled water and then autoclaved) |
| Chemical compound, drug | Blasticidin S HCl, powder | ThermoFisher Scientific | Cat. #R21001 | From a stock solution of 10 mg/ml. Prepared in UltraPure Distilled water (Invitrogen Cat. # 10977–015) |
| Chemical compound, drug | Puromycin Dihydrochloride | ThermoFisher Scientific | Cat. #A1113803 | From a stock solution of 10 mg/ml |
Additional files
-
Supplementary file 1
Miscellaneous tables listing the following information.
Vectors for expressing PLXND1 and GIPC proteins/fragments, primers for genotyping Tg(fli1a:GAL4FF)ubs4 zebrafish, oligos for assembling DNA templates for in vitro transcription of gRNAs for zebrafish genome editing and for making lentiCRISPRv2-Blast vectors for Cas9 and gRNA coexpression for use in HUVEC, cognate sequences of WT alleles and mutant alleles generated in this study via genome editing, and primers for genotyping mutant alleles generated in this study via genome editing. Related to Figures 1–7, Figure 2—figure supplement 1, Figure 2—figure supplement 2, Figure 4—figure supplement 1, Figure 4—figure supplement 2, Figure 5—figure supplement 1, Figure 7—figure supplement 1 and, Figure 7—figure supplement 2.
- https://doi.org/10.7554/eLife.30454.021
-
Supplementary file 2
Tables of the raw and average densitometry values of tagged proteins in Western blots of CoIP experiments and their statistical significances.
Related to Figure 1.
- https://doi.org/10.7554/eLife.30454.022
-
Supplementary file 3
Tables of the plxnd1skt6 complementation of plxnd1fov01b (related to Figure 2C–E), the comparison of the vascular phenotypes of homozygous WT and homozygous plxnd1skt6 mutant siblings (related to Figure 2F–I, Figure 2—figure supplement 1), and the mosaic transgenic endothelial expression of tagged forms of zebrafish Plxnd1 in plxnd1fov01b null mutants (related to Figure 2—figure supplement 2J).
- https://doi.org/10.7554/eLife.30454.023
-
Supplementary file 4
Tables comparing the Se-DLAV truncations of wild-type embryos and plxnd1skt6 mutants (at 32 hpf) in animals treated with DMSO and SU5416. Related to Figure 3E and Figure 3—figure supplement 1.
- https://doi.org/10.7554/eLife.30454.024
-
Supplementary file 5
Tables comparing the Se truncations of wild-type embryos and gipc mutants at 32 hpf.
Related to Figure 4B and Figure 4—figure supplement 3.
- https://doi.org/10.7554/eLife.30454.025
-
Supplementary file 6
Tables comparing the Se-DLAV truncations of gipc1skt1 (MZ) and gipc1skt1 (MZ); plxnd1fov01/+ mutants at 32 hpf.
Related to Figure 5C and Figure 5—figure supplement 1.
- https://doi.org/10.7554/eLife.30454.026
-
Supplementary file 7
Tables of raw and average densitometry values for both pERK and ERKTotal, relative ERK activities and the statistical significances of the latter. Related to Figure 7E and Figure 7—figure supplement 1.
- https://doi.org/10.7554/eLife.30454.027
-
Supplementary file 8
Protein sequences. Related to Figure 1, Figure 2A–B, Figure 4—figure supplement 1, Figure 7—figure supplement 2, Supplementary file 1 (see ‘Vectors for expressing PLXND1 and GIPC proteins/fragments’ and ‘Cognate sequences of WT alleles and mutant alleles generated in this study via genome editing’), and Supplementary file 2.
- https://doi.org/10.7554/eLife.30454.028
-
Transparent reporting form
- https://doi.org/10.7554/eLife.30454.029
