1. Neuroscience

A homozygous loss-of-function CAMK2A mutation causes growth delay, frequent seizures and severe intellectual disability

  1. Poh Hui Chia  Is a corresponding author
  2. Franklin Lei Zhong  Is a corresponding author
  3. Shinsuke Niwa
  4. Carine Bonnard
  5. Kagistia Hana Utami
  6. Ruizhu Zeng
  7. Hane Lee
  8. Ascia Eskin
  9. Stanley F Nelson
  10. William H Xie
  11. Samah Al-Tawalbeh
  12. Mohammad El-Khateeb
  13. Mohammad Shboul
  14. Mahmoud A Pouladi
  15. Mohammed Al-Raqad
  16. Bruno Reversade  Is a corresponding author
  1. Institute of Medical Biology, Singapore
  2. Institute of Molecular and Cell Biology, Singapore
  3. Tohoku University, Japan
  4. Agency for Science, Technology and Research, Singapore
  5. David Geffen School of Medicine, University of California, Los Angeles, United States
  6. David Geffen School of Medicine University of California, Los Angeles, United States
  7. King Hussein Medical Centre, Royal Medical Services, Jordan
  8. Endocrinology and Genetics, Jordan
  9. Faculty of Science, Jordan
  10. National University of Singapore, Singapore
  11. Koç University School of Medicine, Turkey
https://doi.org/10.7554/eLife.32451
Share this article
Cite this article
  1. Poh Hui Chia
  2. Franklin Lei Zhong
  3. Shinsuke Niwa
  4. Carine Bonnard
  5. Kagistia Hana Utami
  6. Ruizhu Zeng
  7. Hane Lee
  8. Ascia Eskin
  9. Stanley F Nelson
  10. William H Xie
  11. Samah Al-Tawalbeh
  12. Mohammad El-Khateeb
  13. Mohammad Shboul
  14. Mahmoud A Pouladi
  15. Mohammed Al-Raqad
  16. Bruno Reversade
(2018)
A homozygous loss-of-function CAMK2A mutation causes growth delay, frequent seizures and severe intellectual disability
eLife 7:e32451.
https://doi.org/10.7554/eLife.32451
  2. Download BibTeX
  3. Download .RIS
5 figures, 2 videos, 2 tables and 3 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
A new syndrome of global neuro-developmental delay with seizures caused by a biallelic mutation in CAMK2A.

(A) Pedigree of a consanguineous Jordanian family with two affected siblings with germline homozygous mutations in CAMK2A. The genotypes of all individuals were verified by Sanger sequencing. (B) …

https://doi.org/10.7554/eLife.32451.003
Figure 1—figure supplement 1
Download asset Open asset
Genetic and clinical findings from the two patients with global developmental delay.

(A) Clinical table detailing the growth parameters and learning deficits of the two affected children. (B) EEG of patient II.4 showing abnormal waveforms (red box). (C) MRI images of patient II.4 …

https://doi.org/10.7554/eLife.32451.004
Figure 2
Download asset Open asset
CAMK2A mutant iPSC-derived neurons are functionally less active.

(A) Schematic of the hPSC-derived neuronal activity assay with representative image of iPSC-derived neurons plated on a multi-electrode array (B) Representative confocal images of immunofluorescence …

https://doi.org/10.7554/eLife.32451.008
Figure 3 with 1 supplement
Download asset Open asset
p.H477Y affects CAMK2A oligomerization and protein stability.

(A) Sequence conservation of CAMK2A homologs. Histidine 477 (H477) is highlighted in red. (B) X-ray crystal structure of human CAMK2A AD tetradecamer (PDB: 5IG3). H477 (red) is located at the …

https://doi.org/10.7554/eLife.32451.009
Figure 3—figure supplement 1
Download asset Open asset
Decreased stability and defective cytoplasmic localization of the CAMK2AH477Y mutant.

(A) Sequence conservation of CAMK2 paralogs. His477 (red) is invariant in all human CAMK2 paralogues with an association domain. (B) p.H477Y mutant is subject to proteasomal degradation. 293 T cells …

https://doi.org/10.7554/eLife.32451.010
Figure 4
Download asset Open asset
CAMK2AH477Y mutant fails to rescue synaptic defects in unc-43 C. elegans neurons.

(A) Schematic drawing of C. elegans motor neuron, DA9 in the tail region. DA9 extends a dendrite (red) anteriorly and an axon (blue) that extends posteriorly crosses the midline of the animal and …

https://doi.org/10.7554/eLife.32451.011
Author response image 1
Download asset Open asset
https://doi.org/10.7554/eLife.32451.016

Videos

Video 1
Download asset
Video of patient II.1
https://doi.org/10.7554/eLife.32451.005
Video 2
Download asset
Video of patient II.4
https://doi.org/10.7554/eLife.32451.006

Tables

Table 1
List of homozygous variants identified by Whole Exome Sequencing.
https://doi.org/10.7554/eLife.32451.007
ChrPositionGenecDNA variantProtein variant
133,476,435AK2c.*45–1G > T
136,752,343THRAP3c.512C > Tp.Ser171Phe
136,932,102CSF3Rc.2273C > Tp.Thr758Ile
139,758,439MACF1c.1931G > Tp.Gly644Val
1145,365,316NBPF10c.9941G > Ap.Gly3314Glu
211,758,842GREB1c.3841G > Ap.Ala1281Thr
229,404,617CLIP4c.1976G > Ap.Arg659Gln
264,779,195AFTPHc.587G > Ap.Gly196Glu
2238,277,211COL6A3c.4895G > Ap.Arg1632Gln
2241,987,827SNED1c.1369G > Ap.Glu457Lys
338,348,802SLC22A14c.574G > Ap.Ala192Thr
344,672,687ZNF197c.524C > Tp.Ala175Val
347,452,772PTPN23c.3484C > Tp.Arg1162Trp
352,556,184STAB1c.6403C > Gp.Pro2135Ala
367,426,232SUCLG2c.1235T > Cp.Ile412Thr
3197,422,844KIAA0226c.1366C > Tp.Arg456Trp
49,174,981FAM90A26Pc.83T > Gp.Val28Gly
49,175,603FAM90A26Pc.211C > Gp.Pro71Ala
410,089,539WDR1c.743A > Gp.His248Arg
415,529,151CC2D2Ac.1231T > Gp.Ser411Ala
574,021,852GFM2c.1820_1825delTTGAGTp.Glu608_Phe609del
578,610,479JMYc.2464C > Ap.Pro822Thr
5149,602,589CAMK2Ac.1429C > Tp.His477Tyr
5154,199,950C5orf4c.928G > Ap.Glu310Lys
5156,456,715HAVCR1c.1090G > Ap.Ala364Thr
5156,479,452HAVCR1c.590_592delCAAp.Thr198del
626,509,392BTN1A1c.1571G > Ap.Gly524Glu
627,215,709PRSS16c.119G > Ap.Ser40Asn
632,806,007TAP2c.4C > Tp.Arg2Trp
633,260,924RGL2c.1876G > Ap.Gly626Arg
638,704,952DNAH8c.221C > Ap.Ala74Asp
643,412,643ABCC10c.2807C > Tp.Pro936Leu
6129,932,746ARHGAP18c.1054C > Tp.Arg352Ter
6131,946,054MED23c.235C > Tp.Leu79Phe
6151,674,121AKAP12c.4595_4596insGGCp.Asp1532delinsGluAla
6168,479,677FRMD1c.98A > Cp.Glu33Ala
75,352,665TNRC18c.7851_7856dupCTCCTCp.Ser2618_Ser2619dup
745,123,857NACADc.1922T > Cp.Val641Ala
7143,884,437ARHGEF35c.1040C > Tp.Thr347Ile
7149,422,981KRBA1c.1304C > Tp.Ala435Val
7151,680,130GALNTL5c.428A > Gp.Tyr143Cys
812,285,064FAM86B1|FAM86B2c.310T > Cp.Ser104Pro
812,285,250FAM86B2c.808C > Tp.Arg270Trp
886,574,132REXO1L1c.1595A > Cp.Asp532Ala
912,775,863LURAP1Lc.149_150insTGGCGGp.Gly49_Gly50dup
940,706,047FAM75A3c.3704A > Gp.His1235Arg
941,323,425FAM75A4c.1908C > Tp.Arg637Trp
941,323,469FAM75A4c.1864G > Ap.Gly622Asp
943,822,668CNTNAP3Bc.1222C > Tp.Leu408Phe
1051,748,684AGAP6c.209G > Ap.Arg70Gln
1081,471,741FAM22Bc.2137T > Cp.Trp713Arg
111,651,198KRTAP5-5c.129_137delAGGCTGTGGp.Gly44_Gly46del
1112,316,388MICALCLc.1408_1410dupCCTp.Pro470dup
127,045,917ATN1c.1488_1508delGCAGCAGCAGCAGCAGCAGCAp.Gln496_Gln502del
127,045,920ATN1c.1491_1508delGCAGCAGCAGCAGCAGCAp.Gln497_Gln502del
1399,461,564DOCK9c.1271_1272insAp.Leu425LeufsTer?
13114,503,875FAM70Bc.500_509 + 72delCCTGCGGGAGG
TGAGGGGCACCGGGGACCCCCATATC
TACACCTGCGGGAGGTGAGGGGC
GCTGGGGACCCCCGTATCTACA
14105,411,514AHNAK2c.10274C > Tp.Ala3425Val
14106,994,118IGHV3-48c.47G > Ap.Gly16Asp
1629,496,359c.916T > Cp.Ser306Pro
1630,772,988C16orf93c.82G > Ap.Ala28Thr
1670,215,817CLEC18Cc.521C > Tp.Ala174Val
1739,211,189KRTAP2-2c.275G > Cp.Cys92Ser
191,026,716CNN2c.56A > Cp.Lys19Thr
1910,084,460COL5A3c.3584T > Cp.Val1195Ala
1914,517,213CD97c.1892G > Ap.Ser631Asn
2136,042,462CLIC6c.776_805delGCGTAGAAGCGGGGGTCCCGGCGGGGGACAp.Val260_Ser269del
2218,834,773c.329C > Tp.Thr110Ile
X48,920,059CCDC120c.110A > Gp.Asp37Gly
X55,116,478PAGE2c.25T > Ap.Ser9Thr
X150,832,702PASD1c.954_971delCCCAATGGACCAGCAGGAp.Pro319_Asp324del
X153,050,158SRPK3c.1_5delGACAGp.Thr2LeufsTer57
X154,010,046MPP1c.978A > Cp.Glu326Asp
Key resources table
Reagent type (species)
or resource		DesignationSource or referenceIdentifiersAdditional information
Gene (human)CAMK2A Calcium/Calmodulin Dependent Protein Kinase II AlphaUniprot: Isoform B (identifier: Q9UQM7-2)Q9UQM7-2
Gene (C. elegans)unc-43 Calcium/Calmodulin-Dependent Protein Kinase type IIProtein UNC-43 isoform d (Wormbase CDS K11E8.1d)K11E8.1d
Strain, strain background (C. elegans)Worm (C. elegans) N2 Bristol Strain;unc-43(e408)Caenorhabditis Genetics Center (CGC) PMID: 1794171117941711
Recombinant DNApCDH-CMV-MCS-EF1α-NeoSystems Biosciences (SBI)CD514B-1
Recombinant DNApSM vector (a derivative of pPD49.26 with additional cloning sites)Modified for this paperNAADDGENE https://media.addgene.org/cms/files/Vec95.pdf
Recombinant DNApCDH-CMV-CAMK2A-T2A-mCherryThis paper; based on pCDH-CMV-MCS-EF1α-NeoNA
Recombinant DNApMIG-hOCT4AddgenePlasmid #17225
Recombinant DNAMSCV h c-MYC IRES GFPAddgenePlasmid #18119
Recombinant DNApMIG-hKLF4AddgenePlasmid #17227
Recombinant DNApMIG-hSOX2AddgenePlasmid #17226
Cell line (human)Patient derived iPS neuronsThis paperNA
Cell line (human)293TLab stockNA
Chemical compound, drugMG132Sigma-AldrichM7449
Commercial kitNativeMark PAGEThermoFisherBN1002BOX
Commercial kitTnT Quick Coupled Transcription/Translation SystemPromegaL1170
AntibodyAnti-FLAG Clone M2Sigma-AldrichF3165
AntibodyAnti-HA Clone Y-11Santa Cruz Biotechnologysc-7392
AntibodyAnti-GADPHSanta Cruz Biotechnologysc-47724
AntibodyAnti-Tuj1Covance ResearchMMS-435P
AntibodyAnti-MAP2Synaptic Systems188 004
Cell culture reagent20% Knock Out Serum ReplacementThermo Fisher10828–028
Cell culture reagentbFGFStemgent37316
Cell culture reagentMatrigel Basement Membrane MatrixCorning354234
Cell culture reagentmTeSR1STEMCELL Technologies85850
Cell culture reagentCytoTune-iPS 2.0 Sendai Reprogramming KitThermoFisherA16517
Cell line (human)H1 embryonic stem cellsGift from Dr. Lawrence W. Stanton, WiCellRRID:CVCL_C813
AntibodyAlexa Fluor 594 secondary AbThermoFisherCat# A-11076, RRID:AB_2534120
AntibodyAlexa Fluor 488 secondary AbThermoFisherCat# A-11001, RRID:AB_2534069
Assay system/kitMaestro MEA SystemAxion Biosystem-

Additional files

Supplemental file 1

Statistical Data Analysis

https://doi.org/10.7554/eLife.32451.012
Source code 1

IBD linkage program.

https://doi.org/10.7554/eLife.32451.013
Transparent reporting form
https://doi.org/10.7554/eLife.32451.014

Download links