Multivesicular bodies mediate long-range retrograde NGF-TrkA signaling
- The Johns Hopkins University, School of Medicine, United States
- Howard Hughes Medical Institute, Harvard Medical School, United States
Figures
Figure 1 with 1 supplement
Retrograde TrkA+ endosomes are predominantly of multi-vesicular, not single-vesicular, ultrastructure.
(a,b) The Flag-TrkA transport assay was performed in compartmentalized sympathetic neurons using pre-conjugated anti-Flag antibody with Protein A-5 nm gold. Cells were fixed 1 hr post-NGF …
Figure 1—figure supplement 1
Retrogradely transported TrkA is associated with MVBs.
(a) Schematic of the Flag-TrkA endosome transport assay. DA: distal axons. PA: proximal axons. See also Materials and methods. (b) Newly internalized Flag-TrkA is sorted into early endosomes in …
Figure 2 with 1 supplement
Multivesicular bodies, not early endosomes, are major carriers of retrograde TrkA signals in sympathetic neurons.
(a,b) The Flag-TrkA endosome transport assay was performed in sympathetic neurons grown in compartmentalized microfluidic culture and infected with a lentivirus expressing EGFP-Rab7. The percentage …
Figure 2—figure supplement 1
Retrogradely transported TrkA is associated with MVB markers.
(a) Colocalization of Flag-TrkA endosomes with EGFP-Rab5 or EGFP-Rab7 in distal axons post internalization over time was quantified (n = 3). (b,c) Colocalization between Flag-TrkA (magenta) and …
Figure 3 with 1 supplement
Rab7 mediates survival and synaptogenesis of sympathetic ganglia in vivo and retrograde NGF/TrkA transport, signaling and survival in vitro.
(a,b) Neuronal cell counts of SCGs from Rab7+/+; Th2a-CreER, Rab7f/+; Th2a-CreER and Rab7f/f; Th2a-CreERmice at P7. Tamoxifen was administered at E14 (0.5 mg) to induce Cre expression (n = 3). Scale …
Figure 3—figure supplement 1
Rab7 is required for retrograde TrkA transport and survival in sympathetic and sensory neurons.
(a) Rab7+/+; Th2a-CreER and Rab7f/f; Th2a-CreERmice were treated with tamoxifen at E14 to induce Cre expression. SCGs were harvested at P0 or P7 and levels of Rab7 protein were assessed by …
Figure 4 with 1 supplement
Retrograde TrkA+ MVBs associate with key effectors of the NGF/TrkA signaling pathway.
(a,b) The Flag-TrkA endosome transport assay was performed in compartmentalized sympathetic neurons expressing CD63-EGFP. The extent of CD63-EGFP+ Flag-TrkA (green/magenta) punctae in proximal axons …
Figure 4—figure supplement 1
Retrograde TrkA+ endosomes associate with key effectors of NGF/TrkA signaling pathway.
(a) Compartmentalized sympathetic neurons were NGF- and serum-deprived for 6 hr and then stimulated with NGF in the presence of either DMSO or K252a for 20 min in distal axons. Cells were then …
Figure 5 with 1 supplement
Retrogradely transported TrkA+ endosomes within cell bodies evolve from MVBs into simple, single-membrane vesicle structures.
(a) Schematic of the pulse-block assay. The Flag-TrkA assay is performed in Ntrk1Flag sympathetic neurons cultured in compartmentalized microfluidic chambers as in Figure 1—figure supplement 1A …
Figure 5—figure supplement 1
Nocodazole treatment effectively blocks microtubule-dependent axonal trafficking and retrograde Flag-TrkA transport.
(a) Quantification of retrograde Flag-TrkA localization in MVB, SV and lysosome in cell bodies over time (n = 4,>200 gold particles scored for each time point). Data for the 1 hr time point is the …
Figure 6 with 1 supplement
TrkA+ single vesicles formed de novo in cell bodies after retrograde transport are signaling competent and are not Rab5+early endosomes.
(a) The pulse-block assay was performed in compartmentalized sympathetic neurons using pre-conjugated anti-Flag antibody with 5 nm gold secondary antibody. Cells were fixed 5 hr post-NGF application …
Figure 6—figure supplement 1
Retrogradely transported transferrin and Flag-TrkA are sorted in distinct MVBs and characterization of TrkA+ single vesicles.
(a) Internalized transferrin-Alexa 546 was co-localized with transferrin receptor in distal axons of compartmentalized sympathetic neurons. Scale: 10 μm. (b) Internalization of transferrin-Alexa …
Figure 7 with 1 supplement
TrkA kinase activity within endosomes regulates maturation and fate of retrograde TrkA+ endosomes.
(a) Compartmentalized WT sympathetic neurons were infected with a virus expressing either Flag-TrkB/A-WT or Flag-TrkB/A-F592A. The pulse-block kinase assay was performed as in Figure 5a, with BDNF …
Figure 7—figure supplement 1
Expression of Flag-TrkB/A-F592A allows specific activation and inhibition of TrkA kinase activity within endosomes.
(a) Schematic of the Flag-TrkB/A-F592A construct. See also Materials and methods. (b) Schematic of the pulse-block kinase assay. See also Materials and methods. (c) Compartmentalized sympathetic …
Figure 8
Model for MVB-mediated retrograde TrkA transport and signaling.
This schematic illustrates a model for how multivesicular bodies control propagation of retrograde NGF-TrkA signals. In distal axons, newly internalized NGF/TrkA complexes are sorted into Rab5+ …
Videos
Video 1
EGFP-Rab5+ TrkA+ endosomes in distal axons are stationary/oscillatory.
Time lapses of EGFP-Rab5 (cyan, bottom panel) and Flag-TrkA (magenta, middle panel) trafficking (merged channel, top panel) in distal axons of sympathetic neurons grown in compartmentalized …
Video 2
EGFP-Rab7+ TrkA+ endosomes display consistent and processive retrograde movement in axons.
Time lapses of EGFP-Rab7 (cyan, bottom) and Flag-TrkA (magenta, middle) trafficking (merged channel, top) in axons in the middle grooves of microfluidic chambers adjacent to the distal axon …
Video 3
CD63-EGFP+ TrkA+ endosomes display consistent and processive retrograde movement in axons.
Time lapses of CD63-EGFP (cyan, bottom) and Flag-TrkA (magenta, middle) trafficking in axons (merged channel, top) in the middle grooves of microfluidic chambers adjacent to the distal axon …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Ntrk1Flag | (Sharma et al., 2010) PMID: 20696380 | Mice were handled and housed in accordance with Harvard Medical School and Johns Hopkins University IACUC guidelines | |
| Genetic reagent (M. musculus) | Th2a-CreER | (Abraira et al., 2017) PMID: 28041852 | ||
| Genetic reagent (M. musculus) | Rab7flox | (Roy et al., 2013) PMID: 23615463 | ||
| Antibody | NeuN | Abcam (Cambridge, MA) | 1:1000 | |
| Antibody | Rab5 | 1:500 | ||
| Antibody | Rab7 | 1:200 for ICC; 1:1000 for immunoblot | ||
| Antibody | Lamp1 | 1:1000 | ||
| Antibody | P-Trk Y490 | Cell signaling(Danvers, MA) | 1:2000; 1:100 for immunoEM | |
| Antibody | P-Trk Y785 | |||
| Antibody | P-PLCγ | 1:500; 1:50 for immunoEM | ||
| Antibody | VAChT | Enzo Life Sciences (Farmingdale, NY) | 1:1000 | |
| Antibody | Homer1 | Synaptic Systems (Germany) | 1:500 | |
| Antibody | Flag | Sigma (St. Louis, MO) | 1 ug/ml | |
| Antibody | Alexa conjugated secondary antibodies (488, 555, 647) | Thermo Fisher Scientific (Waltham, MA) | 1:1000 | |
| Antibody | IgG F(ab’)2–6 nm/10 nm gold secondary antibodies | Aurion (Netherlands) | 1:50 | |
| Antibody | Protein A-5nm/10 nm gold | Made by The Harvard Medical School EM Facility | 1:50 | |
| Recombinant DNA reagent | FUW | (Lois et al., 2002) PMID: 11786607 | Addgene 14882 | |
| Recombinant DNA reagent | APEX2 | (Lam et al., 2015) PMID: 25419960 | Addgene 49385 | |
| Recombinant DNA reagent | FUW-EGFP-Rab5 | This paper | ||
| Recombinant DNA reagent | FUW-EGFP-Rab7 | This paper | ||
| Recombinant DNA reagent | FUW-CD63-EGFP | This paper | ||
| Recombinant DNA reagent | FUW-CD63-mCherry | This paper | ||
| Recombinant DNA reagent | FUW-RILP-EGFP | This paper | ||
| Recombinant DNA reagent | FUW-APEX2-Rab5 | This paper | ||
| Recombinant DNA reagent | FUW-APEX2-Vps35 | This paper | ||
| Recombinant DNA reagent | FUW-Flag-TrkB/A-WT | This paper | The TrkB/A chimeric receptor comprises the extracellular domain of TrkB (nucleotide 1–1242) and the transmembrane and intracellular domains of TrkA (nucleotide 1156–2400) | |
| Recombinant DNA reagent | FUW-Flag-TrkB/A-F592A | This paper | ||
| Sequence-based reagent | Primers for genotypingTh2a-CreER | CATGCCCATATCCAATCTCC and CTGGAGCGCATGCAGTAGTA | ||
| Sequence-based reagent | Primers for genotyping Rab7flox | CTCACTCACTCCTAAATGG and TTAGGCTGTATGTATGTGC | ||
| Sequence-based reagent | shRNAs for Rab7 | GAAGTTCAGTAACCAGTACAA; GCGGCAGTATTCTGTACAGTA; GCCCTTAAACAGGAAACAGAA; TGAACCCATCAAACTGGACAA; TGCTGTGTTCTGGTGTTTGAT | ||
| Sequence-based reagent | shRNAs for RILP | CAGCTATGCAGGAGGCTTAAC; AGATCAAGGCCAAGATGTTAG; CCAGAATTTCTTTGGCTTATG; TTCAGCAGGGAAGAGCTTAAG; AGGAGCGGAATGAGCTCAAAG | ||
| Sequence-based reagent | Scrambled shRNA | CCTAAGGTTAAGTCGCCCTCG | ||
| Chemical compound, drug | K252a | EMD Millipore (Billerica, MA) | ||
| Chemical compound, drug | 1NMPP1 | |||
| Chemical compound, drug | Nocodazole | |||
| Chemical compound, drug | Saponin | MP Biomedicals (Santa Ana, CA) | ||
| Chemical compound, drug | 3.3’-Diaminobenzidine (DAB) | |||
| Chemical compound, drug | 6 nm gold-conjugated transferrin, CTB, BSA | Electron Microscopy Sciences (Hatfield, PA) |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.33012.020
