Segmentation of the zebrafish axial skeleton relies on notochord sheath cells and not on the segmentation clock
- WWU Münster, Germany
- CiM Cluster of Excellence (EXC-1003-CiM), Germany
- Hubrecht Institute-KNAW & UMC Utrecht, Netherlands
- The Francis Crick Institute, United Kingdom
- Instituto de Investigación en Biomedicina de Buenos Aires (IBioBA), CONICET–Partner Institute of the Max Planck Society, Argentina
- FCEyN, UBA, Ciudad Universitaria, Argentina
- Max Planck Institute for Molecular Physiology, Germany
- University College London, United Kingdom
- École Polytechnique Fédérale de Lausanne (EPFL), Switzerland
Figures
Figure 1 with 3 supplements
Disruption of the segmentation clock in tbx6, her1;her7 and her1;her7;tbx6 mutants.
(A–D’) In situ hybridization for segmentation clock marker her7. (B and B') her7 oscillates in the posterior PSM of tbx6−/−, but does not oscillate in her1−/−;her7−/− (C and C´) or her1−/−;her7−/−;tb…
Figure 1—figure supplement 1
Generating novel her1;her7 and hes6 mutants by TALEN.
(A) A TALEN construct directed against her1 was injected in the her7 mutant resulting in an insertion of 17 bp (red sequence) and the creation of 2 consecutive stop codons in exon 2 of her1 (*=stop …
Figure 1—figure supplement 2
Disruption of the segmentation clock in tbx6, her1;her7, her1;her7;tbx6 and her1;her7;hes6 mutants.
(A-H') In situ hybridization for segmentation clock markers her1 and deltaC in tbx6−/−, her1−/−;her7−/−and her1−/−;her7−/−;tbx6−/−. her1 (B and B’) and deltaC (F and F’) oscillate in the posterior …
Figure 1—figure supplement 3
Disruption of segmental output in the anterior PSM of her1;her7 mutants.
In situ hybridization for segmentation clock output markers. (A-b') Two examples of mespb expression in the anterior PSM of wild type embryos, present as segmental stripes (A, a and A’, a’) whereas m…
Figure 2 with 4 supplements
Myotome boundaries are disrupted in segmentation clock mutants, but chordacentra are still patterned.
(A to D’) In situ hybridization for myotome boundary marker xirp2a. Myotome boundaries are disrupted to differing degrees of severity depending on the genotype. (E–H’) Alizarin Red bone …
Figure 2—figure supplement 1
Schematic depiction of a vertebral body.
The initial mineralization immediately adjacent to the notochord results in the formation of the chordacentrum (cc). The subsequent expansion of this structure through further mineralization of …
Figure 2—figure supplement 2
Severity of myotome boundary disruptions in tbx6, her1;her7 and her1;her7;tbx6 mutants differ according to genotype.
(A1–D6) In situ hybridisation for myotome boundary marker xirp2a in six representative embryos for each genotype. (A1-A6) In wild type larvae, xirp2a staining delimits periodic, chevron-shaped …
Figure 2—figure supplement 3
Centra are well-formed in deltaD, deltaC, her1, her7 and hes6 segmentation clock single gene mutants.
(A, D, G, J and M) xirp2a myotome marker in situ hybridization at 27 hpf. (B, E, H, K and N) entpd5:kaede expression between 15 dpf and 20 dpf. (C, F, I, L, O) Alizarin Red bone stain in adults …
Figure 2—figure supplement 4
Segmentation clock gene double and triple heterozygous mutants have well-formed centra.
(A, D, G, J, M, P, S) xirp2a myotome marker in situ hybridization at 27 hpf. (B, E, H, K, N, Q, T) entpd5:Kaede expression between 15 dpf and 20 dpf. (C, F, I, L, O, R, U) Alizarin Red bone …
Figure 3 with 1 supplement
Segmental entpd5 expression in notochord sheath cells marks the sites of chordacentrum mineralization.
(A-D) Confocal images of live transgenic entpd5 reporter larvae in lateral view with anterior to left. (A) At 6 dpf, entpd5 is expressed only in notochord sheath cells and not in vacuolated …
Figure 3—figure supplement 1
osterix is required for the formation of cranial bone structures, but not for the axial skeleton.
(A) Lateral view of a transgenic entpd5:YFP; osterix:mCherry embryo. entpd5:YFP expressing cells are present at positions (arrows; numbers refer to prospective vertebrae 3–5) where mineralization of …
Figure 4 with 5 supplements
Mutants with disturbed segmentation clock form a metameric order of chordacentra with scattered defects.
(A–D) Kymogram representation of virtual time lapse observations of representative entpd5:kaede-expressing larvae of each genotype. (A) In wild type (n = 16), entpd5+ segments are added in an …
Figure 4—figure supplement 1
Wild type entpd5:kaede larvae develop axial segmentation in an orderly manner from anterior to posterior.
Virtual time lapse of one larva from 7 dpf to 23 dpf showing entpd5 positive segment development in the axial skeleton progressing continuously from anterior to posterior, with regular distance …
Figure 4—figure supplement 2
fss (tbx6−/−);entpd5:kaede larvae develop axial segmentation with occasional gaps that are later filled by a smaller entpd5+ ring domain.
Virtual time lapse of one larva from 7 dpf to 27 dpf. Scale bars are 300 µm.
Figure 4—figure supplement 3
her1−/−;her7−/−;entpd5:kaede larvae develop axial segmentation in a disorganized manner, occasionally missing one or two segments or inserting additional segments.
Fusions of adjacent chordacentra, non-regular entpd5+ segment shapes, thicker and thinner segments and a transient bending of the axis (asterisk) can be seen. Virtual time lapse of one larva from 7 …
Figure 4—figure supplement 4
her1−/−;her7−/−;tbx6−/−;entpd5:kaede larvae showed disorganized axial segmentation.
These defects are not as strong or as frequent as in her1−/−;her7−/−, but gaps in segmentation, insertion of additional segments, fusions of adjacent centra, non-regular entpd5+ segment shapes, …
Figure 4—figure supplement 5
hes6−/−;entpd5:kaede larvae segment their axis in an orderly manner.
Even though segmentation is overtly normal, the hes6 mutant forms fewer chordacentra than wild type, as expected. Scale bars are 300 µm.
Figure 5
Inaccurate spacing of entpd5+ segments results in erroneous chordacentrum formation.
(A, B) Time series images of entpd5+ segments around the notochord in her1;her7 mutants, in lateral view with anterior to the left. (A) An atypically wide space between entpd5+ segments (arrow) …
Figure 6
hes6 mutant embryos can form defective caudal vertebrae.
(A,B) Alizarin Red bone preparations of wild type and hes6−/− adults. (B) 27% of hes6−/− adult bone stains presented with defects in caudal chordacentra (n=4/15) wildtype. Arrow points at fused …
Figure 7 with 9 supplements
A reaction diffusion theory accounts for key experimental findings.
A sink profile (blue) describes cues from myotomes that bias the position of segments. The Entpd5 pattern is given by the concentration of an activator (green) that is regulated by an inhibitor …
Figure 7—figure supplement 1
Theory schematics.
(A) Scheme of the reactions between the activator U, the inhibitor V and the inhibitor sinks S. Pointed arrows indicate activation and blunt arrows inhibition. (B) Nullcline plots for the …
Figure 7—figure supplement 2
Sequence of snapshots from Video 1 showing simulation of the autonomous sinkless condition, in which patterning occurs sequentially from anterior to posterior.
The absence of sink profile (blue) in the top panel and corresponding activator (green) and inhibitor (red) patterns in a sequence of snapshots from the simulation for the sinkless condition. …
Figure 7—figure supplement 3
Sequence of snapshots from Video 2 showing simulation of the wild type condition.
The sink profile (blue) for the wild type condition in the top panel and corresponding activator (green) and inhibitor (red) patterns. Parameters as in Figure 7 of the main text.
Figure 7—figure supplement 4
Theoretical effects of sink strength and sink wavelength noise on notochord patterning mechanism.
Steady state concentration of the activator (green) and inhibitor (red) for different sink profiles (blue) as indicated. (A–G) Increasing sink strength S0. For vanishing sinks S0 = 0 the patterning …
Figure 7—figure supplement 5
Sequence of snapshots from Video 3 showing simulation of the her1;her7 mutant condition.
The sink profile (blue) representing the noisy spatial distribution of the her1;her7 mutant in the top panel and corresponding activator (green) and inhibitor (red) patterns. Parameters as in Figure …
Figure 7—figure supplement 6
Sequence of snapshots from Video 4 showing simulation of the tbx6 mutant condition.
The sink profile (blue) representing the noisy spatial distribution and the reduced amplitude of sinks in the tbx6 mutant in the top panel and corresponding activator (green) and inhibitor (red) …
Figure 7—figure supplement 7
Sequence of snapshots from Video 5 showing simulation of the hes6 mutant condition.
The sink profile (blue) representing the longer spatial wavelength of sinks in the hes6 mutant in the top panel and corresponding activator (green) and inhibitor (red) patterns. Parameters as in Figu…
Figure 7—figure supplement 8
Chordacentra always align with the myotome boundaries in wild type larvae, but not in mutants.
(A-R) Live confocal images of entpd5:Kaede in the trunk of wild type, her1−/−;her7−/− and fss (tbx6−/−) larvae, in lateral view, anterior to the left. (A-F) Live images at 4 dpf and 7 dpf show entpd5…
Figure 7—figure supplement 9
Quantification of mutant phenotype observables and comparison to theoretical description.
(A) The number of entpd5+ segments at 28 dpf, including smaller vertebrae, is increased in mutants. (B) At 28 dpf her1−/−;her7−/− have the highest number of segmentation defects, which is partially …
Author response image 1
Videos
Video 1
Simulation of the autonomous sinkless condition.
The absence of sink profile (blue) in the top panel and corresponding activator (green) and inhibitor (red) patterns in the bottom with patterning occurring sequentially from anterior to posterior. …
Video 2
Simulation of the wild type condition.
The sink profile (blue) for the wild type condition in the top panel and corresponding activator (green) and inhibitor (red) patterns in the bottom. Parameters as in Figure 7 of the main text.
Video 3
Simulation of the her1;her7 mutant condition.
The sink profile (blue) showing the noisy spatial distribution for the her1;her7 mutant condition in the top panel and corresponding activator (green) and inhibitor (red) patterns in the bottom. …
Video 4
Simulation of the tbx6 mutant condition.
The sink profile (blue) representing the noisy spatial distribution and the reduced amplitude of sinks in the tbx6 mutant in the top panel and corresponding activator (green) and inhibitor (red) …
Video 5
Simulation of the hes6 mutant condition.
The sink profile (blue) representing the longer spatial wavelength of sinks in the hes6 mutant in the top panel and corresponding activator (green) and inhibitor (red) patterns in the bottom. …
Tables
Key resources table
| Reagent type or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Danio rerio) | sagff214 | NA | ||
| Gene (Danio rerio) | entpd5 | NA | ||
| Gene (Danio rerio) | her1 | NA | ||
| Gene (Danio rerio) | her7 | NA | ||
| Gene (Danio rerio) | tbx6 | NA | ||
| Gene (Danio rerio) | hes6 | NA | ||
| Gene (Danio rerio) | deltaD | NA | ||
| Gene (Danio rerio) | deltaC | NA | ||
| Gene (Danio rerio) | osterix | NA | ||
| Genetic reagent | ||||
| Genetic reagent (Danio rerio) | Tg(entpd5:kaede) | Geurtzen et al., 2014 doi: 10.1242/dev.105817 | hu6867 | Same BAC used as Huitema et al., 2012 with kaede insertion at first translated ATG |
| Genetic reagent (Danio rerio) | Tg(entpd5:pkred) | This paper | hu7478 | Same BAC used as Huitema et al., 2012 with pkred insertion at first translated ATG |
| Genetic reagent (Danio rerio) | Tg(SAGFF214:GFP) | Yamamoto et al., 2010 DOI: 10.1242/dev.051011 | ||
| Genetic reagent (Danio rerio) | Osterix:mcherry | Spoorendonk et al., 2008 DOI: 10.1242/dev.024034 | hu4008 | |
| Genetic reagent (Danio rerio) | her1 | Schröter et al., 2012 doi: 10.1371/journal.pbio.1001364 | hu2124 | |
| Genetic reagent (Danio rerio) | her7 | Schröter et al., 2012 doi:10.1371/journal.pbio.1001364 | hu2526 | |
| Genetic reagent (Danio rerio) | tbx6 | Busch-Nentwich et al., 2013 ZFIN ID: ZDB-PUB-130425–4 | sa38869 | |
| Genetic reagent (Danio rerio) | hes6 | Schröter and Oates, 2010 doi: 10.1016/j.cub.2010.05.071 | zm00012575Tg | Also called zf288Tg |
| Genetic reagent (Danio rerio) | deltaD | van Eeden et al., 1996 PMID: 9007237 | ar33 | Also called tr233 |
| Genetic reagent (Danio rerio) | deltaC | van Eeden et al., 1996 PMID: 9007237 | tm98 | |
| Recombinant DNA reagent (plasmid) | ||||
| Plasmid (Danio rerio) | her7 | Oates and Ho, 2002 | ||
| Plasmid (Danio rerio) | mespb | Sawada et al., 2000 | ||
| Plasmid (Danio rerio) | xirp2a | Deniziak et al., 2007 | ||
| Plasmid (Danio rerio) | papc | Yamamoto et al., 1998 | ||
| Plasmid (Danio rerio) | en2a | Erickson et al., 2007 | ||
| Plasmid (Danio rerio) | ripply1 | PCR template: Rip1 F (CGTGGCTTGTGACCAGAAAAG) Rip1 R T7 325 (TAATACGACTCACTATAGGCT GTGAAGTGACTGTTGTGT) | ||
| Plasmid (Danio rerio) | ripply2 | PCR template: Rip2 F(ACGCGAATCAACCCTGGAGA) and Rip2 R T7 281 (AATACGACTCACTATAGGGAGA GAGCTCTTTCTCGTCCTCTTCAT) | ||
| Plasmid (Danio rerio) | dlc | Oates and Ho, 2002 | ||
| Plasmid (Danio rerio) | her1 | Müller et al., 1996 | ||
| Sequence-based reagent | ||||
| Talen | hes6 | this paper | See Figure 1, Figure 1—figure supplement 1 | |
| Talen | her1 | this paper | See Figure 1, Figure 1—figure supplement 1 | |
| Commercial assay or kit | ||||
| Commercial assay or kit | RNeasy MinElute Cleanup Kit | Qiagen | Cat No./ID: 74204 | |
| Commercial assay or kit | Gene jet plasmid (miniprep kit) | Thermo scientific | Cat no: K0502 | |
| Chemical compound, drug | ||||
| Chemical compound, drug | Alizarin red | Sigma | CAS Number 130-22-3 | |
| Software, algorithm | ||||
| Software, algorithm | LAS X | Leica microsystems | ||
| Software, algorithm | Fiji (RRID:SCR_002285) | ImageJ 1.51 n | ||
| Software, algorithm | Python (RRID:SCR_008394) | Version Python 2.7.14: : Anaconda custom (64-bit) | ||
| Software, algorithm | Libraries: numpy (RRID:SCR_008633), matplotlib (RRID:SCR_008624) | Anaconda distribution | ||
| Software, algorithm | Lleras_fhn_1d_ solve_and_animate_ eLife.py | This paper | Custom PDE solver and animator | Provided as supplementary data. |
| Software, algorithm | Spyder | Anaconda distribution, Spyder 3.2.6 | The Scientific PYthon Development EnviRonment |
Table 1
Genotyping of lines using sequencing or restriction enzyme digestion
https://doi.org/10.7554/eLife.33843.036| Zebrafish line | FW | RV | Restriction enzymes |
|---|---|---|---|
| her1 | TCTAGCAAGGACACGCATGA | GATGAAGAGGAGTCGGTGGA | |
| her7 | GATGAAAATCCTGGCACAGACT | TCTGAATGCAGCTCTGCTCG | |
| hes6 | TCACGACGAGGATTATTACGG | GGGCGACAACGTAGCGTA | NHEI |
| her1−/−;her7−/− and her1−/−;her7−/−;tbx6 −/− | ACTCCAAAAATGGCAAGTCG | GCCAATTCCAGAATTTCAGC | AGEI |
| aei | AGGGAAGCTACACCTGCTCA | TTCTCACAGTTGAATCCAGCA | |
| fss | GGGTCATTGTTGGGTTGCA | ATGAACACCGCCCTTCCAAT |
Table 2
Genotyping using Kaspar
https://doi.org/10.7554/eLife.33843.037| Zebrafish line | FW X | FW Y | RV |
|---|---|---|---|
| bea | GAAGGTGACCAAGTTCATGCT | GAAGGTCGGAGTCAACGGATT | AGTCCTTGCCTGACAAACCAA |
Additional files
-
Source code 1
Custom python code.
- https://doi.org/10.7554/eLife.33843.038
-
Transparent reporting form
- https://doi.org/10.7554/eLife.33843.039
