1. Neuroscience

Metformin reverses early cortical network dysfunction and behavior changes in Huntington’s disease

  1. Isabelle Arnoux
  2. Michael Willam
  3. Nadine Griesche
  4. Jennifer Krummeich
  5. Hirofumi Watari
  6. Nina Offermann
  7. Stephanie Weber
  8. Partha Narayan Dey
  9. Changwei Chen
  10. Olivia Monteiro
  11. Sven Buettner
  12. Katharina Meyer
  13. Daniele Bano
  14. Konstantin Radyushkin
  15. Rosamund Langston
  16. Jeremy J Lambert
  17. Erich Wanker
  18. Axel Methner
  19. Sybille Krauss  Is a corresponding author
  20. Susann Schweiger  Is a corresponding author
  21. Albrecht Stroh  Is a corresponding author
  1. University Medical Center, Germany
  2. German Center for Neurodegenerative Diseases (DZNE), Germany
  3. Ninewells Hospital and Medical School, United Kingdom
  4. Max-Delbrück-Center, Germany
https://doi.org/10.7554/eLife.38744
Share this article
Cite this article
  1. Isabelle Arnoux
  2. Michael Willam
  3. Nadine Griesche
  4. Jennifer Krummeich
  5. Hirofumi Watari
  6. Nina Offermann
  7. Stephanie Weber
  8. Partha Narayan Dey
  9. Changwei Chen
  10. Olivia Monteiro
  11. Sven Buettner
  12. Katharina Meyer
  13. Daniele Bano
  14. Konstantin Radyushkin
  15. Rosamund Langston
  16. Jeremy J Lambert
  17. Erich Wanker
  18. Axel Methner
  19. Sybille Krauss
  20. Susann Schweiger
  21. Albrecht Stroh
(2018)
Metformin reverses early cortical network dysfunction and behavior changes in Huntington’s disease
eLife 7:e38744.
https://doi.org/10.7554/eLife.38744
  2. Download BibTeX
  3. Download .RIS
5 figures, 2 tables and 1 additional file

Figures

Figure 1 with 5 supplements
Download asset Open asset
In vivo two-photon Ca2+ imaging in layer 2/3 of visual cortex reveals a hyperactive neuronal activity pattern prior to disease onset.

(a,b) Top right, Illustrations indicating the visual cortex (blue area) in human (a) and mouse (b) brains. The brains are not drawn to scale. Bottom, timeline of Huntington’s disease progression in human and Hdh150 mouse model of Huntington’s disease. The Huntington’s disease onset was age 30–50 years in humans and ~70 weeks in Hdh150 mice. We conducted our experiments during a very early pre-symptomatic phase, far prior to mHtt aggregates and motor symptoms. VFDO: very far from disease onset. (c) Representative two-photon images of OGB-1 AM staining in layer 2/3 of the visual cortex of WT and Hdh150 mice. Scale bar: 70 µm. (d) Color-coded maps of silent (black) and spontaneously active (orange) neurons in WT (left) and Hdh150 (right) mice. Dashed lines represent the boundaries of blood vessels (original images in Figure 1c). Scale bar: 100 µm. (e) Density of stained cells in layer 2/3 of the visual cortex in WT and Hdh150 mice. Unpaired t-test, p=0.71. (f) Increased proportion of spontaneously active neurons in Hdh150 mice. Unpaired t-test, p<0.05. (g) Representative traces of spontaneous Ca2+ transients (red) of 10 neurons recorded in vivo in WT and Hdh150 mice. Vertical scale bars: 40% dF/F. (h) Increased frequency of Ca2+ transients in spontaneously active neurons of Hdh150 mice. Silent neurons were excluded, as in subsequent panels. Mann-Whitney test, p<0.01 (i) Quantification of area under the curve (AUC) of Ca2+ transients. Unpaired t-test, p=0.98 (j) Cumulative frequency distribution of Ca2+ transients in WT (dark grey) and Hdh150 (red) mice. Top, colored categorization of neurons according to their Ca2+ transient frequencies. Two-way ANOVA, group: p<0.0001, time: p<0.0001, Interaction: p<0.0001. (k) Color-coded categorization of neurons according to their Ca2+ transient frequency: ‘low’ (<0.3 trans/min, blue; silent neurons excluded), ‘medium’ (0.3–3 trans/min, orange) and ‘hyper’ (>3 trans/min, red). Each peak is marked by an asterisk. (l) Relative proportion of low, medium and hyperactive neurons in layer 2/3 of the visual cortex in WT (left) and Hdh150 (right) mice. Chi-square test, p<0.01.

https://doi.org/10.7554/eLife.38744.003
Figure 1—source data 1

Numerical values of Figure 1 and associated supplement figures.

https://doi.org/10.7554/eLife.38744.007
Figure 1—source data 2

Code used for the analysis of calcium imaging.

https://doi.org/10.7554/eLife.38744.008
Figure 1—figure supplement 1
Download asset Open asset
Ca2+ events from astrocytes and neurons show clearly distinct kinetics.

(a) Schematic diagram of the two-photon microscope used for high-speed Ca2+ imaging in vivo. The synthetic dye OGB-1 AM loaded in layer 2/3 of mouse visual cortex was excited by pulsed laser light generated by a Ti:sapphire laser (λ = 800 nm), a resonant scanner enabled video-rate imaging. Emitted light was collected by a photomultiplier tube (PMT). (b) Two-photon images of OGB-1 AM staining captured in vivo at depths between 150 and 270 µm from the pial surface in the visual cortex of WT (top) and Hdh150 (bottom) mice. Scale bar: 70 µm. (c) Two-photon image of OGB-1 AM staining in layer 2/3 of the visual cortex. Neurons (open squares) show round shapes with no processes. Astrocytes (inverted open triangle) in contrast, are more intensely stained; both the soma and processes can be visualized. Scale bar: 40 µm. (d) Five representative traces recorded for visually identified neurons (left) and astrocytes (right). Putative astrocytes show slower rise time, longer duration, and slower decay. The onset of events is aligned. Scale bars: 40% dF/F. (e, f) Box-and-whisker plots displaying the time to peak (e) and decay time (f) in neurons and astrocytes. Mann-Whitney test, p<0.01. .

https://doi.org/10.7554/eLife.38744.004
Figure 1—figure supplement 2
Download asset Open asset
Cortical hyperactivity is independent of mHtt aggregation, astrogliosis or apoptotic cell death in presymptomatic VFDO Hdh150 mice.

(a, b, c) Confocal images of sagittal or coronal sections of 13 weeks old WT and Hdh150 mice stained for Htt proteins (a), glial fibrillary acidic protein (GFAP, (b)) and neuronal (NeuN, (c)) and apoptotic markers (cleaved-caspase 3, (c), arrows). Scale bars: 20 (a), 200 (b) and 100 (c) µm.

https://doi.org/10.7554/eLife.38744.005
Figure 1—figure supplement 3
Download asset Open asset
Randomization of experimental data to assess specific spatial clustering.

(a,b) Color-coded spatial distributions and raster plots of the peak of Ca2+ transients in low (blue), medium (orange) and hyperactive (red) neurons recorded in vivo in layer 2/3 of the visual cortex ((a), left) and after randomization of the data ((b), right). Silent cells are also displayed in the color-coded maps (black). (c) Color-coded spatial distribution of silent (black), low (blue), medium (orange) and hyperactive (red) neurons in WT (left) and Hdh150 (right) mice. The maps are equivalent to Figure 1d, but active neurons were subdivided into groups based on Ca2+ transient frequency. Dashed line outlines the boundary of blood vessels. Scale bar: 100 µm. (d) Box-and-whisker plot showing the mean pairwise distance for the different type of neuronal pairs (SS: silent-silent, SL: silent-low, SM: silent-medium, SH: silent-hyper, LL: low-low, LM: low-medium, LH: low-hyper, MM: medium-medium, MH: medium-hyper, HH: hyper-hyper) in WT (filled dark grey) and Hdh150 (filled red) mice. The experimental data were compared to randomized data (WT rand and Hdh150 rand, open dark grey and red, respectively). No significant difference was observed between groups in WT and Hdh150 mice. This indicated an absence of spatial clustering among any of the subgroups of active neurons. Mann-Whitney test, not significant, see Table 1 for p-values.

https://doi.org/10.7554/eLife.38744.006
Figure 1—video 1
Download asset
In vivo two-photon images of mouse visual cortex performed at different depths (indicated in the upper left corner) after multi-bolus loading with OGB-1 AM.

Scale bar: 50 µm.

https://doi.org/10.7554/eLife.38744.009
Figure 1—video 2
Download asset
Representative time-lapse of in vivo two-photon Ca2+ imaging acquired in layer 2/3 of mouse visual cortex showing single-cell Ca2+ transients.

Scale bar: 40 µm.

https://doi.org/10.7554/eLife.38744.010
Figure 2 with 2 supplements
Download asset Open asset
Presymptomatic Hdh150 mice exhibit an increased synchronicity of cortical microcircuits.

(a) Color-coded Pearson’s r matrices calculated from representative recordings of WT (left) and Hdh150 (right) mice. Silent cells were excluded from the analysis. Right, color-coded scale of Pearson’s r values. (b) Overall Pearson’s correlation coefficient (Pearson's r) in WT (dark grey) and Hdh150 (red) mice for experimental (filled) and randomized (open) raster data. Mann-Whitney test, WT vs. Hdh150 p<0.05; WT vs. WT rand p<0.0001; Hdh150 vs. Hdh150 rand p<0.0001 (c) Pearson’s r for combinations of neuronal pairs (LL: low-low, LM: low-medium, LH: low-hyper, MM: medium-medium, MH: medium-hyper, HH: hyper-hyper) in WT (dark grey) and Hdh150 (red) mice. * pairwise comparisons between a pair of WT and Hdh150 mice. # comparisons of functional subgroup pairs to the low-low pair within the same genotype. The pairs involving hyperactive neurons could only be analyzed in Hdh150 mice. Mann-Whitney test, WT vs. Hdh150 mice: MM p<0.05 in Hdh150 mice; compared to LL: MM p<0.05, MH p<0.01, HH p<0.01 (d,e) Relationship between Pearson’s r and distance between neuronal pairs in WT (black) and Hdh150 (red) mice (d) and randomized data (e). Lines represent the linear fit of WT and Hdh150 experimental data. Two-way ANOVA (d) Genotype: p<0.0001 Distance: p=0.97, Interaction: p=0.3, (e) Genotype = 0.35, p=0.3, Interaction: p=0.8.

https://doi.org/10.7554/eLife.38744.012
Figure 2—source data 1

Numerical values of Figure 2 and associated supplement figures.

https://doi.org/10.7554/eLife.38744.015
Figure 2—figure supplement 1
Download asset Open asset
Randomization of experimental data to assess specific network synchronicity.

(a,b) Comparison of Pearson’s r for different functional subgroup pairs in WT experimental and randomized data (a) and Hdh150 data (b), *p<0.05, **p<0.01 and ***p<0.001, Mann-Whitney test. #p<0.05, ##p<0.01, in comparisons of functional subgroup pairs to the low-low pair within the same genotype.

https://doi.org/10.7554/eLife.38744.013
Figure 2—figure supplement 2
Download asset Open asset
Presymptomatic Hdh150 mice did not exhibit alteration of mitochondria respiration.

(a,b) Scheme of the Oroboros O2K respirometer and typical traces obtained from high-resolution respirometry of microdissected cortical tissue from male WT or Hdh150 mice. (c) Box-and-whisker plot depicting the O2 flow in n = 6 mice per genotype. No difference was observed indicating that mitochondria respiration is similar in the two genotypes. Mann-Whitney test, not significant, see Table 1 for p-values.

https://doi.org/10.7554/eLife.38744.014
Figure 3 with 2 supplements
Download asset Open asset
Presymptomatic VFDO Hdh150 mice exhibit anxiolytic behavior.

(a) Representative travel pathways of WT (left) and presymptomatic Hdh150 (right) mice analyzed in a 5 min open field test. (b) Increased explorative behavior of Hdh150 animals compared to the WT mice. Mann-Whitney test, p<0.05.

https://doi.org/10.7554/eLife.38744.016
Figure 3—source data 1

Numerical values of Figure 3 and associated supplement figures.

https://doi.org/10.7554/eLife.38744.018
Figure 3—figure supplement 1
Download asset Open asset
Presymptomatic VFDO Hdh150 mice did not exhibit deficit in visual discrimination test and explorative behavior in novel object recognition test.

(a) Schema of the visual discrimination task set-up. Left, front view of the touch screen panel. Right, top view of the complete test set-up. A monitor is placed at the end of the unit which simultaneously displays the correct and false choice. Both WT and presymptomatic VFDO Hdh150 mice were trained to choose the correct screen and for each correct choice made, a food pellet was released from a reward dispenser placed on the other end of the unit. (b) Graph representing time course of the training sessions of WT (dark grey) and presymptomatic Hdh150 (red) mice. Training sessions were carried out for both groups; mice that made at least 70% correct choice for 3 consecutive days were considered for discrimination analysis. After a training period of 7 days, mice were able to perform tasks successfully reaching the 70% criterion (dashed line). Note that no significant difference was observed between WT and Hdh150 mice during the training of visual discrimination task. Repeated measures two-way ANOVA, genotype p=0.6; time p<0.0001; interaction p=0.6. (c,d) Time course of visual performance in WT (dark grey) and Hdh150 (red) mice during visual discrimination first of black and white screens (c) and then of black and grey screens (d). c: Repeated measures two-way ANOVA, genotype p=0.5; time p<0.0001; interaction p=0.03. d: Repeated measures two-way ANOVA, genotype p=0.8; time p<0.01; interaction p=0.9. (e) 9-week-old transgenic Hdh150 mice and wildtype littermates received metformin containing (5 mg/ml, met) or pure water over a period of 3 weeks. Groups of WT, Hdh150, WT met and Hdh150 met were analyzed in an open-field test and total distance travelled was measured. Mann-Whitney test, p=0.3.

https://doi.org/10.7554/eLife.38744.017
Figure 3—video 1
Download asset
Example of visual discrimination task performed by a trained mouse, real time.
https://doi.org/10.7554/eLife.38744.019
Figure 4 with 2 supplements
Download asset Open asset
Metformin reduces translation rates of mutant HTT through MID1/PP2A protein complex in vitro and decreases both S6 phosphorylation and mutant Htt protein load in Hdh150 animals.

(a) FLAG-HTT detected on a filter retardation assay after treatment with and without 1 mM and 2.5 mM metformin. Quantification on right panel. Mann-Whitney test, control vs. 1 mM metformin p=0.08; control vs. 2.5 mM metformin, p<0.05. (b) Stable cell line expressing FLAG-HTT exon1 with 83 CAG repeats transfected with MID1-specific siRNAs or control siRNAs in the presence or absence of 2.5 mM metformin. FLAG-HTT detected on a filter retardation assay. Efficiency of the knock-down including Actin as a loading control is shown on a western blot (left panel). Quantification of filter retardation assay on right panel. Mann-Whitney test, control siRNA vs. MID1 siRNA p<0.01; control siRNA vs. MID1 siRNA + metformin p<0.05. (c) Protein translation rate of GFP-tagged mutant Htt exon1 (49 CAG repeats) in primary cortical neurons measured in a FRAP-based assay, over a time frame of 4 hr. Lines show the GFP-signal intensity over time in mock-treated (control) and metformin-treated (1 mM and 2.5 mM) cells. Lines represent means, shadowed areas standard deviations. Repeated measures two-way ANOVA, treatment p<0.01, time p<0.0001; interaction p<0.0001. (d) Protein translation rate measured in a FRAP-based assay (see c). Lines show the GFP-signal intensity over time in mock-treated (control), metformin-treated (2.5 mM), ocadaic acid (OA)-treated and metformin +OA-treated cells. Shadowed areas show SEM. Repeated measures two-way ANOVA, treatment p<0.01, time p<0.0001, interaction p<0.0001. (e) Transgenic Hdh150 mice received metformin-containing water (5 mg/ml, Hdh150 +metformin) or pure water (Hdh150) over a period of 3 weeks. Whole brain lysates were analyzed for the phosphorylation of S6, the expression of total S6, mHtt and wtHtt on western blots. Representative western blots are shown. (f) Quantification of pS6 relative to S6. Unpaired t-test, p<0.05. (g) mHtt and wt Htt proteins of prefrontal cortex lysates analyzed on western blots after 11 weeks of treatment with metformin (5 mg/ml, Hdh150 +metformin) or pure water (Hdh150). Representative western blots are shown. (h) Quantification of mHtt relative to wtHtt. Treatment of 5 mg/ml metformin in the drinking water showed a significant reduction of mHtt protein compared to water control treatment. Unpaired t-test p <<0.05 (i) Quantification of mHtt relative to Gapdh. Unpaired t-test, p<0.01. (j) Quantification of wtHtt relative to Gapdh. Unpaired t-test, p=0.88.

https://doi.org/10.7554/eLife.38744.020
Figure 4—source data 1

Numerical values of Figure 4 and associated supplement figures.

https://doi.org/10.7554/eLife.38744.023
Figure 4—figure supplement 1
Download asset Open asset
Metformin reduces mutant Htt protein translation and does not change drinking behavior of Hdh150CAG animals.

(a) GFP-tagged mutant (49 CAG repeats- Q49) Htt exon1 was expressed in N2A cells and protein translation rate were measured in a FRAP-based assay, in which the GFP signal of transfected cells is removed by photobleaching and the synthesis rate of freshly translated GFP-tagged protein is measured over a time frame of 4 hr. Lines show the GFP-signal intensity over time in mock-treated (control) and metformin (1 mM and 2.5 mM) treated cells. Shadowed areas show standard deviations. Repeated measures two-way ANOVA, treatment p=0.03; time p<0.0001; interaction p<0.0001. (b) Male, 9-week-old Hdh150CAG animals were fed with 5 mg/ml metformin in the drinking water (metformin) or with pure water (no metformin) and observed over 21 days. The water consumption was monitored every day. Lines represent means, shadowed areas show ±SEM. Repeated measures two-way ANOVA, treatment p=0.3; time p=0.06; interaction p=1. (c) Transgenic Hdh150 mice received metformin-containing water (5 mg/ml, Hdh150 +metformin) or pure water (Hdh150) over a period of 3 weeks. Whole brain lysates were analyzed for the expression of mHtt and wtHtt on western blots. Representative western blots are shown. (d) Quantification of mHtt relative to wtHtt. Unpaired t-test, p=0.18.

https://doi.org/10.7554/eLife.38744.021
Figure 4—figure supplement 2
Download asset Open asset
Metformin treatment rescues motility impairment in a C.elegans model.

(a) Q40::YFP nematodes were treated with 500 mM of metformin or pure water (control): Images of nematodes with and without metformin treatment for 5 days (left panel): After 5 days of metformin treatment, the number of aggregates was significantly reduced (right panel): Mann-Whitney test, p<0.0001. (c) Q40::YFP worms were grown on heat-inactivated bacteria on plates pre-treated with either 5 mM or 10 mM of metformin or with pure water (control). After 5 days of metformin treatment, the number of inclusion bodies was analyzed. Mann-Whitney test, control vs 5 mM metformin, p=0.008; control vs 10 mM metformin, p<0.0001. (d,e) RNAi knockdown of the MID1-ortholog arc-1 was performed in Q40::YFP C. elegans. After 5 days, the number of inclusion bodies (d) and liquid thrashing events (e) were analyzed. Mann-Whitney test, p<0.0001.

https://doi.org/10.7554/eLife.38744.022
Figure 5 with 1 supplement
Download asset Open asset
Metformin treatment reverses pathological neuronal network activity and behavioral abnormalities in presymptomatic VFDO Hdh150 mice.

(a) Representative traces of spontaneous Ca2+ transients of 10 neurons recorded in vivo in WT and Hdh150 mice after metformin treatment. Vertical scale bar: 40% dF/F. (b) Relative proportion of spontaneously active neurons in WT (dark grey), Hdh150 (red), WT metformin-treated (light grey) and Hdh150 metformin-treated (light red) mice. Mann-Whitney test, WT vs. Hdh150, p<0.05; Hdh150 vs. Hdh150 met, p<0.05; Hdh150 vs. WT met, p<0.05. (c) Significant reduction in the spontaneous Ca2+ transient frequency to WT levels in Hdh150 mice after metformin treatment (red vs. light red). Mann-Whitney test, WT vs. Hdh150, p<0.01; Hdh150 vs. Hdh150 met, p<0.01; Hdh150 vs. WT met, p<0.01. (d) Cumulative frequency distributions of Ca2+ transients in WT (dark grey), Hdh150 (red), metformin-treated WT (light grey) and metformin-treated Hdh150 (light red) mice. Top, color-coding of active neurons by frequency. Two-way ANOVA test, Group: p<0.0001; Time: p<0.0001; Interaction: p<0.0001. (e) Pie charts showing the relative proportion of low (blue), medium (orange) and hyperactive (red) neurons in layer 2/3 of the visual cortex in WT (top) and Hdh150 (bottom) mice after metformin treatment. Chi-square test, p=0.62, Chi-square = 0.24. (f) Comparison of Pearson’s r between a pair of neurons in WT (dark grey), Hdh150 (red), metformin-treated WT (light grey) and metformin-treated Hdh150 (light red) mice. Mann-Whitney test, WT vs. Hdh150, p<0.05, Hdh150 vs. Hdh150 met, p<0.01, Hdh150 vs. WT met, p<0.01. (g) Relationship between pairwise Pearson’s r and pairwise distance in metformin-treated WT (light grey) and Hdh150 (light red) mice. Two-way ANOVA test, group p<0.0001; Distance p=0.09; Interaction p<0.001. (h) Representative travel pathways of a metformin-treated WT (left) and pre-symptomatic Hdh150 (right) mice analyzed in a 5 min open-field test. (i) Decrease in the explorative behavior of metformin-treated Hdh150 animals. Mann-Whitney test, WT vs. Hdh150, p<0.01; Hdh150 vs. Hdh150 met, p<0.001; Hdh150 vs. WT met, p<0.05; WT vs. Hdh150 met, p=0.8.

https://doi.org/10.7554/eLife.38744.024
Figure 5—source data 1

Numerical values of Figure 5 and associated supplement figures.

https://doi.org/10.7554/eLife.38744.026
Figure 5—figure supplement 1
Download asset Open asset
Metformin treatment does not affect cell density or Ca2+ transient dynamics

(a) Two-photon images of OGB-1 AM staining collected in vivo at different depths (from 150 to 270 µm from pial surface) in the visual cortex of WT and Hdh150 mice after metformin treatment. Scale bar: 70 µm. (b) Quantification of the density of stained cells in layer 2/3 of the visual cortex in WT (black), Hdh150 (red, n = 10 animals), metformin-treated WT (light grey) and metformin-treated Hdh150 (light red) mice. No significant difference was found in the cell density across genotypes. Unpaired t-test, p=0.7. (c) Area under the curve (AUC) of Ca2+ transients in WT (black), Hdh150 (red), metformin-treated WT (light grey) and metformin-treated Hdh150 (light red) mice. Unpaired t-test, WT vs. WT met, p<0.05. (d) Box-and-whisker plot showing Pearson’s r between different combinations of neuron pairs (LL: low-low, LM: low-medium, LH: low-hyper, MM: medium-medium, MH: medium-hyper, HH: hyper-hyper) in metformin-treated WT (light grey) and metformin-treated Hdh150 (light red) mice. There was no statistical difference between WT and Hdh150 mice after metformin treatment. # a statistical difference between a pair vs. LL within the same genotype. Unpaired t-test, WT met: LL vs. LM, p<0.05; LL vs. MM, p<0.0001; Hdh150 met: LL vs. MM, p<0.01. (e) Comparison of Pearson’s r between different combinations of neuron pairs in WT (dark grey), Hdh150 (red), metformin-treated WT (light grey) and metformin-treated Hdh150 (light red) mice. * a statistical difference between WT within the same functional subgroup. LM WT vs LM Hdh150 and MM WT vs MM Hdh150 p<0.05. (f) Pairwise distance for the different neuronal pairs (SS: silent-silent, SL: silent-low, SM: silent-medium, SH: silent-hyper, LL: low-low, LM: low-medium, LH: low-hyper, MM: medium-medium, MH: medium-hyper, HH: hyper-hyper) in metformin-treated WT (light grey) and metformin-treated Hdh150 (light red) mice. No significant difference between metformin-treated WT and metformin-treated Hdh150 mice could be found. Mann-Whitney test, not significant, see Table 1 for p-values.

https://doi.org/10.7554/eLife.38744.025

Tables

Table 1
Statistics
https://doi.org/10.7554/eLife.38744.011
FigureTestValuesN
Figure 1eUnpaired t test, two-tailedNS, p=0.71WT n = 11 mice; Hdh150 n = 10 mice
Figure 1fUnpaired t test, two-tailedp=0.023WT n = 1204 cells in eight mice;
Hdh150 n = 933 cells in six mice
Figure 1hMann-Whitney testp=0.006WT n = 765 cells in eight mice;
Hdh150 n = 695 cells in six mice
Figure 1iUnpaired t test, two-tailedNS, p=0.98WT n = 765 cells in eight mice;
Hdh150 n = 695 cells in six mice
Figure 1jTwo-way ANOVA testGroup: p<0.0001, Df = 1, F = 85.96, time: p<0.0001, Df = 16, F = 147, Interaction: p<0.0001, F = 4.9, Df = 16WT n = 765 cells in eight mice;
Hdh150 n = 695 cells in six mice
Figure 1lChi-square testp=0.002, df = 1, Chi-square = 9.127WT n = 765 cells in eight mice;
Hdh150 n = 695 cells in six mice
Figure 2bMann-Whitney testWT vs Hdh150 p=0.03; WT vs WT rand p<0.0001; Hdh150 vs Hdh150 rand p<0.0001WT n = 26126 Pearson's r in eight
mice; Hdh150 n = 58050 Pearson's
r in six mice
Figure 2cMann-Whitney testWT vs Hdh150 mice: MM p=0.041 in Hdh150 mice; compared to LL: MM p=0.0496, MH p=0.005, HH p=0.009WT n = 26126 Pearson's r in eight
mice; Hdh150 n = 58050
Pearson's r in six mice
Figure 2dTwo-way ANOVA testGroup: p<0.0001, Df = 1, F = 58.20
Distance: p=0.97, Df = 15, F = 0.44
Interaction: p=0.33, df = 15, F = 1.13		WT n = 26126 distances in
eight mice; Hdh150 n = 58050 distances in six mice
Figure 2eTwo-way ANOVA testp=0.35, Df = 1, F = 0.86WT rand n = 26126 distances
in eight mice; Hdh150 rand
n = 58050 distances in six mice
Figure 3bMann-Whitney testp=0.031119WT n = 10 mice; Hdh150 n = 13 mice
Figure 4aMann-Whitney testcontrol vs 1 mM metformin p=0.084521, control vs 2.5 mM metformin p=0.023231Control n = 10, 1 mM metformin
n = 11, 2.5 mM metformin n = 10.
Figure 4bMann-Whitney testcontrol siRNA vs MID1 siRNA p=0.008, control siRNA vs MID1 siRNA + metformin p=0.015Control siRNA n = 6, MID1 siRNAn = 6, MID1 siRNA + metformin n=6.
Figure 4cRM two-way ANOVATreatment: p=0.0082, Df = 2, F = 5
Time: p<0.0001, Df = 47, F = 27.5
Interaction: p<0.0001, Df = 94, F = 5.9		ncontrol = 47, nmetformin 1mM = 44,
nmetformin 2.5mM = 35
Figure 4dRM two-way ANOVATreatment: p=0.0021, Df = 3, F = 5.1
Time: p<0.0001, Df = 47, F = 64.1
Interaction: p<0.0001, Df = 141, F = 6.1 p<0.0001		ncontrol = 46, nmetformin = 49,
nmetformin+OA = 51, nOA = 43
Figure 4fUnpaired t-testp=0.0473Hdh150 n = 6; Hdh150
metformin n = 6
Figure 4hUnpaired t-testp=0.0467Hdh150 n = 3; Hdh150
metformin n = 3
Figure 4iUnpaired t-testp=0.0062Hdh150 n = 3; Hdh150
metformin n = 3
Figure 4jUnpaired t-testp=0.8766Hdh150 n = 3; Hdh150
metformin n = 3
Figure 5bMann-Whitney testWT vs Hdh150 p=0.023, Hdh150 vs Hdh150 met p=0.03, Hdh150 vs WT met p=0.012WT n = 1204 cells in eight mice;
Hdh150 n = 933 cells in six mice;
WT met n = 1915 cells in nine mice;
Hdh150 met n = 1585 cells in
six mice
Figure 5cMann-Whitney testWT vs Hdh150 p=0.006; Hdh150 vs Hdh150 met p=0.007; Hdh150 vs WT met p=0.008WT n = 765 cells in eight mice;
Hdh150 n = 695 cells in six mice;
WT met n = 1199 in nine mice;
Hdh150 met n = 1014 cells in
six mice
Figure 5dTwo-way ANOVA testGroup: p<0.0001, Df = 3, F = 61.80
Time: p<0.0001, Df = 16, F = 345.9
Interaction: p<0.0001, Df = 48, F = 3.64		WT n = 765 cells eight mice;
Hdh150 n = 695 cells six mice;
WT met n = 1199 cells nine mice;
Hdh150 met n = 1012 cells six
mice
Figure 5eChi-square testp=0.62, df = 1; Chi-square = 0.24WT n = 765 cells eight mice;
Hdh150 n = 695 cells six mice;
WT met n = 1199 cells nine mice;
Hdh150 met n = 1012 cells six mice
Figure 5fMann-Whitney testWT vs Hdh150 p=0.03; Hdh150 vs Hdh150 met p=0.002; Hdh150 vs WT met p=0.003WT n = 765 cells eight mice;
Hdh150 n = 695 cells six mice;
WT met n = 1199 cells nine mice;
Hdh150 met n = 1012 cells six mice
Figure 5gTwo-way ANOVA testGroup: p<0.0001, Df = 3, F = 85.96
Distance: p=0.99, Df = 45, F = 0.58
Interaction: p=0.0007, Df = 15, F = 2.63		WT n = 765 cells eight mice;
Hdh150 n = 695 cells six mice;
WT met n = 1199 cells nine mice;
Hdh150 met n = 1012 cells six mice
Figure 5iMann-Whitney testWT vs Hdh150 p=0.002, Hdh150 vs Hdh150 Met p=0.002, Hdh150 vs. WT met p=0.02, WT vs Hdh150 Met p=0.82WT n = 10; Hdh150 n = 13; WT
met n = 6; Hdh150 met n = 8 mice
Figures supplementsTestvaluesn
Figure 1—figure supplement 1eMann-Whitney testp=0.002n = 6 neurons, n = 6 astrocytes
Figure 1—figure supplement 1fMann-Whitney testp=0.002n = 6 neurons, n = 6 astrocytes
Figure 1—figure supplement 3dMann-Whitney testIn WT mice: SS vs SL p=0.5, SS vs SM p=0.9, SS vs LL p=0.1, SS vs LM p=0.2, SS vs MM p=0.1, SL vs SM p=0.4, SM vs LL p=0.1, SM vs MM p=0.1, LL vs MM p=0.9, LM vs MM p=0.4, LM vs SM, p=0.2.
In Hdh150 mice: SS vs SL p=0.8, SS vs SM p=0.5, SS vs SH p=0.9, SS vs SH p=0.9, SS vs LL p=0.9, SS vs LM p=0.9, SS vs LH p=1, SS vs MM p=0.1, SS vs MH p=0.1, SS vs HH p=0.4, SL vs SM p=0.8, SL vs SH p=0.9, SL vs LL p=0.9, SL vs LM p=0.9, SL vs LH p=0.8, SL vs MM p=0.5, SL vs MH p=0.6, SL vs HH p=0.7, SN vs SH p=0.6, SM vs LL p=0.7, SM vs LM p=0.6, SN vs LH p=0.4, SM vs MM p=0.3, SN vs MH p=0.4, SN vs HH p 0 0.6, SH vs LL p=0.7, SH vs LM p=1, SH vs LH p=1, SH vs MM p=0.4, SH vs MH p=0.3, SH vs HH p=0.6, LL vs LM p=0.9, LL vs LH p=1, LL vs MM p=0.5, LL vs MH p=0.7, LL vs HH p=0.8, LM vs LH p=0.6, LM vs MM p=0.3, LM vs MH p=0.3, LM vs HH p=0.5, LH vs MM p=0.3, LH vs MH p=0.3, LH vs HH p=0.5, MM vs MH p=0.7, NN vs HH p=0.8, MH vs HH p=0.9
In WT vs WT rand: WT mice: SS p=0.5, SL p=0.7, SM p=0.3, LL p=0.3, LM p=0.8, MM p=0.1.
In Hdh150 vs Hdh150 rand: SS p=0.6, SL p=1, SM p=1, SH p=0.6, LL p=0.7, LM p=0.6, LH p=0.2, MM p=0.6, MH p=0.8, HH p=0.7 NS		WT n = 72595 distances eight
mice; Hdh150 n = 132009
distances six mice
Figure 2—figure supplement 1aMann-Whitney testLL p=0.005; LM p<0.0001; MM p<0.0001WT n = 26126 Pearson's r in eight mice
Figure 2—figure supplement 1bMann-Whitney testLL p=0.004; LM p=0.0006; LH p=0.041; MM p<0.0001; MH p=0.0002; HH p=0.01. In Hdh150 mice, compared to LL: MM p=0.049; MH p=0.005; HH p=0.009Hdh150 n = 58050 Pearson's
r in six mice
Figure 2—figure supplement 2cMann-Whitney testroutine p=0.4, leak p=0.5, CI p=0.6, CI + CII p=0.5, ETS p=0.2WT n = 6 mice; Hdh150
n = 6 mice
Figure 3—figure supplement 1bRM two-way ANOVAGenotype: p=0.6, Df = 1, F = 0.3
Time: p<0.0001, Df = 6, F = 86.1
Interaction: p=0.6, Df = 6, F = 0.7		WT n = 16 mice; Hdh150
n = 13 mice
Figure 3—figure supplement 1cRM two-way ANOVAGenotype: p=0.5, Df = 1, F = 0.5
Time: p<0.0001, Df = 9, F = 35.4
Interaction: p=0.03, Df = 9, F = 2.2		WT n = 16 mice; Hdh150
n = 13 mice
Figure 3—figure supplement 1dRM two-way ANOVAGenotype: p=0.8, Df = 1, F = 3.4
Time: p<0.01, Df = 6, F = 3.4
Interaction: p=0.97, Df = 6, F = 0.2		WT n = 16 mice; Hdh150 n = 13 mice
Figure 3—figure supplement 1eMann-Whitney testp=0.3WT n = 10; Hdh150 n = 13; WT
met n = 6; Hdh150 met n = 8 mice
Figure 4—figure supplement 1aRM two-way ANOVATreatment p=0.0342, Df = 2, F = 3.5;
Time p<0.0001, Df = 47, F = 45.3; Interaction p<0.0001, Df = 94, F = 3.5		ncontrol = 36, nmetformin 1mM = 42,
nmetformin 2.5mM = 44
Figure 4—figure supplement 1bRM two-way ANOVATreatment p=0.2986, Df = 1, F = 1.9;
Time p=0.0654, Df = 20, F = 1.8;
Interaction p=0.9988, Df = 20, F = 0.3.		control n = 7, metformin n = 8
Figure 4—figure supplement 1dcUnpaired t-testp=0,1826Hdh150 n = 4; Hdh150 metformin
n = 4
Figure 4—figure supplement 2aMann-Whitney testp<0.0001control n = 65, metformin n = 65
Figure 4—figure supplement 2bMann-Whitney testQ40 vs. Q40 Met p<0.0001Q40n = 43, Q40 Met n = 43
Figure 4—figure supplement 2cMann-Whitney testCtrl vs. 5 mM p=0.0078, Ctrl vs. 10 mM p<0.0001n = 45
Figure 4—figure supplement 2dMann-Whitney testp<0.0001Control n = 72, arc-1 RNAi n = 74
Figure 4—figure supplement 2eMann-Whitney testp<0.0001Control n = 60, arc-1 RNAi n = 62
Figure 5—figure supplement 1bUnpaired t test, two-tailedWT met vs. Hdh150 met p=0.39, WT vs. WT met p=0.7, Hdh150 vs. Hdh150 met p=0.9WT n = 11; Hdh150 n = 10; WT met
n = 9; Hdh150 met n = 6 mice
Figure 5—figure supplement 1cUnpaired t test, two-tailedWT vs WT met p=0.024WT n = 765 cells eight mice;
Hdh150 n = 695 cells six mice;
WT met n = 1199 cells nine mice; Hdh150
met n = 1012 cells six mice
Figure 5—figure supplement 1dUnpaired t test, two-tailedWT met: LL vs LM p=0.04 and LL vs MM p<0.0001; Hdh150 met: LL vs LM p=0.4, LL vs MM p=0.004WT met n = 57140 Pearson's r in
nine mice; Hdh150 met n = 49535
Pearson's r in six mice
Figure 5—figure supplement 1eMann-Whitney testLM WT vs LM Hdh150; MM WT vs MM Hdh150 p=0.04WT n = 26126 Pearson's r in eight mice;
Hdh150 n = 58050 Pearson's r in
six mice; WT met n = 57140
Pearson's r in nine mice; Hdh150
met n = 49535 Pearson's r in six mice
Figure 5—figure supplement 1fMann-Whitney testSS p=0.1, SL p=0.1, SM p=0.1, LL p=0.4, LM p=0.3, MM p=0.2WT met n = 140467 distances
in nine mice; Hdh150 met
n = 117485 distances in six mice
Key resources table
Reagent type
(species)
or resource		DesignationSource or referenceIdentifiersAdditional
information
Genetic reagent
(C.elegans)		C.elegans strain AM141,
genotype rmIs133		University
of Minnesota		AM141 (WormBase ID)
RRID:WB-STRAIN:AM141
Genetic reagent
(M. Musculus)		Hdh150Jackson
Laboratory		#004595
RRID:IMSR_JAX:004595		Only males
were used
Cell line
(H. sapiens)		HEK 293T/17Scherzinger et al. (1997)CRL-11268
RRID:CVCL_1926
Cell line
(M. Musculus)		Neuro-2AATCCATCC CCL131
RRID:CVCL_0470
Cell line
(M. Musculus)		primary cortical
neurons		isolated from
NMRI (Janvier)
Transfected
construct		pEGFP-C1-
Httex1		Krauss et al., 2013Self-cloned
Antibodyrabbit anti-
activated-caspase-3		Cell signaling9661
RRID:AB_2341188		1 to 500
Antibodymouse anti-NeuNMilliporeMAB377
RRID:AB_2298772		1 to 500
Antibodyrabbit anti-GFAPDakoZ0334
RRID:AB_10013382		1 to 1500
Antibodyrabbit anti-HttAbcamab109115
RRID:AB_10863082		WB: 1:850, IHC:
1:200
AntibodyAlexa 546 goat
anti-rabbit		InvitrogenA11035
RRID:AB_143051		1 to 300
AntibodyAlexa 647 goat
anti-mouse		InvitrogenA21235
RRID:AB_141693		1 to 300
AntibodyCy2 donkey
anti-rabbit		Jackson Immuno Research711-225-152 RRID:AB_23406121 to 300
AntibodyAlexa 488 goat
anti-rabbit		Life technologiesA11008 RRID:AB_1431651 to 200
Antibodyanti-FLAG M2-PeroxidaseSigma-AldrichA8592 RRID:AB_4397021 to 3000
Antibodyrabbit anti-actinSigma-AldrichA2066
RRID:AB_476693		1 to 2000
Antibodyrabbit anti-pS6Cell signaling2215
RRID:AB_2630325		1 to 2000
Antibodymouse anti-GAPDHAbcamab8245
RRID:AB_2107448		1 to 2000
AntibodyHRP-anti-mouseDianova115-035-072
RRID:AB_2338507		1 to 6000
AntibodyHRP-anti-rabbitDianova305-036-003
RRID:AB_2337936		1 to 6000
Antibodygoat anti-rabbit IgG,
AlexaFluor 488
conjugate		Life technologiesA11008
RRID:AB_143165		1 to 200
Sequence-
based reagent		primers 5’-CCC ATT
CAT TGC CTT GCT
GCT AGG-3’ and 5’-CCT
CTG GAC AGG GAA CAG		Sigma-Aldrichcustom
Sequence-
based reagent		siRNA AATTGACAGAGGAGTGTGATCQiagencustom
Sequence-
based reagent		siRNA CACCGCAUCCUAGUAUCACACTTQiagencustom
Sequence-based reagentsiRNA CAGGAUUACAACUUUUAGGAATTQiagencustom
Sequence-based reagentsiRNA TTGAGTGAG
CGCTATGACAAA		Qiagencustom
Sequence-based reagentsiRNA AAGGTGAT
GAGGCTTCGCAAA		Qiagencustom
Sequence-based reagentsiRNA TAGAACGTGATGAGTCATCATQiagencustom
Sequence-based reagentnon siRNA AATTCTCCGAACGTGTCACGTQiagencustom
Chemical
compound, drug		Hoechst33342Sigma-AldrichB2261
CHEBI:51232		1 to 1000
Chemical compound, drugFluoromountSigma-AldrichF4680
Chemical
compound, drug		Fluoroshield Mounting MediumAbcamab104135
Chemical
compound, drug		PBS tablettsgibco18912–014
Chemical compound, drugTriton-XRoth6683.1
CHEBI:9750		0.3%
Chemical
compound, drug		Tween20Roth9127.10.1%
Chemical
compound, drug		Triton X-100Sigma-AldrichT8787 CHEBI:97501 – 0.1%
Chemical
compound, drug		natural donkey
serum		Abcamab7475
RRID: AB_2337258		4 – 2%
Chemical
compound, drug		natural goat
serum		Abcamab7481
RRID:2532945		4 – 2%
Chemical
compound, drug		natural sheep
serum		Abcamab7489
RRID: AB_2335034		20%
Chemical
compound, drug		xylocaineAstraZenecaPUN0804402%
Chemical
compound, drug		isofluraneAbbVie8506 CHEBI:60151–1.55%
Chemical
compound, drug		PBSLife technologies18912–0141 M
Chemical
compound, drug		paraformaldehydeLife technologies15710
CHEBI:31962		diluted to
4%
Chemical
compound, drug		Oregon-Green BAPTA1 AMMolecular probesO68071 mM
Chemical compound, drugEGTASigma-AldrichE4378
CHEBI:30740		0.5 mM
Chemical
compound, drug		MgCl2Sigma-AldrichM2670
CHEBI:86345		3 mM
Chemical
compound, drug		K-lactobionateSigma-AldrichL2398
CHEBI:55481		60 mM
Chemical
compound, drug		TaurineSigma-AldrichT0625
CHEBI:15891		20 mM
Chemical
compound, drug		KH2PO4Sigma-AldrichP5655
CHEBI:63036		10 mM
Chemical
compound, drug		HEPESSigma-AldrichH3375
CHEBI:42334		20 mM
Chemical
compound, drug		SucroseSigma-AldrichS0389
CHEBI:17992		110 mM
Chemical
compound, drug		BSASigma-AldrichA60031 g/L
Chemical
compound, drug		MalateSigma-AldrichM1000
CHEBI:6650		2 mM
Chemical
compound, drug		PyruvateSigma-AldrichP2256
CHEBI: 50144		10 mM
Chemical
compound, drug		GlutamateSigma-AldrichG1626
CHEBI:64243		20 mM
Chemical
compound, drug		ADPSigma-AldrichA2754
CHEBI:16761		5 mM
Chemical
compound, drug		SuccinateSigma-AldrichS2378
CHEBI:63686		10 mM
Chemical
compound, drug		FCCPSigma-AldrichC2920
CHEBI:75458		0.2 µM
Chemical
compound, drug		RotenoneSigma-AldrichR8875
CHEBI:28201		0.1 µM
Chemical
compound, drug		Antimycin ASigma-AldrichA8674
CHEBI:22584		2 µM
Chemical
compound, drug		MgSO4Sigma-Aldrich203726
CHEBI:32599
Chemical
compound, drug		NaClSigma-AldrichS3014
CHEBI:26710
Chemical
compound, drug		Na2HPO4Sigma-AldrichS3264
CHEBI:34683
Chemical
compound, drug		oligofectamineThermo-Fisher12252–0110.2%
Chemical
compound, drug		metforminMP Biomedicals157805
CHEBI:6802		5 mg/ml
Chemical compound, drugureaRoth2317.3
CHEBI:16199		48%
Chemical
compound, drug		TrisRoth4855.2
CHEBI:9754		15 mM
Chemical compound, drugGlycerinRoth3783.1
CHEBI:17754		8.7%
Chemical compound, drugSDSRoth2326.1
CHEBI:8984		1%
Chemical compound, drugmercaptoehanolRoth4227.3
CHEBI:41218		1%
Chemical
compound, drug		protease
inhibitors		Roche04 693 116 0011 tablet
per 50 ml
Chemical compound, drugPhosstopRoche04 906 837 0012 tablets
per 10 ml
Software,
algorithm		GraphPad
Prism		GraphPad
Prism		RRID:SCR_002798http://www.graphpad.com/
Software,
algorithm		Igor Pro
6.22 – 6.37		WavemetricsRRID:SCR_000325http://www.wave
metrics.com/products/igorpro/igorpro.htm
Software,
algorithm		MATLAB R2011aMathworksRRID:SCR_001622https://www.mathworks.com
Software,
algorithm		Code use for
Calcium transient
analysis		this paperthe code is enclosed
as a source file
Software,
algorithm		LaVision BioTec ImSpector
microscopy
software		LaVision BioTecRRID:SCR_015249https://www.lav
isionbiotec.com/
Software,
algorithm		FijiFijiRRID:SCR_002285http://fiji.sc
Software,
algorithm		Image JImage J - NIHRRID:SCR_003070https://imagej
.nih.gov/ij/
Software,
algorithm		EthoVision XT 8.5NoldusRRID:SCR_000441https://www.
noldus.com/EthoVision-XT/New
Software,
algorithm		Image labBioradRRID:SCR_014210http://www.bio-rad.com/en-us/sku/1709690-image-lab-software
Software,
algorithm		Oroboros
DatLab		Oroboros,
Innsbruck,
Austria		http://www.
oroboros.at/index.php?id
=datlab

Additional files

Transparent reporting form
https://doi.org/10.7554/eLife.38744.027

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Isabelle Arnoux
  2. Michael Willam
  3. Nadine Griesche
  4. Jennifer Krummeich
  5. Hirofumi Watari
  6. Nina Offermann
  7. Stephanie Weber
  8. Partha Narayan Dey
  9. Changwei Chen
  10. Olivia Monteiro
  11. Sven Buettner
  12. Katharina Meyer
  13. Daniele Bano
  14. Konstantin Radyushkin
  15. Rosamund Langston
  16. Jeremy J Lambert
  17. Erich Wanker
  18. Axel Methner
  19. Sybille Krauss
  20. Susann Schweiger
  21. Albrecht Stroh
(2018)
Metformin reverses early cortical network dysfunction and behavior changes in Huntington’s disease
eLife 7:e38744.
https://doi.org/10.7554/eLife.38744