1. Structural Biology and Molecular Biophysics
Download icon

Cryo-EM structure of respiratory complex I at work

  1. Kristian Parey
  2. Ulrich Brandt
  3. Hao Xie
  4. Deryck J Mills
  5. Karin Siegmund
  6. Janet Vonck
  7. Werner Kühlbrandt
  8. Volker Zickermann  Is a corresponding author
  1. Max Planck Institute of Biophysics, Germany
  2. Radboud University Medical Centre, The Netherlands
  3. Goethe University Frankfurt, Germany
Research Article
Cite this article as: eLife 2018;7:e39213 doi: 10.7554/eLife.39213
15 figures, 5 tables and 2 additional files

Figures

Figure 1 with 1 supplement
Image processing and two-dimensional classification of particle images.

Electron densities of complex I in the deactive state and under turnover conditions are light blue and magenta. About 30% of the particles belong to a subclass (yellow) which contains the accessory sulfur transferase subunit ST1 known to be bound substoichiometrically to Y. lipolytica complex I (D'Imprima et al., 2016).

https://doi.org/10.7554/eLife.39213.002
Figure 1—figure supplement 1
Raw micrographs and class averages.

Raw micrographs for (A) deactive complex I; (B) complex I under turnover (red circles highlight oxidase molecules). (C) Selection of 2D reference-free class averages of inactive complex I sorted by RELION2.1 in different orientations.

https://doi.org/10.7554/eLife.39213.003
Local resolution and Fourier shell correlation (FSC) curves of (A) deactive complex I and (B) complex I under steady-state turnover conditions.

Left: cryo-EM maps of complex I analysed by ResMap (Kucukelbir et al., 2014) coloured according to local resolution. Right: FSC plots of final masked and refined cryo-EM maps. The map resolution is indicated by the point where the curve crosses the 0.143 threshold (Rosenthal and Henderson, 2003).

https://doi.org/10.7554/eLife.39213.004
Figure 3 with 1 supplement
Cryo-EM map of deactive complex I with fitted models.

(A) Selected regions of the matrix domain. (B) A horizontal cross-section through the membrane arm shows TMH fits. (C) A region of the accessory LYR protein subunit NB4M (Angerer et al., 2017); the acyl chain appended to the phosphopantetheine group of the adjacent acyl carrier protein ACPM1 inserts into the interior of NB4M. Cofactor and acyl chain are drawn as ball-and-stick model.

https://doi.org/10.7554/eLife.39213.005
Figure 3—figure supplement 1
Validation of model refinement.

The FSC curve between the final refined model and the reconstruction from all particles of the deactive data set (blue) indicates a resolution of 4.5 Å. The model was scrambled by random displacement of the atoms up to 0.5 Å and refined against half map 1 to 4.3 Å. The FSC between the refined model and half map 1 (FSCwork, red), and between this model and the reconstruction from the other half of the particles (FSCfree, grey) both indicate the same resolution (4.6 Å) and are similar over the full resolution range, showing that no overfitting of the model to the map has taken place.

https://doi.org/10.7554/eLife.39213.006
Cryo-EM structure of respiratory complex I from Y. lipolytica.

(A) Side view; (B) view from peripheral arm; central subunits (labelled, solid) and accessory subunits (transparent, compare Figure 8) are shown.

https://doi.org/10.7554/eLife.39213.007
Cryo-EM and X-ray structures of deactive complex I are consistent.

(A) With 42 assigned subunits (colour coded as in Figures 4 and 8) and 7515 residues the cryo-EM structure is significantly more complete than the X-ray structure (B) with 15 assigned subunits and 4979 residues (colour coded as in (A). Unassigned parts of the model are grey. Red arrows indicate subunits NI8M, NUYM, NUZM, N7BM, NUMM, cofactors FMN (51 kDa subunit) and NADPH (NUEM subunit) that are missing or incomplete in the X-ray structure. (C) X-ray structure of deactive complex I from Y. lipolytica (Zickermann et al., 2015) (grey) overlaid with the cryo-EM structure of deactive Y. lipolytica complex I (blue).

https://doi.org/10.7554/eLife.39213.008
Docking site of accessory subunit ST1 and extensions of the 30 kDa and ND3 subunits in Y. lipolytica complex I.

(A) ST1 (yellow) binds to N7BM (violet), NUZM (red) and the extended N-terminus of the 30 kDa subunit (blue); (B) N-terminal extension of the 30 kDa subunit (blue oval) and interaction of the C-terminal extension of subunit ND3 with NUFM (yellow oval).

https://doi.org/10.7554/eLife.39213.011
Overlay of membrane arm subunits of complex I from Y. lipolytica and B. taurus.

Top view of membrane arm with subunits of the peripheral arm removed for clarity (Y. lipolytica blue, B. taurus, grey; selected subunits are coloured as indicated). The first three helices of ND2 are missing in bovine complex I and the position of TMH 4 of ND6 is different. These changes result in an incision of the membrane arm of mammalian complex I at the position of ND2. Subunit ND5 of complex I from Y. lipolytica has an extra C-terminal TMH (yellow asterisk [Zickermann et al., 2015]), and TMH 1 of ND4 is oriented differently in the membrane.

https://doi.org/10.7554/eLife.39213.012
Figure 8 with 2 supplements
Accessory subunits of complex I.

Central subunits (see Figure 4) are shown in grey, accessory subunits are labelled and coloured. (A) Side views, (B) view from the matrix (left) and from the intermembrane space (right) with peripheral arm subunits removed for clarity.

https://doi.org/10.7554/eLife.39213.013
Figure 8—figure supplement 1
Assignment of accessory subunits.

Example densities with corresponding sequence stretches are shown for the Zn binding domain of NUMM and for the NADPH binding domain of NUEM. In agreement with secondary structure predictions subunit NUXM has four αhelices, two of which are transmembrane. Side chains were modelled for short sequence stretch in this subunit.

https://doi.org/10.7554/eLife.39213.014
Figure 8—figure supplement 2
Assignment of accessory subunits.

Sequence and structural alignments with bovine complex I (PDB ID 5O31 (Blaza et al., 2018), bovine subunits, orange) are shown for eight subunits that were modelled largely or entirely as poly-alanine.

https://doi.org/10.7554/eLife.39213.015
Unassigned density (orange arrows) at the interface of subunits ND1, 49 kDa, and PSST.

Slice of interface region of membrane and peripheral arm of complex I in the deactive state (model, cartoon representation; selected residues, stick representation; cryo-EM map, mesh). Note that the density is also present in the maps of complex I under steady-state turnover conditions.

https://doi.org/10.7554/eLife.39213.016
Model for subunit ND3 (yellow) and cryo-EM density (grey mesh) of subunit ND3 in the deactive state (left) and under turnover conditions (right).

The central part of the long loop connecting TMH1 and 2 is disordered.

https://doi.org/10.7554/eLife.39213.018
In vitro assay of a minimal respiratory chain of complex I and bo3-type ubiquinol oxidase.

(A) Assay conducted at the substrate concentration used for cryo-EM sample preparation (2 μM complex I, 1 μM oxidase, 2 mM NADH and 200 μM DBQ at 18°C. The reaction was started by addition of NADH. (B) Inhibition of complex I by DQA (blue) and of the Vitreoscilla oxidase by CN- (red).

https://doi.org/10.7554/eLife.39213.019
Complex I in the deactive state and under turnover conditions.

The model for complex I in the deactive state (colour) is overlaid with the cryo-EM density (grey) for complex I under turnover conditions. There are no differences in overall structure, so there is no indication that the matrix arm moves relative to the membrane arm during turnover. Occupation and conformational changes of the substrate binding sites are shown in Figure 13.

https://doi.org/10.7554/eLife.39213.020
Substrate binding sites of complex I.

(A) Under steady-state turnover conditions NADH (mesh, cryo-EM density) binds to the FMN cofactor and residues of the 51 kDa subunit; (B) ubiquinone binding site in the deactive state (mesh, cryo-EM density; 49 kDa subunit, green; PSST subunit, blue) and under steady-state turnover (C). The ubiquinone headgroup (purple) binds between the β1-β2 loop of the 49 kDa subunit and helix α2 of PSST. (D) This binding site overlaps with the position of the toxophore of decyl-quinazolineamine (orange) that was modelled based on anomalous diffraction of brominated inhibitor derivatives in the X-ray structure of Y. lipolytica complex I (Zickermann et al., 2015).

https://doi.org/10.7554/eLife.39213.021
Alternating binding positions of ubiquinone support a two-state stabilization change mechanism for respiratory complex I (Brandt, 2011).

(A) ubiquinone and Tyr144 of the 49 kDa subunit (stick representation) and the β1-β2 loop of the 49 kDa and helix α2 and FeS cluster N2 of the PSST subunit in the ubiquinone binding pocket of Y. lipolytica complex I (green) were superimposed on ubiquinone and the corresponding structures in T. thermophilus (grey). The position of ubiquinone in T. thermophilus (PDB ID: 4HEA) was fitted according to Figure 4 in (Baradaran et al., 2013). The position of ubiquinone in T. thermophilus is assigned to the E-state (E) while the position of ubiquinone determined in our study is assigned to the P-state (P). (B) Electron transfer from iron-sulfur cluster N2 occurs in the E-state (grey), while ubiquinone intermediates are protonated in the P-state (green). The stabilization of negatively charged redox intermediates of ubiquinone drive the transition from the E- to the P-state, changing the binding site for the ubiquinone headgroup. This would create conformational and electrostatic strain in the loops lining the ubiquinone binding pocket. (C) The strain provides the energy for a power stroke transmitted through a chain of titratable residues (orange) into the membrane arm, where it drives the proton pump modules (red dots) (Zickermann et al., 2015).

https://doi.org/10.7554/eLife.39213.022
Author response image 1
Density for ubiquinone headgroup.

View from the membrane arm into the ubiquinone binding pocket. Overlay of density maps (deactive, blue; turnover conditions, red; model for complex I under turnover conditions). Note that the blue map has slightly higher resolution and that the b1 b2 loop changes between the two states.

https://doi.org/10.7554/eLife.39213.027

Tables

Table 1
Data collection, refinement and model statistics.
https://doi.org/10.7554/eLife.39213.009
Deactivesteady-state turnover
Data collection
Microscope

FEI Tecnai Polara

FEI Titan Krios
CameraGatan K2 SummitFalcon III
Voltage (kV)
Nominal magnification
Calibrated pixel size (Å)
300
200,000x
1.09
300
75,000x
1.053
Total exposure (e-2)60.530.7–40.7
Exposure rate (e-/pixel/s)
Number of frames
9
40
0.4
81
Defocus range (μm)1.5–3.01.5–4.5
Image processing
Motion correction software

MotionCor2

MotionCor2
CTF estimation softwareCTFFIND4Gctf
Particle selection softwareEMAN boxer and RELION2.1RELION2.1
Initial/final micrographs3,110/3,1105,964/5,650
Particles selected271,443273,581
Applied B-factor (Å2)−142−215
Final resolution (Å)4.34.5
Refinement statistics
Modeling software

COOT, PHENIX
Number of residues7515
Map CC (whole unit cell)0.786
RMS deviations
Bond-lengths (Å)
0.0099
Bond-angles (°)1.52
Av. B-factor (Å2)151.46
Ramachandran plot
Outliers (%)

0.74
Allowed (%)13.43
Favoured (%)85.83
Rotamer outliers (%)0.71
Molprobity score2.11
All-atom clashscore8.55
PDB ID6GCS
Table 2
Composition of subunits.
https://doi.org/10.7554/eLife.39213.010
Subunithuman/bovineChainTotal residues/
range built
Modelled with
side chains
Modelled as
poly-alanine
[%] residues
modelled
[%] with
side chains
[%]
unknown
central subunits
NUAMNDUFS1/
75 kDa
A694/
1–691
1–691099991
NUBMNDUFV1/
51 kDa
B470/
15–457
15–437437–45795906
NUCMNDUFS2/
49 kDa
C444/
28–443
58–67
77–443
28–57
68–76
93857
NUGMNDUFS3/
30 kDa
G251/
1–232
30–1891–29
190–232
92648
NUHMNDUFV2/
24 kDa
H215/
3–187
23–1873–22867814
NUIMNDUFS8/
TYKY
I198/
19–198
26–19819–2691879
NUKMNDUFS7/
PSST
K183/
15–183
15–183092928
NU1MNU1M/
ND1
1341/
1–340
1–179
184–205
217–251
268–340
180–183
206–216
252–267
100910
NU2MNU2M/
ND2
2469/
1–85
99–465
1–25
53–85
99–415
26–52
416–465
96804
NU3MNU3M/
ND3
3128/
1–34
49–124
1–34
49–118
119–124817719
NU4MNU4M/
ND4
4486/
7–481
85–189
201–434
7–84
190–200
435–481
98702
NU5MNU5M/
ND5
5655
5–479
489–652
28–436
457–474
568–592
614–652
5–27
437–456
475–479
489–567
593–613
98752
NU6MNU6M/
ND6
6185
2–184
2–77
160–184
78–15999551
NULMNULM/
ND4L
L89
1–86
1–86097973
accessory subunits peripheral arm
NUEMNDUFA9/
39 kDa
E355
17–334
17–3340828218
NUFMNDUFA5/
B13
F136
13–131
34–13113–33887212
NUMMNDUFS6/
13 kDa
M119
13–117
43–11713–42887512
NUYMNDUFS4/
18 kDa
Y137
19–133
19–1330848416
NUZMNDUFA7/
B14.5a
Z182
30–166
030–16675025
N7BMNDUFA12/B17.2h137
6–135
6–135095955
NB4MNDUFA6/
B14
P123
3–118
3–118094946
ACPM1NDUFAB1/SDAPO84
4–80
4–80092928
NI8MNDUFA2/
B8
f86
5–84
5–84093937
Accessory subunits PP module
NUPMNdufa8/
pgiv
U171
10–167
16–14210–15
143–167
92748
NUJMNDUFA11/B14.7J197
18–157
18–133134–157715929
NB6MNDUFA13/B16.6W122
3–120
14–1203–1397883
NIPMNDUFS5/
15 kDa
988
8–66
14–6608–13676033
NUXM-/-X168
4–120
72–964–71
97–120
701530
NI9MNDUFA3/
B9
g66
3–62
3–6291919
NIMMNDUFA1/
MWFE
D86
1–80
1–5859–8093677
NEBMNDUFC2/
B14.5b
b73
1–64
1–6487013
accessory subunits PD module
NESMNDUFB11/ESSSS204
29–187
29–18778022
NIAMNDUFB8/
ASHI
a125
11–110
11–11080020
NUNMNDUFB5/
SGDH
n119
23–115
23–11578022
NB2MNDUFB3/
B12
c59
8–49
31–498–30713229
NB5MNDUFB4/
B15
j92
3–75
16–413–15
42–75
822718
NB8MNDUFB7/
B18
898
3–84
3–8081–84848016
ACPM2NDUFAB1/SDAPQ88
3–87
3–87097973
NIDMNDUFB10/PDSWd91
3–91
3–91098985
NI2MNDUFB9/
B22
R108
6–107
6–9899–10794866
NUUMNDUFB2/
AGGG
e89
6–50
6–5051049
Table 3
Lipid content of typical complex I preparation
https://doi.org/10.7554/eLife.39213.017
Lipidnmol lipid/nmol complex I
phosphatidylcholine19.3
lyso-phosphatidylcholine0.1
phosphatidylethanolamine13.3
phosphatidylserine0.5
phosphatidylinositol11.8
cardiolipin21.7
Σ66.7
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain
background
(Y. lipolytica GB20)
∆mus51, lys1-, leu2-,
ura3-, 30Htg2, ndh2i
PMID 24706851
Strain, strain
background
(E. coli CLY)
derived from
C43(DE3), ∆cyoBCD::kan
PMID 17267395Prof. Robert
B. Gennis,
University of Illinois
Genetic reagent
(pET17b-V14)
cyoABCDE in
pET 17b
this workDr. Hao Xie,
MPI for Biophysics,
Frankfurt
Chemical compound,
drug
n-Dodecyl β-
maltoside
Glycon Biochemicals
GmbH
Cat. # D97002-C
Chemical compound,
drug
DecylubiquinoneSigma-Aldrich/MerckCat. # D7911
Chemical compound,
drug
β-Nicotinamide
adenine dinucleotide
Sigma-Aldrich/MerckCat. # N8129
Chemical compound,
drug
Asolectin from
soybean
Sigma-Aldrich/MerckCat. # 11145
Chemical compound,
drug
CHAPS, AnagradeAnatraceCat. # C316
Software,
algorithm
CootPMID: 15572765RRID: SCR_014222
Software,
algorithm
CTFFIND4PMID:26278980
Software,
algorithm
GctfPMID:26592709
Software,
algorithm
MolProbityPMID: 20057044RRID: SCR_14226
Software,
algorithm
MotionCor2PMID: 28250466
Software,
algorithm
PhenixPMID: 20124702RRID: SCR_014224
Software,
algorithm
PyMOLSchrödinger, LLCRRID: SCR_000305
Software,
algorithm
RELIONPMID: 27845625RRID: SCR_016274
Software,
algorithm
UCSF ChimeraPMID: 15264254RRID: SCR_004097
Software,
algorithm
TMHMM ServerPMID: 11152613RRID: SCR_014935
Table 4
Oligonucleotides used in this work.
https://doi.org/10.7554/eLife.39213.023
OligonucleotidesSequence (5’−3’)
Vbo3-NdeIaGCGCATATGAAGCAGATGATTCAGGTC
Vbo3-HindIIIaGGGAAGCTTTC AAAAATAAATATGCGGCAAC
Vbo3-10TAATCTATGTTAGGTAAACTCGATTGG
Vbo3-15ATTTCCTCCTGCAGCAGATGCAGCAAC
Vbo3-19bGCTGCAGGAGGAAATGAAAACCTGTACTTTCAAGGTCATCACCATCACCATCAC
CATCACCATCACTAAGCTGCATCTGCTGCAGGAGGAAATTAATCTATGTTAGGT
Vbo3-20bACCTAACATAGATTAATTTCCTCCTGCAGCAGATGCAGCTTAGTGATGGTGATG
GTGATGGTGATGGTGATGACCTTGAAAGTACAGGTTTTCATTTCCTCCTGCAGC
  1. *Restriction enzymes sites are underlined.

    The nucleotide sequences encoding the TEV cleavage site and the deca-histidine tag are shown in red and blue, respectively. The artificial intergenic region containing the Vitreoscilla ribosomal binding site is shown in magenta.

Additional files

Supplementary file 1

Coordinate file of complex I under steady-state turnover conditions with NADH and ubiquinone binding sites occupied (compare EMD-4385).

Please note that the position of the ubiquinone head group was identified but that the precise orientation of the molecule in the site remained ambiguous due to limited detail of the 4.5 Å resolution map.

https://doi.org/10.7554/eLife.39213.024
Transparent reporting form
https://doi.org/10.7554/eLife.39213.025

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)