1. Human Biology and Medicine
Download icon

Identification of functionally distinct fibro-inflammatory and adipogenic stromal subpopulations in visceral adipose tissue of adult mice

Research Communication
Cite this article as: eLife 2018;7:e39636 doi: 10.7554/eLife.39636
9 figures, 5 tables, 1 data set and 2 additional files

Figures

Figure 1 with 2 supplements
Single-cell RNA sequencing reveals molecularly distinct Pdgfrb-expressing subpopulations in visceral adipose tissue.

(A) Schematic overview of the MuralChaser model: a ‘Tet-On’ system allowing for indelible labeling of Pdgfrb-expressing cells. In the absence of doxycycline (Dox), gonadal SVF cells are labeled membrane tdTomato+ and are devoid of membrane GFP expression. In the presence of Dox, rtTA activates Cre expression in Pdgfrb-expressing cells. Cre excises the loxP-flanked membrane tdTomato (mtdTomato) cassette and allows constitutive activation of membrane GFP (mGFP) reporter expression. The gating strategy shows prospective isolation of tdTomato- GFP+ cells from the stromal vascular fraction of gonadal WAT (gWAT). (B) t-distributed stochastic neighbor embedding (tSNE) plot of 1045 tdTomato- GFP+ cells isolated from pooled gWAT depots from five male MuralChaser mice. Equal numbers of cells were combined from five individual mice for single-cell RNA-sequencing. Clustering was generated using k-means = 4. See Figure 1—source data 1. (C) Distribution of Gfp and tdTomato expression within tSNE plot. Transcript counts represent Log2 of gene expression. (D) Heatmap of top 20 most differentially expressed genes defining the clusters indicated in (B). See Figure 1—source data 1. (E) Gene expression distribution of adipocyte/adipogenesis-associated genes. (F) Gene expression distribution of genes associated with terminal adipocyte differentiation. (G) Gene expression distribution of genes associated with fibrosis and inflammation. (H) Gene expression distribution of mesothelial cell markers.

https://doi.org/10.7554/eLife.39636.003
Figure 1—source data 1

Complete list of differentially expressed genes (k-means = 4).

https://doi.org/10.7554/eLife.39636.006
Figure 1—figure supplement 1
GFP expression in gonadal WAT of MuralChaser mice.

(A) Representative FACS gating strategy for the isolation of mGFP+ cells from gonadal WAT of MuralChaser mice and representative plots indicating the expression of PDGFRβ expression in these cells. mGFP+ cells from MuralChaser mice are devoid of CD31, CD45, and CD11b expression. (B) 63x confocal image of sectioned gonadal WAT obtained from doxycycline-treated MuralChaser mice. Paraffin sections were stained with antibodies raised against GFP and PERILIPIN, and counterstained with DAPI. Note the presence of GFP+ cells along the vasculature. (C) Digital overlay of 20x brightfield and fluorescent images of sectioned gonadal WAT obtained from doxycycline-treated MuralChaser mice. Paraffin sections were stained with antibodies raised against GFP and counterstained with DAPI. Note the presence of GFP+ epithelial like cells (circled) along the outer later of the depot where the mesothelium resides. (D) Fluorescent images of live cultures of mesothelial cells isolated from gonadal WAT from doxycycline-treated male MuralChaser mice. mGFP expression is found in a small subset of the cobblestone mesothelial-like cells within the cultures. Scale bar = 200 μm.

https://doi.org/10.7554/eLife.39636.004
Figure 1—figure supplement 2
tSNE plot of 4203 tdTomato- GFP+ cells isolated from gonadal WAT of MuralChaser mice.

(A) tSNE plot of 4203 tdTomato- GFP+ cells obtained from gonadal WAT of MuralChaser mice. (Median UMI count of 1873 per cell, mean reads per cell of 13,268, and median genes per cell of 908). (B) Distribution of Gfp, tdTomato, Ly6c1, and Cd9 expression within the identified clusters. (C) Heatmap of top 20 most differentially expressed genes defining the clusters indicated in (A).

https://doi.org/10.7554/eLife.39636.005
Isolation of gonadal WAT PDGFRβ+ subpopulations by FACS.

(A) tSNE plot of cells from Figure 1B with k-means = 3 clustering. See Figure 2—source data 1. (B) Distribution of Ly6c1 and Cd9 expression within tSNE plot. Transcript counts represent Log2 of gene expression. (C) Fluorescence-activated cell sorting (FACS) gating strategy to isolate indicated PDGFRβ+ CD31 CD45- subpopulations from gWAT. (D) Frequency of APCs, FIPs, and MLCs in gonadal WAT isolated from lean male 8 week old C57BL/6 mice. Frequencies were quantified based on the gating strategy shown in (C). n = 6. (E) Heatmap of top 20 most differentially expressed genes that define the clusters depicted in (A). See Figure 2—source data 1. (F) mRNA levels of Cluster 1 genes in freshly isolated APCs (LY6C- CD9-), FIPs (LY6C+), and MLCs (LY6C- CD9-), obtained from gWAT of lean male 8 week old C57BL/6 mice. n = 4. (G) mRNA levels of Cluster 2 genes in same sorted populations shown in (F). n = 4. (H) mRNA levels of Cluster 3 genes in same sorted populations shown in (F). n = 4. * in all graphs denote p<0.05 by student’s t-test in comparisons to the other populations. Bars represent mean +SEM.

https://doi.org/10.7554/eLife.39636.010
Figure 2—source data 1

Complete list of differentially expressed genes (k-means = 3).

https://doi.org/10.7554/eLife.39636.011
Figure 3 with 4 supplements
LY6C- CD9- PDGFRβ+ cells (APCs) are functional gonadal white adipocyte precursors.

(A) Photograph of Oil Red O (ORO) stained gWAT-derived PDGFRβ+ cells maintained for 8 days in growth media (2% FBS and ITS supplement). (B) Photograph of ORO stained LY6C- CD9- PDGFRβ+ cells maintained for 8 days in growth media. (C) Photograph of ORO stained LY6C+ PDGFRβ+ cells maintained for 8 days in growth media. (D) Photograph of ORO stained LY6C- CD9+ PDGFRβ+ cells maintained for 8 days in growth media. (E) Brightfield image of the culture shown in A. Scale bar = 400 μm. (F) Brightfield image of the culture shown in B. Scale bar = 400 μm. (G) Brightfield image of the culture shown in C. Scale bar = 400 μm. (H) Brightfield image of the culture shown in D. Scale bar = 400 μm. (I) Brightfield image of the culture shown in A. Scale bar = 200 μm. (J) Brightfield image of the culture shown in B. Scale bar = 200 μm. (K) Brightfield image of the culture shown in C. Scale bar = 200 μm. (L) Brightfield image of the culture shown in D. Scale bar = 200 μm. (M) Brightfield image of unstained PDGFRβ+ cells maintained for 8 days in growth media. Scale bar = 100 μm. (N) Brightfield image of unstained LY6C- CD9- PDGFRβ+ cells maintained for 8 days in growth media. Scale bar = 100 μm. (O) Brightfield image of unstained LY6C+ PDGFRβ+ cells maintained for 8 days in growth media. Scale bar = 100 μm. (P) Brightfield image of unstained LY6C- CD9+ PDGFRβ+ cells maintained for 8 days in growth media. Scale bar = 100 μm. (Q) mRNA levels of adipocyte-selective genes in total PDGFRβ+ cells, APCs, FIPs, and MLCs, after 8 days of culture in growth media. * denotes p<0.05 by student’s t-test in comparisons to total PDGFRβ+ cells. Bars represent mean +SEM. n = 4–7. All photographs/images are representative of multiple experiments/repetitions (See Supplementary file 1).

https://doi.org/10.7554/eLife.39636.012
Figure 3—figure supplement 1
Expression of common adipocyte stem cell markers in APCs, FIPs, and MLCs, isolated from gonadal WAT of adult male mice.

(A) Pparg isoform two expression in freshly isolated APCs, FIPs, and MLCs from gWAT of 8 week old male mice. n = 4. (B) Representative brightfield image of APCs after 3 days of culture in growth media containing 2% FBS and ITS supplement. (C) Representative brightfield image of FIPs after 3 days of culture in growth media containing 2% FBS and ITS supplement. (D) Representative brightfield image of MLCs after 3 days of culture in growth media containing 2% FBS and ITS supplement. Note cobblestone morphology of mesothelial-like cells. (E) Numbers of cells/well of APCs and FIPs at 2, 4, and 6 days post-plating. n = 5. * denotes p<0.05 by student’s t-test. Bars represent mean +SEM. (F) Distribution of Pdgfra, Ly6a, Cd34, Cd24a, Cd38, and Pdgfrb expression within tSNE plot. (G) qPCR measurements of Pdgfra, Ly6a, Cd34, Cd24, Cd38, and Pdgfrb mRNA levels in APCs, FIPs, and MLCs, isolated from gonadal WAT of 8-week-old male mice. n = 4. * denotes p<0.05 by student’s t-test. Bars represent mean +SEM. (H) Representative histograms from flow cytometry analyses of PDGFRα, SCA-1, CD34, CD24, and CD38, expression in APCs, FIPs, and MLCs, isolated from gonadal WAT of 8-week-old male mice. (I) tSNE-plots highlighting the potential relationship between APCs, FIPs, and MLCs, and the SVF subpopulations identified by Burl et al. (2018). Lists of the top-50 most-enriched genes, each characterizing ASC1, ASC2, FB, Diff. ASC, and Pro. ASC, respectively, (from Burl et al.) were input into Cell Loupe Browser. Color intensities represent the sum of the Log2 expression values of the population gene lists within the single cell RNA-sequencing dataset of gWAT from Figure 1B. ASC1, adipocyte stem cells 1; ASC2, adipocyte stem cells 2; FB, fibroblasts; Diff. ASC, differentiating adipocyte stem cells; Pro. ASC, proliferating adipocyte stem cells.

https://doi.org/10.7554/eLife.39636.013
Figure 3—figure supplement 2
FIPs undergo adipocyte differentiation in the presence of dexamethasone, IBMX, insulin, and rosiglitazone.

(A) Representative brightfield image of FIPs maintained at confluence for 8 days in growth media containing 2% FBS and ITS supplement. Scale bar = 200 µm fro A-C. (B) Representative brightfield image of FIPs 8 days after inducing adipocyte differentiation with dexamethasone, IMBX, and insulin (DMI). (C) Representative brightfield image of FIPs 8 days after inducing adipocyte differentiation with dexamethasone, IMBX, insulin, and rosiglitazone (Rosi). (D) mRNA levels of adipocyte-selective genes in cultures represented in A-C. * denotes p<0.05 by student’s t-test in comparisons to FIPs allowed to undergo spontaneous differentiation. Bars represent mean +SEM. n = 3.

https://doi.org/10.7554/eLife.39636.014
Figure 3—figure supplement 3
Visceral APCs undergo adipocyte differentiation upon transplantation into lipodystrophic mice.

(A) Schematic of transplantation of APCs and FIPs for in vivo adipogenesis assay. 80,000 APCs or FIPs were injected subcutaneously into the remnant inguinal WAT depot of lipodystrophic mice (Adipoq-Cre, PpargloxP/loxP). Three weeks after transplant, the remnant inguinal WAT depots were harvested for histological analysis. (B) Brightfield image of the inguinal WAT depot from Adipoq-Cre, PpargloxP/loxP mice 3 days after transplant of 80,000 APCs. Scale bar = 400 μm. (C) Brightfield image of the inguinal WAT depot from Adipoq-Cre, PpargloxP/loxP mice 3 days after transplant of 80,000 FIPs. Scale bar = 400 μm. (D) Brightfield image of the inguinal WAT depot from Adipoq-Cre, PpargloxP/loxP mice 3 days after transplant of vehicle (Matrigel only). Scale bar = 400 μm.

https://doi.org/10.7554/eLife.39636.015
Figure 3—figure supplement 4
Gonadal PDGFRβ+ Zfp423GFP-High cells enrich for markers of committed preadipocytes.

(A) mRNA levels of endogenous Zfp423 in APCs, FIPs, and MLCs, isolated from gonadal WAT of 8-week-old male Zfp423GFP mice. (B) Representative FACS gating strategy for the isolation of Zfp423GFP-Low and Zfp423GFP-High PDGFRβ+CD31 CD45- cells from gonadal WAT. (C) Pparg expression in Zfp423GFP-Low and Zfp423GFP-High cells isolated from gonadal WAT. (D) mRNA levels of Cluster 1A genes (APCs) in Zfp423GFP-Low and Zfp423GFP-High cells. (E) mRNA levels of Cluster 1B genes (Committed Preadipocytes) in Zfp423GFP-Low and Zfp423GFP-High cells. (F) mRNA levels of Cluster 2 genes (FIPs) in Zfp423GFP-Low and Zfp423GFP-High cells. (G) mRNA levels of Cluster 3 genes (MLCs) in Zfp423GFP-Low and Zfp423GFP-High cells. * in all graphs denote p<0.05 by student’s t-test. All bars represent mean +SEM. n = 4.

https://doi.org/10.7554/eLife.39636.016
Figure 4 with 1 supplement
Functionally distinct stromal populations from visceral, but not subcutaneous, WAT depots can be revealed on the basis of LY6C and CD9 expression.

(A) Fluorescence-activated cell sorting (FACS) gating strategy to isolate indicated PDGFRβ+ CD31- CD45- subpopulations from mesenteric and retroperitoneal WAT. (B) Frequency of APCs, FIPs, and MLCs in mesenteric and retroperitoneal WAT isolated from lean male 8 week old C57BL/6 mice. Frequencies were quantified based on the gating strategy shown in (A). n = 6. Bars represent mean +SEM. (C) Brightfield image of LY6C- CD9- PDGFRβ+ (APCs) cells from mesenteric WAT maintained for 8 days in growth media. Scale bar = 200 μm. (D) Brightfield image of LY6C+ PDGFRβ+ (FIPs) cells from mesenteric WAT maintained for 8 days in growth media. Scale bar = 200 μm. (E) Brightfield image of LY6C- CD9+ PDGFRβ+ (MLCs) cells from mesenteric WAT maintained for 8 days in growth media. Scale bar = 200 μm. (F) Brightfield image of LY6C- CD9- PDGFRβ+ (APCs) cells from retroperitoneal WAT maintained for 8 days in growth media. Scale bar = 200 μm. (G) Brightfield image of LY6C+ PDGFRβ+ (FIPs) cells from retroperitoneal WAT maintained for 8 days in growth media. Scale bar = 200 μm. (H) Brightfield image of LY6C- CD9+ PDGFRβ+ (MLCs) cells from retroperitoneal WAT maintained for 8 days in growth media. Scale bar = 200 μm. (I) Flow cytometry plot of LY6C and CD9 expression in CD31- CD45- PDGFRβ+ cells isolated from inguinal WAT and anterior subcutaneous WAT.

https://doi.org/10.7554/eLife.39636.017
Figure 4—figure supplement 1
APCs and FIPs can be isolated from gonadal WAT of female mice.

(A) Fluorescence-activated cell sorting (FACS) gating strategy to isolate indicated PDGFRβ+ CD31- CD45- subpopulations from peri-ovarian WAT. (B) Frequency of APCs, FIPs, and MLCs in peri-ovarian WAT isolated from lean female 8 week old C57BL/6 mice. Frequencies were quantified based on the gating strategy shown in (A). n = 6. Bars represent mean +SEM. (C) mRNA levels of Cluster 1 genes identified in Figure 2 in freshly isolated APCs (LY6C- CD9-), FIPs (LY6C+), and MLCs (LY6C- CD9-), obtained from peri-ovarian WAT of lean female 8 week old C57BL/6 mice. n = 4. * denotes p<0.05 by student’s t-test in comparisons to the other populations. Bars represent mean +SEM. (D) mRNA levels of Cluster 2 genes in same sorted populations shown in (C). n = 4. * denotes p<0.05 by student’s t-test in comparisons to the other populations. Bars represent mean +SEM. (E) mRNA levels of Cluster 3 genes in same sorted populations shown in (C). n = 4. * denotes p<0.05 by student’s t-test in comparisons to the other populations. Bars represent mean +SEM. (F) Pparg isoform two expression in freshly isolated APCs, FIPs, and MLCs from peri-ovarian WAT of 8 week old female mice. n = 4. * denotes p<0.05 by student’s t-test in comparisons to the other populations. Bars represent mean +SEM. (G) mRNA levels of indicated collagens and fibrosis-related genes in APCs, FIPs, and MLCs isolated from peri-ovarian WAT of 8-week-old female mice. n = 4. * denotes p<0.05 by student’s t-test. Bars represent mean +SEM. (H) mRNA levels of indicated inflammatory genes in APCs, FIPs, and MLCs isolated from peri-ovarian WAT of 8-week-old female mice. n = 4. * denotes p<0.05 by student’s t-test. Bars represent mean +SEM. (I) Brightfield image of LY6C- CD9- PDGFRβ+ (APCs) cells from peri-ovarian WAT maintained for 8 days in growth media. Scale bar = 200 μm. (J) Brightfield image of LY6C+ PDGFRβ+ (FIPs) cells from peri-ovarian WAT maintained for 8 days in growth media. Scale bar = 200 μm. (K) Brightfield image of LY6C- CD9+ PDGFRβ+ (MLCs) cells from peri-ovarian WAT maintained for 8 days in growth media. Scale bar = 200 μm.

https://doi.org/10.7554/eLife.39636.018
FIPs inhibit adipocyte differentiation from APCs.

(A) Pparg isoform two expression in cultured APCs maintained for 3 days in conditioned media from either APCs, FIPs, or MLCs. n = 4. *denotes p<0.05 by student’s t-test in comparisons to data represented in blue bars. Bars represent mean +SEM. (B) Brightfield image of APCs after 8 days of culture in conditioned media from parallel cultures of APCs. Scale bar = 100 μm for B-D. (C) Brightfield image of APCs after 8 days of culture in conditioned media from parallel cultures of FIPs. (D) Brightfield image of APCs after 8 days of culture in conditioned media from parallel cultures of MLCs. (E) mRNA levels of adipocyte-selective genes within cultures shown in (B–D). n = 3. * denotes p<0.05 by student’s t-test in comparisons to data represented in blue bars. Bars represent mean +SEM. (F) Distribution of Abcg1 and F3 expression within tSNE plot from Figure 1B. (G) mRNA levels of Abcg1 and F3 in APCs, FIPs, and MLCs isolated from lean 8 week old male mice. * denotes p<0.05 by student’s t-test. Bars represent mean +SEM. (H) tSNE-plot highlighting the potential relationship between APCs, FIPs, and MLCs, and iguinal WAT Aregs identified by Schwalie et al. (Schwalie et al., 2018). The top-23 Areg-selective genes identified by Schwalie et al were input into Cell Loupe Browser. Color intensities represent the sum of the Log2 expression values of the Areg selective gene list within the single cell RNA-sequencing dataset of gWAT from Figure 1B.

https://doi.org/10.7554/eLife.39636.019
Figure 6 with 1 supplement
LY6C+ PDGFRβ+ cells (FIPs) exhibit a functional pro-inflammatory phenotype.

(A) mRNA levels of indicated cytokines in cultures of APCs and FIPs treated with vehicle (PBS) or LPS (100 ng/ml) for 3 hr. * denotes p<0.05 by student’s t-test. Bars represent mean +SEM. n = 4. (B) mRNA levels of indicated cytokines in cultures of APCs and FIPs treated with vehicle (PBS) or TNFα (20 ng/ml) for 3 hr. * denotes p<0.05 by student’s t-test. Bars represent mean +SEM. n = 4. (C) Schematic depicting the treatment of bone marrow derived macrophages (MΦ) with conditioned media (CM) from LPS-treated APCs, FIPs and MLCs. (D) mRNA levels of select markers of activated macrophages in macrophage cultures exposed to conditioned media. n = 4. * denotes p<0.05 comparing vehicle vs. LPS. # denotes p<0.05 comparing LPS-treated FIPs vs. LPS-treated APCs. Bars represent mean +SEM.

https://doi.org/10.7554/eLife.39636.020
Figure 6—figure supplement 1
LY6C+ PDGFRβ+ cells (FIPs) exhibit a fibrogenic phenotype.

(A) mRNA levels of indicated collagens and fibrosis-related genes in APCs, FIPs, and MLCs, isolated from gonadal WAT of 8-week-old male mice. (B) mRNA levels of indicated collagens in cultured APCs and FIPs treated with vehicle (PBS) or TGFβ (1 ng/ml) for 3 days. * in all graphs denote p<0.05 by student’s t-test. All bars represent mean +SEM. n = 4.

https://doi.org/10.7554/eLife.39636.021
The frequencies and gene expression profiles of APCs and FIPs are differentially regulated in association with high-fat diet feeding.

(A) Frequency of total PDGFRβ+ cells, FIPs, and APCs in gonadal WAT isolated from chow-fed mice, mice fed high fat diet (HFD) for 1 week, or mice fed HFD for 4 weeks. n = 4. * denotes p<0.05 by student’s t-test in comparison to white bars. # denotes p<0.05 by student’s t-test in comparison to red or white bars. Bars represent mean +SEM. (B) Histograms depicting BrdU incorporation into APCs, FIPs, and MLCs after 1 week of chow or HFD feeding. (C) Relative median fluorescence intensity (MFI) corresponding to histograms shown in (B). n = 4. * denotes p<0.05 by student’s t-test in comparison to corresponding data from APCs. # denotes p<0.05 by student’s t-test in comparison to corresponding data from APCs and MLCs. (D) Pparg isoform two expression in freshly isolated APCs, FIPs, and MLCs, from gWAT of chow or 4 week HFD fed mice. n = 4. (E) Il6 expression in same cell populations shown in (D). (F) Ccl2 expression in same cell populations shown in (D). (G) Cxcl2 expression in same cell populations shown in (D). (H) Tnfa expression in same cell populations shown in (D). (I) Tgfb1 expression in same cell populations shown in (D). (J) Tgfb2 expression in same cell populations shown in (D). (K) Fn1 expression in same cell populations shown in (D). (L) Col1a1 expression in same cell populations shown in (D). (M) Col3a1 expression in same cell populations shown in (D). * in panels D-M denote p<0.05 by student’s t-test. All bars represent mean +SEM.

https://doi.org/10.7554/eLife.39636.022
NR4A nuclear receptors regulate the pro-inflammatory phenotype of PDGFRβ+ cells.

(A) Distribution of Nr4a1, Nr4a2, and Nr4a3 expression, within tSNE plot depicted in Figure 1B. Transcript counts represent Log2 of gene expression. (B) Nr4a mRNA levels in freshly isolated APCs, FIPs, and MLCs, isolated from the gonadal WAT of lean chow-fed male mice. n = 4. (C) Nr4a mRNA levels in freshly isolated APCs, FIPs, and MLCs, isolated from the gonadal WAT of male mice following 4 weeks of high-fat diet (HFD) feeding. n = 4. (D) Relative mRNA levels of Nr4a family members in cultures of FIPs treated with vehicle (PBS) or TNFα (20 ng/ml) for 3 hr. n = 4. * denotes p<0.05 by student’s t-test. n = 4. (E) Relative mRNA levels of Nr4a1 in FIPs 3 days following transduction with retrovirus expressing either Gfp or Nr4a1. n = 4. (F) Relative mRNA levels of Nr4a2 in FIPs 3 days following transduction with retrovirus expressing either Gfp or Nr4a2. n = 4. (G) Relative mRNA levels of Nr4a3 in FIPs 3 days following transduction with retrovirus expressing either Gfp or Nr4a3. n = 4. (H) Cxcl2 expression in FIPs 3 days following transduction with indicated retroviruses and treated with vehicle (PBS) or TNFα (20 ng/ml) for 4 hr. n = 4. (I) Cxcl10 expression in same cultures shown in (H). (J) Ccl2 expression in same cultures shown in (H). (K) Il6 expression in same cultures shown in (H). (L) Relative mRNA levels of Nr4a1 in FIPs following transduction with retrovirus expressing shRNA targeting Gfp (shGFP) (control) or retroviruses individually expressing distinct shRNAs targeting unique regions of Nr4a1 mRNA (shNr4a1 #1–3). n = 4. (M) Ccl2 expression in FIPs following transduction with indicated retroviruses and treatment with vehicle (PBS) or TNFα (20 ng/ml) for 3 hr. n = 4. (N) Tnfa expression in same cultures shown in (C). (O) Cxcl2 expression in same cultures shown in (C). (P) Il6 expression in same cultures shown in (C). * in panels E-P denote p<0.05 by student’s t-test in comparison to corresponding treatments of control cells (pMSCV-GFP or shGFP). Bars in all graphs represent mean +SEM.

https://doi.org/10.7554/eLife.39636.023
Functional heterogeneity of PDGFRβ+ perivascular cells in visceral adipose tissue of mice.

The pool of PDGFRβ+ cells in visceral WAT of mice is molecularly and functionally heterogeneous. LY6C- CD9- PDGFRβ+ cells represent visceral adipocyte precursor cells (APCs), whereas LY6C+ PDGFRβ+ cells represent fibro-inflammatory progenitors (FIPs). FIPs are fibrogenic, pro-inflammatory, and inhibit adipocyte differentiation from APCs.

https://doi.org/10.7554/eLife.39636.024

Tables

Table 1
Gene sets enriched in APCs (Cluster 1A/B).
https://doi.org/10.7554/eLife.39636.007
Gene set nameGene set
description
FDR q-valueEnriched genes
HALLMARK_XENOBIOTIC_
METABOLISM
Genes encoding proteins
involved in processing
of drugs and other
xenobiotics.
0.008879008APOE, IGF1, NDRG2, VTN, HSD11B1, ENPEP, POR, TNFRSF1A, SLC1A5, JUP, PMM1, CD36, PTGES, FAH, FMO1, HMOX1, GCNT2, ABCD2, ECH1, GSTA3, AOX1, IL1R1, GABARAPL1, ID2, CASP6, CSAD, MPP2, DDT, GSTO1, ALDH2, TMEM176B, GSTT2, CYP27A1, CYB5A, SMOX, FBLN1, MCCC2, ELOVL5, NQO1, PDK4, ALAS1, ATP2A2, RBP4, TMEM97
HALLMARK_
ADIPOGENESIS
Genes up-regulated during
adipocyte differentiation
(adipogenesis).
0.033845212GPX3, SPARCL1, COL15A1, APOE, LPL, COL4A1, MYLK, CMBL, LIFR, SDPR, EPHX2, PPARG, POR, MRAP, REEP6, SLC1A5, ENPP2, ANGPTL4, CD302, FABP4, ANGPT1, GPHN, CD36, SLC27A1, RAB34, LIPE, PTGER3, IFNGR1, FAH, ALDOA, SULT1A1, FZD4, SCP2, TST, ECH1, SLC19A1, ADCY6, TANK, CS, ACADM, DDT, UBC, MCCC1, ALDH2, BCKDHA, AGPAT3, DBT, JAGN1, MGST3, ADIPOR2, SLC5A6, DNAJC15, GPAM, PIM3, CYP4B1, RETSAT, ITGA7, SLC25A10, SCARB1
HALLMARK_IL6_JAK_
STAT3_SIGNALING
Genes up-regulated by
IL6 via STAT3, e.g., during
acute phase response.
0.08689988SOCS3, JUN, CNTFR, TNFRSF1A, CD38, PIM1, OSMR, CD36, IFNGR1, SOCS1, IL17RA, MYD88, HMOX1, IRF1, STAT3, IL1R1, STAT2
Table 2
Gene sets enriched in committed preadipocytes (Cluster 1B).
https://doi.org/10.7554/eLife.39636.008
Gene set nameGene set
description
FDR q-valueEnriched genes
HALLMARK_MYC_
TARGETS_V2
A subgroup of genes
regulated by MYC - version 2.
0SRM, GNL3, NOLC1, HSPE1, NIP7, HSPD1, PA2G4, NPM1, CDK4, PPAN, MYBBP1A, RCL1, PUS1, PHB, WDR43, HK2, WDR74, SLC19A1, GRWD1, EXOSC5, PES1, PRMT3, DDX18, TMEM97, IMP4, UNG, UTP20, LAS1L, MPHOSPH10, PPRC1, NOC4L, TBRG4, BYSL, IPO4, TFB2M
HALLMARK_OXIDATIVE_
PHOSPHORYLATION
Genes encoding proteins
involved in oxidative
phosphorylation.
0ATP5G1, NNT, COX8A, TIMM13, TIMM10, LDHA, CYCS, TOMM70A, UQCRQ, COX7C, CYC1, COX7A2, ATP5G2, TIMM50, ATP5E, NDUFA4, NDUFAB1, SLC25A5, ATP5L, SLC25A4, PHB2, ACAT1, ATP5J, ATP5C1, CS, NDUFB8, NDUFB2, GRPEL1, UQCRFS1, IDH3A, NDUFV2, COX5A, NDUFC2, MRPS15, NDUFB4, POR, ECHS1, ATP5B, MRPS12, COX7B, LDHB, COX4I1, ATP5D, MRPL15, COX6B1, UQCRH, MDH2, SLC25A3, TIMM9, ATP5G3, NDUFB5, PRDX3, NDUFA2, ATP5A1, MRPS30, ATP5H, NDUFA7, NDUFC1, COX5B, PDHB, ATP5F1, MAOB, BAX, NDUFA3, GPX4, NDUFS8, VDAC2, COX6C, POLR2F, NDUFS3, COX6A1, NDUFS2, UQCRB, TIMM17A, ACADM, NDUFS7, ATP5O, MRPL11, IDH1, MRPL35, SUCLG1, HCCS, SDHD, MRPL34, MRPS11, NDUFB7, VDAC1, ATP5J2, NDUFA8, GOT2, OXA1L, SLC25A11, NDUFS6, NDUFA6, ETFB, IMMT, HTRA2, MTRR, FXN, SDHB, ACO2, FDX1, NDUFB6, DLAT, PMPCA, DLD, IDH2, AFG3L2, ETFDH, MTX2, TIMM8B, RETSAT, COX7A2L, TOMM22, NDUFA5, SUCLA2, UQCRC1, ALDH6A1, RHOT1, ECH1, SURF1, ATP6V1G1, VDAC3, PDHX, LRPPRC, UQCRC2, HADHB
HALLMARK_
ADIPOGENESIS
Genes up-regulated
during adipocyte
differentiation (adipogenesis).
0REEP6, COL15A1, MYLK, APOE, COX8A, PIM3, CMBL, UQCRQ, LPL, SLC1A5, CYC1, PPARG, NDUFAB1, TKT, YWHAG, CS, DBT, GRPEL1, IDH3A, SCP2, SLC25A10, POR, ECHS1, FZD4, G3BP2, COX7B, SLC19A1, AK2, MRPL15, JAGN1, ENPP2, MDH2, ALDOA, PRDX3, MRAP, RAB34, DDT, MTCH2, HADH, PTGER3, LIPE, CPT2, REEP5, MCCC1, ANGPT1, GPX4, AGPAT3, NDUFS3, COX6A1, TANK, ACADM, SCARB1, ATP5O, ADCY6, GPX3, IDH1, SUCLG1, PEX14, SPARCL1, SDPR, PREB, GHITM, ALDH2, ADIPOR2, NDUFB7, EPHX2, ACADS, DNAJC15, GPHN, HIBCH, FAM73B, CHUK, VEGFB, ETFB, IMMT, ACOX1, RREB1, QDPR, FABP4, ACLY, ELOVL6, SDHB, PFKL, ACO2, RETN, CAT, PTCD3, DLAT, DLD, TST, CD36, DHRS7B, ITSN1, RETSAT, NDUFA5, UQCRC1, UBQLN1, DNAJB9, ECH1, SLC27A1
HALLMARK_MYC_
TARGETS_V1
A subgroup of genes
regulated by
MYC - version 1 (v1).
0RPLP0, SRM, RPL6, GNL3, RPS2, RPL18, CNBP, RPS5, APEX1, RPL14, RPS6, RANBP1, SERBP1, ERH, C1QBP, RPL34, NOLC1, HSPE1, GNB2L1, HSPD1, PABPC1, SET, LDHA, EIF4A1, RPS3, PA2G4, SNRPD1, RSL1D1, TOMM70A, RAN, DDX21, NPM1, EIF2S2, CYC1, PABPC4, CDK4, IMPDH2, FBL, NAP1L1, NDUFAB1, RPL22, ABCE1, PHB2, HDGF, SNRPD2, LSM7, RPS10, HSP90AB1, PHB, CCT2, PPM1G, SNRPD3, SYNCRIP, PCBP1, CCT3, LSM2, EPRS, NME1, EIF2S1, GSPT1, COX5A, CCT7, CCT5, TUFM, U2AF1, PPIA, TCP1, ODC1, POLE3, ACP1, EEF1B2, TARDBP, YWHAE, SLC25A3, EIF1AX, SNRPA1, ETF1, SRPK1, PSMD7, PRDX3, SMARCC1, RAD23B, CCT4, RNPS1, FAM120A, RUVBL2, TXNL4A, EIF4E, KARS, PTGES3, GLO1, DDX18, MCM7, HDAC2, CANX, DUT, PRPF31, UBE2L3, KPNB1, NCBP1, SNRPA, POLD2, PSMA7, EIF4G2, PSMB2, PRPS2, DHX15, SSBP1, CLNS1A, PSMB3, PGK1, XPOT, STARD7, H2AFZ, ILF2, VDAC1, SSB, CTPS, GOT2, MRPS18B, SNRPG, COPS5, MRPL9, PSMA2, CAD, PSMA4, TRIM28, IARS, SF3B3, PSMD14, SNRPB2, UBE2E1, NCBP2, PWP1, YWHAQ, PSMD8, AP3S1, RFC4, HDDC2, PSMA6, XPO1, VDAC3, PSMC4, CDK2, USP1, MYC, PCNA, MRPL23
HALLMARK_
DNA_REPAIR
Genes involved
in DNA repair.
0.001391793AK1, TMED2, BOLA2, IMPDH2, POLR1D, SAC3D1, APRT, NUDT9, NME1, NUDT21, SSRP1, RAE1, ADRM1, GTF2A2, GUK1, POLR2D, GTF2H5, GPX4, POLR2F, MPG, DUT, SEC61A1, ADCY6, POLR2E, POLE4, RBX1, NT5C3, POLR1C, AK3, POLR2C, TAF10, GTF2H1, RNMT, DDB1, NME4, NFX1, POLR3GL, EIF1B, POLR2G, NCBP2, POLR2K, POLR2H, SURF1, ERCC8, TSG101, RFC4, RFC5, PCNA, UPF3B, POLR2I, RAD51, ITPA, EDF1, PRIM1, DAD1, TAF12, GTF2F1, POLD3, TCEB3, DCTN4, ARL6IP1, POLA1
HALLMARK_
MTORC1_SIGNALING
Genes up-regulated through
activation of mTORC1 complex.
0.001159828PSAT1, ATP5G1, HSPE1, HSPD1, LDHA, TOMM40, SLC1A5, EIF2S2, ENO1, EEF1E1, PHGDH, ARPC5L, SQLE, EPRS, HSPA4, PPIA, PSME3, HK2, GAPDH, MTHFD2, ETF1, ALDOA, PDAP1, PPA1, XBP1, ABCF2, BCAT1, UBE2D3, CACYBP, CYB5B, PSMA3, SLC7A5, TXNRD1, CANX, INSIG1, TMEM97, IDH1, HMBS, SSR1, PSMB5, ADIPOR2, PGK1, SERPINH1, UNG, PLOD2, PSPH, PRDX1, POLR3G, RPN1, DAPP1, IMMT, SLC2A1, QDPR, ACLY, ELOVL6, ATP2A2, PFKL, GTF2H1, COPS5, LDLR, SHMT2, UFM1, PSMA4, FDXR, TCEA1, GMPS, IDI1, PSMD12, ELOVL5, PSMD14, MAP2K3, PITPNB, MLLT11, TPI1, GSK3B, M6PR, PSMC4, ME1, NUP205, SLC2A3, NUFIP1, GSR, UCHL5, HMGCR
HALLMARK_FATTY_
ACID_METABOLISM
Genes encoding proteins
involved in metabolism
of fatty acids.
0.00329518REEP6, MIF, APEX1, LDHA, AOC3, FASN, SUCLG2, ECHS1, ODC1, MDH2, ALDOA, HADH, PDHB, BCKDHB, CPT2, ACADM, SETD8, ADSL, IDH1, SUCLG1, HCCS, SDHD, ADIPOR2, ERP29, H2AFZ, ACADS, HIBCH, PRDX6, ACOX1, GSTZ1, ACO2, GRHPR, G0S2, DLD, CD36, ACSL1, IDI1, ELOVL5, ETFDH, CCDC58, RETSAT, METAP1, SUCLA2, ECH1, HSP90AA1, HSPH1, MCEE, HADHB, ME1, GCDH, IDH3B, CRAT, SDHC, MLYCD, AQP7, DLST, HSD17B7, HMGCS1, SMS, GPD1, RDH11, ACADVL, NSDHL, HMGCL, DECR1, ACSL5, UROS
HALLMARK_
PEROXISOME
Genes annotated by the
GO term GO:0005777. A small,
membrane-bounded organelle
that uses dioxygen (O2) to
oxidize organic molecules;
contains some enzymes that
produce and others that degrade
hydrogen peroxide (H2O2).
0.002883282CNBP, PABPC1, SLC25A4, SCP2, SMARCC1, PEX11A, FDPS, SLC35B2, SOD2, IDH1, PEX14, EPHX2, CTPS, GNPAT, PRDX1, PEX13, NUDT19, ACOX1, CTBP1, CAT, IDH2, ACSL1, IDI1, ELOVL5, RETSAT, ECH1, ABCD3, SLC25A17, PEX5, CDK7, CRAT, MLYCD, PEX11B, HRAS, DHRS3, ISOC1, RDH11, ABCD2, HMGCL, ACSL5, SLC23A2, SOD1, TOP2A, CRABP1
HALLMARK_
E2F_TARGETS
Genes encoding cell cycle related
targets of E2F transcription factors.
0.004273379RANBP1, NOLC1, CKS1B, PA2G4, RAN, LYAR, CDK4, NAP1L1, SYNCRIP, NME1, EIF2S1, GSPT1, PHF5A, MTHFD2, AK2, NUDT21, SSRP1, SNRPB, TIPIN, UBE2S, IPO7, PNN, MCM7, SHMT1, DUT, H2AFX, NUP153, HN1, POLD2, POLE4, HMGB3, H2AFZ, UNG, CTPS, HELLS, PAICS, CENPM, ILF3, RBBP7, PSIP1, RAD1, TBRG4, NASP, PRPS1, PSMC3IP, TK1, BRMS1L, RAD51AP1, CDKN2A, CTCF, RAD50, POP7, XPO1, TCF19, ASF1A, CDKN2C, USP1, NUP205, MYC, PCNA, POLE, PPP1R8, ASF1B, SMC1A, ATAD2, DIAPH3, MCM5, CCNB2, DEK, RFC1, XRCC6, BRCA2, CSE1L, EZH2, ANP32E, POLD3, MCM2, SMC6, MCM6, RQCD1, DONSON, ZW10, CKS2, BRCA1, MRE11A, RPA3, KIF22, PLK4, BIRC5, CDC25A, GINS1, CDCA3, KPNA2, HMMR, SMC4, CCNE1, MXD3, EXOSC8, RFC2, MLH1, TRIP13, TOP2A, MAD2L1
HALLMARK_
UNFOLDED_
PROTEIN_RESPONSE
Genes up-regulated during
unfolded protein response, a
cellular stress response related
to the endoplasmic reticulum.
0.005032035PSAT1, RPS14, NOLC1, CKS1B, EIF4A1, EEF2, NPM1, DKC1, LSM4, EIF4EBP1, EIF2S1, EXOSC1, MTHFD2, SDAD1, XBP1, EXOSC5, EIF4E, EIF4G1, SLC7A5, EXOSC2, H2AFX, CEBPG, SSR1, PREB, XPOT, BANF1, DDX10, EXOSC4, FUS, PARN, TARS, LSM1, SRPRB, IARS, SPCS1, DNAJB9, BAG3, EIF4A2
HALLMARK_G2M_
CHECKPOINT
Genes involved in the G2/M
checkpoint, as in progression
through the cell division cycle.
0.005412505NCL, NOLC1, CKS1B, SNRPD1, CDK4, DKC1, DTYMK, UCK2, SYNCRIP, SQLE, GSPT1, HSPA8, ODC1, EWSR1, SMARCC1, RAD23B, HMGN2, UBE2S, PRPF4B, DR1, PRMT5, AMD1, SLC7A5, SETD8, H2AFX, HN1, KPNB1, HMGB3, SFPQ, H2AFZ, ILF3, TNPO2, SLC7A1, TOP1, NASP, CBX1, NUP50, CASP8AP2, E2F4, CTCF, XPO1, CDKN2C, MYC, CUL4A, POLE, CCNT1, YTHDC1, SMC1A, MCM5, CCNB2, BRCA2, CASC5, KATNA1, POLQ, EZH2, CUL1, MCM2, ODF2, MTF2, MCM6, WHSC1, NEK2, E2F1, SMC2, SS18, CKS2, E2F3, KIF22, PLK4, HIF1A, EXO1, BIRC5, H2AFV, CDC25A, KPNA2, CHAF1A, PAFAH1B1, HMMR, SMC4, PBK, TROAP, GINS2, CENPF, CCNA2, RBM14, TOP2A, MAD2L1, KIF11, STMN1, BUB3, DBF4, RPA2, TPX2, RBL1, BARD1, UPF1, CENPE, ATRX, KIF5B, HIRA, PRC1, CCND1, CDC27, CHEK1, CENPA, SUV39H1, MNAT1, STIL, POLA2, TFDP1, FBXO5, PURA, MKI67, AURKA, UBE2C, EGF, CDC25B, ZAK, TMPO, CUL5, MCM3, WRN, MYBL2, RAD54L, LIG3, TTK, SMAD3, RACGAP1
HALLMARK_REACTIVE_
OXIGEN_SPECIES_
PATHWAY
Genes up-regulated by
reactive oxigen species (ROS).
0.011108679MGST1, NDUFB4, SOD2, GPX4, TXNRD1, NDUFS2, GPX3, PRDX2, PRDX6, PRDX1, NDUFA6, PPP2R4, CAT, MSRA, GLRX2
HALLMARK_PI3K_
AKT_MTOR_
SIGNALING
Genes up-regulated by
activation of the
PI3K/AKT/mTOR pathway.
0.012494773PLA2G12A, PTEN, CDK4, PRKAR2A, PPP1CA, PFN1, PIN1, UBE2D3, EIF4E, PLCB1, UBE2N, AKT1S1, AKT1, RPS6KA3, TNFRSF1A, DAPP1, SLC2A1, YWHAB, PPP2R1B, MKNK2, CFL1, ECSIT, MAPKAP1, MAP2K3, PLCG1, ATF1, GSK3B, RAF1, CDK2, MAP3K7, ARHGDIA, HRAS, CAB39L, RIPK1, E2F1, CALR, AP2M1, MYD88, CSNK2B, ARF1, PTPN11, PAK4, SMAD2
HALLMARK_
XENOBIOTIC_
METABOLISM
Genes encoding proteins
involved in processing of
drugs and other xenobiotics.
0.018676866IGF1, APOE, CSAD, SLC1A5, GSTO1, RBP4, PMM1, POR, ENPEP, ACP1, NDRG2, DDT, BCAT1, KARS, PTGES3, IL1R1, TMEM97, IDH1, PTGES, ALDH2, MCCC2, TNFRSF1A, ACOX1, MTHFD1, ATP2A2, TPST1, PGD, ACO2, CAT, SHMT2, IGFBP4, GART, CD36, ELOVL5, ETFDH, RETSAT, SSR3, ADH5, DDAH2, ECH1
Table 3
Gene sets enriched in FIPs.
https://doi.org/10.7554/eLife.39636.009
Gene set nameGene set
description
FDR q-valueEnriched genes
HALLMARK_PANCREAS_
BETA_CELLS
Genes specifically up-regulated
in pancreatic beta cells.
0DPP4, LMO2, SRP9, SRP14
HALLMARK_
INFLAMMATORY_
RESPONSE
Genes annotated by the GO term GO:0006954. The immediate defensive reaction to infection or injury caused by chemical or physical agents. The process is characterized by local vasodilation, extravasation of plasma into intercellular spaces and accumulation of white blood cells and macrophages.5.02E-04AXL, CD55, HAS2, ITGB3, EMP3, IRF7, TNFRSF1B, NFKBIA, EDN1, DCBLD2, ATP2B1, CCL2, SRI, IL18, BST2, ADORA2B, CSF1, TNFAIP6, ADM, ITGA5, CCL7, TLR2, TPBG, HIF1A, PDPN, TAPBP, ABI1, KLF6, NFKB1, SERPINE1, GNAI3, RHOG, CCRL2, SLC7A1, ABCA1, SLC4A4, CDKN1A, GPC3, PVR, PLAUR, IFNGR2, IL18R1, RELA, IL6, P2RY2, EIF2AK2, TIMP1, MMP14, GCH1, LIF, CXCL10, KIF1B
HALLMARK_UV_
RESPONSE_DN
Genes down-regulated in response to ultraviolet (UV) radiation.0.00149668TGFBR2, EFEMP1, CYR61, FYN, CDON, HAS2, LAMC1, ANXA4, ITGB3, MGLL, ANXA2, PMP22, COL1A1, APBB2, ATP2B1, VLDLR, SRI, NR3C1, FBLN5, ADORA2B, COL1A2, COL3A1, PDLIM5, FZD2, IGFBP5, DUSP1, ADD3, SMAD7, SYNE1, CITED2, TGFBR3, NOTCH2, NFKB1, SERPINE1, ATRX, SDC2, SLC7A1, IGF1R, VAV2, CDKN1B, NEK7
HALLMARK_
COAGULATION
Genes encoding components of blood coagulation system; also up-regulated in platelets.0.00112251FN1, FBN1, PRSS23, DPP4, S100A13, FYN, BMP1, ANXA1, ITGB3, GDA, SPARC, CD9, PLAT, RAC1, ARF4, WDR1, CAPN2, ADAM9, SERPINE1, PECAM1, MAFF, DUSP14, KLF7, GNB2, HMGCS2, GNG12, TIMP1, TIMP3, MMP14
HALLMARK_TGF_
BETA_SIGNALING
Genes up-regulated in response to TGFB1.8.98E-04RHOA, SPTBN1, FKBP1A, BMP2, SKIL, SMURF2, CTNNB1, SMURF1, CDKN1C, SKI, SMAD7, BMPR2, SERPINE1, TGFBR1, ID3, IFNGR2, SMAD1, ACVR1, KLF10
HALLMARK_EPITHELIAL_
MESENCHYMAL_TRANSITION
Genes defining epithelial-mesenchymal transition, as in wound healing, fibrosis and metastasis.7.48E-04FN1, PCOLCE2, MFAP5, FBN1, FSTL1, LOXL1, CYR61, BMP1, THY1, LAMC1, ITGB3, EMP3, ECM1, SFRP4, DPYSL3, LOXL2, TPM4, SPARC, CAPG, CALU, LGALS1, PMP22, BASP1, TNFRSF11B, COL1A1, ITGB5, POSTN, FGF2, ANPEP, FLNA, PRRX1, CXCL1, EFEMP2, THBS2, TPM1, ITGAV, PPIB, TNFRSF12A, PDLIM4, SAT1, FBLN5, COL1A2, PTHLH, DST, LAMC2, COL3A1, IGFBP4, TPM2, ITGA5, COL16A1, ITGB1, WIPF1, FBN2, CALD1, PFN2, FZD8, TGFBR3, NOTCH2, SERPINE1, COL12A1
HALLMARK_APICAL_
JUNCTION
Genes encoding components of apical junction complex.7.89E-04FBN1, CD34, ACTG1, ADRA1B, THBS3, BMP1, THY1, MYH10, SIRPA, ZYX, CNN2, FLNC, TNFRSF11B, ARPC2, YWHAH, EPB41L2, LIMA1, MSN, ITGA9, PFN1, ACTB, VCL, PVRL3, RSU1, LAMC2, PARVA, COL16A1, ITGB1, PVRL1, CTNNA1, ADAM9, ADAM15, GAMT, PECAM1, PVRL4, CD276, VAV2, RRAS
HALLMARK_ALLOGRAFT_
REJECTION
Genes up-regulated during transplant rejection.9.30E-04CD47, THY1, RPL39, TGFB2, IRF7, CAPG, RPS9, FLNA, B2M, RPS19, CCL2, RPL9, CSK, GALNT1, IL18, CSF1, CCND3, INHBB, CCL7, TLR2, HIF1A, TAPBP, ELF4, IRF4, ABI1, PSMB10, CD80, IFNGR2, IL6, NPM1, UBE2D1, TIMP1
HALLMARK_APICAL_
SURFACE
Genes encoding proteins over-represented on the apical surface of epithelial cells, e.g., important for cell polarity (apical area).0.002962323SULF2, THY1, HSPB1, DCBLD2, EFNA5, ADAM10, PLAUR, ATP8B1
HALLMARK_MITOTIC_
SPINDLE
Genes important for mitotic spindle assembly.0.002666091MARCKS, FLNB, MYH10, TRIO, SPTBN1, FLNA, EPB41L2, SPTAN1, MAPRE1, RALBP1, CAPZB, ARHGAP29, ABL1, VCL, NIN, DST, ARF6, PDLIM5, CLASP1, YWHAE, KIFAP3, PXN, LMNB1, ARHGDIA, ABI1, NOTCH2, BIN1, DOCK4, KIF5B, PKD2, MYO1E, HOOK3, FARP1, WASF2, DYNC1H1, PREX1, MYH9, CKAP5, SMC3, SOS1, ITSN1, DYNLL2, CDK5RAP2, SMC1A, ARHGEF3, ESPL1, KIF1B, NEDD9, TIAM1, PPP4R2, ROCK1, PALLD, CD2AP, WASF1, CDC42BPA, RASA2, CDC42EP2, RHOT2, ALMS1, APC, PCM1, CDC27
HALLMARK_
COMPLEMENT
Genes encoding components of the complement system, which is part of the innate immune system.0.003505879FN1, DPP4, CD55, TIMP2, ATOX1, S100A13, GNGT2, FYN, KIF2A, IRF7, PLA2G4A, PLAT, CXCL1, CALM1, EHD1, PFN1, ADAM9, IRF2, SERPINE1, GNAI3, RHOG, PRCP, MAFF, GCA, DOCK4, PLAUR, GNB2, IL6, CEBPB, TIMP1, GNAI2, XPNPEP1, MMP14
HALLMARK_PROTEIN_
SECRETION
Genes involved in protein secretion pathway.0.004820185GNAS, PAM, ATP1A1, CLTA, ADAM10, DST, AP2B1, VAMP3, SSPN, RPS6KA3, MAPK1, SCRN1, AP3S1, ARFGAP3, SOD1, ABCA1, AP2S1, COPE, SNX2, ARFIP1, AP2M1, ARCN1, COPB1, ANP32E, LMAN1, CLTC, ERGIC3, DNM1L, RAB22A, TMED10, KIF1B, BET1, RAB14, COPB2, TSG101, AP3B1, STX12, GOLGA4, VPS4B, ARF1, MON2, RER1
HALLMARK_TNFA_
SIGNALING_VIA_NFKB
Genes regulated by NF-kB in response to TNF.0.008500786GFPT2, NR4A1, MARCKS, CYR61, PTGS2, SPSB1, NFKBIA, NR4A3, NFE2L2, EDN1, FOSL2, KLF2, CXCL1, ATP2B1, EIF1, PLK2, CCL2, B4GALT5, BMP2, EHD1, CCNL1, IER3, IL18, SAT1, NFIL3, CSF1, TNFAIP6, PDLIM5, NR4A2, TLR2, DUSP1, TRIP10, JAG1, RELB, PER1, IER2, TUBB2A, IER5, CXCL2, KLF6, NFKB1, SERPINE1, CCRL2, NFKBIE, MAFF, ABCA1, CDKN1A, KLF4, PLAUR, CD80, NFKB2, IFNGR2, RELA, IL6, CEBPB, GEM, FOSL1, IFIT2, DNAJB4, KLF10, ETS2, DDX58, GCH1, LIF
HALLMARK_HYPOXIAGenes up-regulated in response to low oxygen levels (hypoxia).0.01474173PRDX5, CYR61, AKAP12, EXT1, CSRP2, PLAC8, UGP2, NDRG1, PTRF, ANXA2, PRKCDBP, PAM, HAS1, FOSL2, VLDLR, SLC6A6, HS3ST1, NAGK, ERRFI1, NR3C1, IER3, NFIL3, ADORA2B, ADM, CDKN1C, DUSP1, TPBG, DTNA, TPST2, CITED2, HK1, WSB1, KLF6, SERPINE1, GAPDH, SDC2, MAFF, AMPD3, PFKP, CDKN1A, CTGF, GPC3, IDS, PLAUR, KLF7, CDKN1B, PGM1, IL6, SULT2B1, TES, XPNPEP1, MYH9, HK2
Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Antibodyanti-guinea pig Alexa 647InvitrogenRRID:AB_1418821:200
Antibodyanti-chicken Alexa 488InvitrogenRRID:AB_1429241:200
Antibodyanti-GFPAbcamRRID:AB_3007981:700
Antibodyanti-PerilipinFitzgeraldRRID:AB_12884161:1500
AntibodyCD24-APCeBioscienceRRID:AB_108528411:400
AntibodyCD31-FITCBiolegendRRID:AB_3129001:400
AntibodyCD31-PerCP/Cy5.5BiolegendRRID:AB_106127421:400
AntibodyCD34-APCBiolegendRRID:AB_105538951:400
AntibodyCD38-FITCBiolegendRRID:AB_3129261:400
AntibodyCD45-FITCBiolegendRRID:AB_3129731:400
AntibodyCD45-PerCP/Cy5.5BiolegendRRID:AB_8933441:400
AntibodyCD9-APCeBioscienceRRID:AB_106695651:400
AntibodyCD9-FITCBiolegendRRID:AB_12793211:400
AntibodyFC BlockBD BiosciencesRRID:AB_3946571:200
AntibodyLY6C-APCBiolegendRRID:AB_17320761:400
AntibodyLY6C-BV421BiolegendRRID:AB_25621781:400
AntibodyPDGFRα-APCBiolegendRRID:AB_20439701:200
AntibodyPDGFRβ-APCBiolegendRRID:AB_22680911:50
AntibodyPDGFRβ-PEBiolegendRRID:AB_19532711:50
AntibodySCA-1-APCBiolegendRRID:AB_3133481:400
Chemical compound, drugTrypsinCorning25–052 Cl
Chemical compound, drugBrdUSigmaB5002
Chemical compound, drugBSAFisher ScientificBP1605
Chemical compound, drugCollagenase DRoche11088882001
Chemical compound, drugDexamethosoneSigmaD4902
Chemical compound, drugDMEM with 1 g/L glucose,
L-glutamine, and
sodium pyruvate
Corning10–014-CV
Chemical compound, drugDMEM/F12 with GlutaMAXGibco10565–018
Chemical compound, drugFBSSigma12303C
Chemical compound, drugFGF basicR and D Systems3139-FB-025/CF
Chemical compound, drugGentamicin Reagent (50 mg/ml)Gibco15750–060
Chemical compound, drugHarris Eosin SolutionSigmaHT110116
Chemical compound, drugHarris Hematoxylin SolutionSigmaHHS16
Chemical compound, drugHBSSSigmaH8264
Chemical compound, drugInsulinSigmaI6634
Chemical compound, drugIsobutylmethyxanthineSigmaI7018
Chemical compound, drugITS PremixBD Bioscience354352
Chemical compound, drugL-ascorbic acid-2-2phosphateSigmaA8960
Chemical compound, drugLipofectamine LTXInvitrogen15338100
Chemical compound, drugLipopolysaccharides from
Escherichia coli O111:B4
SigmaL3024
Chemical compound, drugMatrigel Growth Factor
Reduced Membrane Matrix
Corning354230
Chemical compound, drugMCDB201SigmaM6770
Chemical compound, drugM-MLV RTInvitrogen28025013
Chemical compound, drugOil Red OSigmaO0625
Chemical compound, drugPBSSigmaD8537
Chemical compound, drugpCMV-VSV-GAddgene8454
Chemical compound, drugPenicillin Streptomycin SolutionCorning30–001 Cl
Chemical compound, drugPolybreneSigmaTR-1003
Chemical compound, drugpsPAX2Addgene12260
Chemical compound, drugRandom PrimersInvitrogen48190011
Chemical compound, drugRecombinant Human TGFβ−1R and D Systems240-B-002
Chemical compound, drugRecombinant Murine TNFαPeproTech315-01A
Chemical compound, drugRed Blood Cell Lysing
Buffer Hybri-Max
SigmaR7757
Chemical compound, drugSYBR Green PCR Master MixApplied Biosystems4309155
Chemical compound, drugTrizolInvitrogen15596018
Commercial assay or kitChromium i7 Multiplex
Kit, 96 rxns
10X Genomics120262
Commercial assay or kitChromium Single Cell 3'
Library and Gel Bead
Kit v2, 16 rxns
10X Genomics120237
Commercial assay or kitChromium Single Cell A
Chip Kit, 48 rxns
10X Genomics120236
Commercial assay or kitDynabeads MyOne SilaneThermo Fisher Scientific37002D
Commercial assay or kitFITC BrdU Flow KitBD Biosciences559619
Commercial assay or kitRNAqueous-Micro Total
RNA Isolation Kit
InvitrogenAM1931
Commercial assay or kitSPRIselectBeckman CoulterB23317
Other100 µm cell strainerFalcon352360
Other12-well plateCorning356500
Other40 µm cell strainerFalcon352340
Other48-well plateFalcon353230
Otherdoxycyline-containing chow
diet (600 mg/kg doxycycline)
Bio-ServS4107
Otherhigh-fat diet (60% kcal% fat)Research DietsD12492i
Software, algorithmCell Ranger v2.1.010X GenomicsNA
Software, algorithmFlowJo V10FlowJoRRID:SCR_008520
Software, algorithmGene Set Enrichment
Analysis v3.0
Broad InstituteRRID:SCR_003199
Software, algorithmGraphpad Prism 7GraphpadRRID:SCR_002798
Software, algorithmR Studio v3.3.2RStudioRRID:SCR_000432
Software, algorithmReadr v1.1.0NANA
Software, algorithmSeurat v2.1.0Satija LabRRID:SCR_016341
Strain, strain background
(M. musculus, C57BL/6)
C57BL/6Charles River LaboratoriesRRID:IMSR_CRL:27
Strain, strain background
(M. musculus, C57BL/6)
PdgfrbrtTAJackson LaboratoriesRRID:IMSR_JAX:028570
Strain, strain background
(M. musculus, C57BL/6)
Rosa26RmT/mGJackson LaboratoriesRRID:IMSR_JAX:007676
Strain, strain background
(M. musculus, C57BL/6)
TRE-CreJackson LaboratoriesRRID:IMSR_JAX:006234
Strain, strain background
(M. musculus, C57BL/6)
Zfp423GFPOtherZfp423GFPB6PMID: 26626462
Table 4
Sequences of qPCR primers used in this study.
https://doi.org/10.7554/eLife.39636.025
GeneForward 5'−3'Reverse 5'−3'
Abcg1CAGCCTCTGGAGGGATTCTTTATCCCACGGCACTCTCACTTA
AdipoqAGATGGCACTCCTGGAGAGAATTCTCCAGGCTCTCCTTTCCT
AdipsinCTACATGGCTTCCGTGCAAGTAGTCGTCATCCGTCACTCCAT
Agpat2CGAAGCTCTTCACCTCAGGAATCTGTAGAAAGGTGGCCCTCA
AgtGTTCTGGGCAAAACTCAGTGCGAGGCTCTGCTGCTCATCATT
Car3CTTTGGAGAGGCTCTGAAGCAATCTGGAACTCGCCTTTCTCC
Ccl2CCACAACCACCTCAAGCACTTCAAGGCATCACAGTCCGAGTCAC
Cd24CCTCCTCCTGTGGCTTTAGGTCTGGGTGCTTGTGGTGAGTGAGAAACG
Cd34TGTGAAAAGGAGGAGGCTGAGGTTTGCTGGGAAGTTCTGTGC
Cd36GAGTTGGCGAGAAAACCAGTGGAGAATGCCTCCAAACACAGC
Cd38GCACCTTTGGAAGTGTGGAAGCATGCGTTACTGGAAGCTCCT
CebpaCAAGAACAGCAACGAGTACCGGTCACTGGTCAACTCCAGCAC
Chst4CAGCAAACAGCATCTGTGGAGCTTCGGAAAGATGTGGACAGG
Col1a1AGATGATGGGGAAGCTGGCAAAAGCCTCGGTGTCCCTTCATT
Col2a1AGAACCTGGTACCCCTGGAAAACCACCAGCCTTCTCGTCATA
Col3a1ATTCTGCCACCCCGAACTCAAACAGTCATGGGGCTGGCATTT
Col5a1TGTCATGTTTGGCTCCCGGATAGTCATAGGCAGCTCGGTTGT
Cxcl10CTCAGGCTCGTCAGTTCTAAGTCCCTTGGGAAGATGGTGGTTAA
Cxcl14TGGACGGGTCCAAGTGTAAGTTCCTCGCAGTGTGGGTACTTT
Cxcl2ACTAGCTACATCCCACCCACACGCACACTCCTTCCATGAAAGCC
Dact2AGCCCCCTAAAGGAAGAAACCGGTCCTTGGCCACAGTCATTA
Efhd1GGCCGCTCTAAGGTCTTCAATGTCAATAAAGCCGTCCCTTCC
F3AAGGATGTGACCTGGGCCTATAGTTGGTCTCCGTCTCCATGA
Fabp5GATGGGAAGATGATCGTGGAGAACTCCTGTCCAGGATGACGA
Fn1GAGAGCACACCCGTTTTCATCGGGTCCACATGATGGTGACTT
Glut4ATCTTGATGACCGTGGCTCTGGCTGAAGAGCTCTGCCACAAT
Hspd1GCACGATCTATTGCCAAGGAGTCTTCAGGGGTTGTCACAGGT
Il1bGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACT
Il6AAGCCAGAGTCCTTCAGAGAGAACTCCTTCTGTGACTCCAGCTT
Krt18GCTGCAGCTGGAGACAGAAATGTCAATCCAGAGCTGGCAATC
Krt8GAATGGCCACTGAAGTCCTTGAGTTCCCTGCACTCTGCCATA
LoxTCGCTACACAGGACATCATGCATGTCCAAACACCAGGTACGG
Loxl2ACCCACGTCTGTATTCCATGCCATCCAAGTCTTCAGCCATCC
Lrrn1CAACATGGGAGAGCTGGTTTCGCACACTACGGAAAGCCAAAC
Ly6aACACAGCCAGCACAGTGAAGACAGGGGGACATTCAGGATACA
Ly6c1ACTGTGCCTGCAACCTTGTCTGGCCACAAGAAGAATGAGCAC
Mmd2ATCTGGGAGCTGATGACAGGAAGTGGGTACCAGCACCAAATG
Nos2CCTCTGGTCTTGCAAGCTGATACTCGTACTTGGGATGCTCCA
NovGTTCCAAGAGCTGTGGAATGGCTCTTGTTCACAAGGCCGAAC
Nr4a1TCTCTGGTTCCCTGGACGTTAACCGGGTTTAGATCGGTATGC
Nr4a1-1317TGCCTCCCCTACCAATCTTCTTAACGTCCAGGGAACCAGAGA
Nr4a1-1468TCTCTGGTTCCCTGGACGTTAACCGGGTTTAGATCGGTATGC
Nr4a1-1877CGCATTGCTAGCTGTCTGAAAGAATAGGTGGAGGGGGTACCA
Nr4a2ACACAGCGGGTCGGTTTACTAATGCGTAGTGGCCACGTAGTT
Nr4a3ACTTGCAGAGCCTGAACCTTGTTGGTGCATAGCTCCTCCACT
Pde11aCGAGCTTGTCAGGAAAGGAGATTCAGCCACCTGTCTGGAGAT
PdgfraATCAGCTTGGCTCTTCCCTTCTATAGCTTCCTGCTCCCGTCA
PdgfrbAGGGGGTGATAGCTCACATCAAGCCATAACACGGACAGCAAC
Pkhd11bCAGATTGGGACAGAAGCATCCACAGGAATAGGCAGACCGTGA
Plin1CAGTTCACAGCTGCCAATGAGATGGTGCCCTTCAGTTCAGAG
Pparg isoform 1TGAAAGAAGCGGTGAACCACTTGGCATCTCTGTGTCAACCAT
Pparg isoform 2GCATGGTGCCTTCGCTGATGGCATCTCTGTGTCAACCATG
Rbp4TCTGTGGACGAGAAGGGTCATTGTCTGCACACACTTCCCAGT
Rps18CATGCAAACCCACGACAGTACCTCACGCAGCTTGTTGTCTA
Stmn4ACCTGAACTGGTGCGTCATCTCTTGGGAGGGAGGCATTAAAC
Tgfb1TTTAGGAAGGACCTGGGTTGGTGTTGGTTGTAGAGGGCAAGG
Tgfb2GGTGTTGTTCCACAGGGGTTACGGTCCTTCAGATCCTCCTTT
TnfaGAAAGGGGATTATGGCTCAGGTCACTGTCCCAGCATCTTGTG
Upk3bGCTTGGCCAACTTAACCTCCTTGCTGCGTTCTCTGAAGTCTG
Zfp423CAGGCCCACAAGAAGAACAAGGTATCCTCGCAGTAGTCGCACA

Data availability

Sequencing data have been deposited to GEO under accession codes GSE111588.

The following data sets were generated
  1. 1
    Single cell RNA-sequencing of visceral adipose tissue Pdgfrβ+ cells
    1. Gupta RK
    2. Hepler C
    (2018)
    Publicly available at the NCBI Gene Expression Omnibus (accession no. GSE111588).

Additional files

Supplementary file 1

Table of statistical data (exact p values and sample/cohort sizes for each dataset in the study).

https://doi.org/10.7554/eLife.39636.026
Transparent reporting form
https://doi.org/10.7554/eLife.39636.027

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)