1. Microbiology and Infectious Disease

A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV

  1. Molly OhAinle  Is a corresponding author
  2. Louisa Helms
  3. Jolien Vermeire
  4. Ferdinand Roesch
  5. Daryl Humes
  6. Ryan Basom
  7. Jeffrey J Delrow
  8. Julie Overbaugh
  9. Michael Emerman  Is a corresponding author
  1. Fred Hutchinson Cancer Research Center, United States
https://doi.org/10.7554/eLife.39823
Share this article
Cite this article
  1. Molly OhAinle
  2. Louisa Helms
  3. Jolien Vermeire
  4. Ferdinand Roesch
  5. Daryl Humes
  6. Ryan Basom
  7. Jeffrey J Delrow
  8. Julie Overbaugh
  9. Michael Emerman
(2018)
A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV
eLife 7:e39823.
https://doi.org/10.7554/eLife.39823
  2. Download BibTeX
  3. Download .RIS
6 figures, 1 table and 2 additional files

Figures

Figure 1 with 2 supplements
Download asset Open asset
The HIV-CRISPR screen identifies gene knockouts that increase and decrease HIV infection.

(A) The deletion in the U3 region of the SIN LTR vector (lentiCRISPRv2) was repaired by inserting the full-length HIV-1LAI LTR sequence to create the HIV-CRISPR construct. (B) The ISG-targeting …

https://doi.org/10.7554/eLife.39823.003
Figure 1—source data 1

PIKAHIV source ISGs.

Gene Symbol. Ensembl Gene ID. Gene Synonyms. Gene Info.

https://doi.org/10.7554/eLife.39823.006
Figure 1—source data 2

PIKAHIV sgRNA sequences.

id.gene. guide.

https://doi.org/10.7554/eLife.39823.007
Figure 1—source data 3

logFC sgRNA enrichment in wt THP-1 PIKAHIV HIV-1LAI screen.

sgRNA. gene. logFC.

https://doi.org/10.7554/eLife.39823.008
Figure 1—source data 4

MAGeCK.

Gene Analysis (Positive Scores) of wt THP-1 PIKAHIV HIV-1LAI screen. Id. num. pos|score. pos|p-value. pos|fdr. pos|rank. pos|goodsgrna. pos|lfc.

https://doi.org/10.7554/eLife.39823.009
Figure 1—figure supplement 1
Download asset Open asset
PIKAHIV ISG library gene and sgRNA selection.

(A) ISG study, source and treatment conditions for ISGs selected for inclusion in the PIKAHIV library. (B) Sources for sgRNA sequences included in the PIKAHIV library.

https://doi.org/10.7554/eLife.39823.004
Figure 1—figure supplement 2
Download asset Open asset
sgRNA read counts for the sequenced PIKAHIV Plasmid Library.

Individual 20bp sgRNA sequences were binned and the distribution of read counts is displayed along the X-Axis.

https://doi.org/10.7554/eLife.39823.005
Figure 2 with 1 supplement
Download asset Open asset
Iterative screening in ZAP-KO THP-1 cells Identifies IFNα-induced Inhibitors of HIV Replication.

(A) Sliding window analysis of CG dinucleotide content per 200 nucleotides of the HIV-CRISPR construct (blue line). The Cas9 and Puromycin coding regions are shaded gray. (B) Total copies of wt HIV …

https://doi.org/10.7554/eLife.39823.010
Figure 2—source data 1

THP IFN gene induction and MAGeCK Gene Analysis (Positive Scores) of ZAP-KO THP-1 PIKAHIV HIV-1LAI screens.

TargetID. log2FC IFN. ZAPKO11_uIFN-ZAPKO11_THP.gDNA.pos.score. ZAPKO46_uIFN-ZAPKO46_THP.gDNA.pos.score. ZAPKO x2 uIFN. NegLog10.

https://doi.org/10.7554/eLife.39823.012
Figure 2—figure supplement 1
Download asset Open asset
ZAP and N4BP1 are modest inhibitors of HIV infection.

(A) Western blot confirming KO of ZAP in THP-1 clonal lines. *indicates clonal line used in PIKAHIV ZAP-KO screening (Figure 2B–E). (B) Control (gray) and ZAP-KO (cyan) clonal THP-1 cell lines were …

https://doi.org/10.7554/eLife.39823.011
Figure 3
Download asset Open asset
MxB is a dominant, early-acting ISG whose activity is masked by other ISGs when HIV entry is mediated by VSV-G.

(A) Clonal MxB-KO THP-1 lines generated by transducing with an MxB-targeting sgRNA/lentiCRISPRv2 construct, selection and single-cell sorting. Western blot for MxB expression with and without IFNα …

https://doi.org/10.7554/eLife.39823.013
Figure 3—source data 1

MAGeCK Gene Analysis (Positive) of ZAP-KO THP-1 PIKAHIV HIV-1LAI/VSVG Screen.

pos|score sort: id. num. pos|score. pos|p-value. pos|fdr. pos|rank. pos|goodsgrna. pos|lfc. pos|score(-log10).

https://doi.org/10.7554/eLife.39823.014
Figure 4
Download asset Open asset
TRIM5alpha, IFITM1 and Tetherin are additional ISGs that contribute to the IFN block.

(A) KO efficiencies in lentiCRISPRv2-edited THP-1 cells as determined by ICE analysis (left) or flow cytometry (right – pretreated with 1000 U/mL uIFN). (B) THP-1 cell pools edited for gene targets …

https://doi.org/10.7554/eLife.39823.015
Figure 4—source data 1

ICE KO Editing Analysis.

name. r^2. ICE KO score.

https://doi.org/10.7554/eLife.39823.016
Figure 5
Download asset Open asset
HIV-CRISPR Screening Identifies HIV Dependency Factors.

(A) Negative MAGeCK Gene Scores across both ZAP-KO Screens ranked from most depleted genes on the X-axis. Only the top 25 hits are shown. (B) Left: THP-1 cells were stimulated overnight with IFNα …

https://doi.org/10.7554/eLife.39823.017
Figure 5—source data 1

MAGeCK Gene Analysis (Negative Scores) of ZAP-KO THP-1 PIKAHIV HIV-1LAI screens.

TargetID. log2FC IFN. ZAPKO11_uIFN-ZAPKO11_THP.gDNA.neg.score. ZAPKO46_uIFN-ZAPKO46_THP.gDNA.neg.score. ZAPKO x2 uIFN NEG. ZAPKO x2 uIFN NEG -log10.

https://doi.org/10.7554/eLife.39823.018
Figure 6 with 1 supplement
Download asset Open asset
HIV-CRISPR Screen of an R5-tropic Clade 1 Isolate (HIV-1Q23.BG505).

(A) The PIKAHIV screen was performed in duplicate in ZAP-KO THP-1 cells with HIV-1Q23.BG505. Y-Axis: IFN induction as determined by Differential Expression (DE) Analysis of microarray data in THP-1 …

https://doi.org/10.7554/eLife.39823.019
Figure 6—source data 1

MAGeCK Gene Analysis (Negative) of ZAP-KO THP-1 PIKAHIV HIV-1LAI/VSVG Screen.

neg|score sort: id. num. neg|score. neg|p-value. neg|fdr. pos|rank. neg|goodsgrna. neg|lfc. neg|score(-log10).

https://doi.org/10.7554/eLife.39823.021
Figure 6—figure supplement 1
Download asset Open asset
HIV Dependency Factors for VSV-G pseudotyped HIV-1.

Negative MAGeCK Gene Scores for the HIV-1 VSV-G PIKAHIV screen in ZAP-KO THP-1s with uIFN. Only the top 20 hits are shown. Gray = NTCs; Orange = previously described or novel candidate HIV …

https://doi.org/10.7554/eLife.39823.020

Tables

Key resources table
Reagent type
(species) or resource		DesignationSource or referenceIdentifiersAdditional
information
Cell line
(homo sapiens)		THP-1NIH AIDS Reagent Program9942; RRID: CVCL_0006
Cell line (homo sapiens)THP-1 ZAP-KOthis paperProgenitor: THP-1
Cell line (homo sapiens)THP-1 N4BP1-KOthis paperProgenitor: THP-1
Cell line (homo sapiens)THP-1 MxB-KOthis paperProgenitor: THP-1
Cell line (homo sapiens)293TATCCCRL-3216; RRID: CVCL_0063
Cell line (homo sapiens)TZM-blNIH AIDS Reagent Program8129; RRID: CVCL_B478
AntibodyMxB (goat polyclonal)Santa Cruz Biotechnologiessc-271527; RRID: AB_106495061:200
AntibodyZAP/ZC3HAV1 (rabbit polyclonal)Proteintech16820–1-AP; RRID: AB_27287331:5000
AntibodyN4BP1 (rabbit polyclonal)Cohesion BiosciencesCPA24151:1000
AntibodySEC62 (rabbit polyclonal)Abcamab1688431:2000
Antibodyactin
(rabbit polyclonal)		SigmaA2066; RRID: AB_4766931:5000
Antibodytubulin (mouse monoclonal)SigmaT6199; RRID: AB_4775831:1000
Antibodygoat anti-rabbit IgG-HRPSanta Cruz Biotechnologiessc-2004; RRID: AB_6317461:5000
Antibodydonkey anti-goat HRPSanta Cruz BiotechnologiesSC-2020; RRID: AB_6317281:5000
AntibodyCD169 (Siglec-1) (mouse monoclonal)NOVUSNB600-534; RRID: AB_21890381:50
AntibodyAPC Mouse anti-Human CD4BD Pharmingen555349; RRID: AB_3985931:50
AntibodyCXCR4eBioscience17-9999-42; RRID: AB_17241131:50
AntibodyPE anti-human CD282 (TLR2)BioLegend309707; RRID: AB_3147771:100
AntibodyAPC
anti-human CD317 (BST2/Tetherin)		BioLegend348410; RRID: AB_20671211:50
AntibodyKC57-FITCBeckman Coulter6604665; RRID: AB_1575987
Sequence-
based reagent		ZAP crRNA (ATGTGGAGTCTTGAACACGG)IDTthis paper
Sequence-based reagenttracrRNAIDT1072534
Recombinant DNA reagentlentiCRISPRv2 (plasmid)Addgene52961
Recombinant
DNA reagent		HIV-CRISPR (plasmid)this paperProgenitors: lentiCRISPRv2; Genscript synthesis
Recombinant
DNA reagent		PIKA-HIV (plasmid library)this paperProgenitors: PCR (synthesized oligos); HIV-CRISPR
Recombinant
DNA reagent		pMD2.GAddgene12259
Recombinant
DNA reagent		psPAX2Addgene12260
Recombinant DNA reagentLKO Sec62 shRNASigmaTRCN0000289739
Recombinant
DNA reagent		LKO Sec62 shRNASigmaTRCN0000289833
Recombinant DNA reagentLKO scrambled shRNAAddgene1864
Recombinant DNA reagentLKO CD169
shRNA		SigmaTRCN155147
Recombinant
DNA reagent		pLKO.1neoAddgene13425
Recombinant DNA reagentHIV-1 LAIPMID: 1683726
Recombinant DNA reagentHIV-1 LAI deltaEnvPMID: 9245614
Recombinant DNA reagentHIV-1 LAI vpuFSPMID: 11069982
Recombinant DNA reagentQ23/BG505envPMID: 29590010;10364271
Recombinant DNA reagentpHIV-zsGreenAddgene18121
Recombinant DNA reagentpHIV-zsGreen/CCR5this paperProgenitor: pHIV-zsGreen
Recombinant DNA reagentpSMART-LacZPMID: 15326157
Recombinant DNA reagentpSCA-helperPMID: 9660762
Chemical compound, drugUniversal Type I Interferon AlphaPBL Assay Science11200–1
Chemical compound, drugPuromycinSigmaP8833
Chemical compound, drugDEAE-DextranSigmaD9885
Chemical compound, drugalpha-ChymotrypsinSigmaC4129
Commercial assay or kitAgencourt AMPure XP BeadsBeckman CoulterA63880
Commercial assay or kitQubit dsDNA HS Assay KitThermoFisherQ32854
Commercial assay or kitQIAamp
viral RNA Kit		Qiagen52904
Commercial assay or kitOne-Step RT-ddPCR Advanced Kit for ProbesBioRad1864021
Commercial assay or kitCas9-NLSUC Berkeley MacroLab
Commercial assay or kitAmaxa SG Cell Line 96-well
Nucleofector Kit		LonzaV4SC-3096
Commercial assay or kitEpicentre QuickExtract DNA
Extraction Solution		LucigenQE09050
Commercial assay or kitQIAamp DNA Blood Mini KitQiagen51185
Commercial assay or kitT-20 (Enfuvirtide)NIH AIDS Reagent Program12732
Commercial assay or kitHIV-1 p24 ELISA KitABL inc.5421
Software, algorithmICESynthego (https://ice.synthego.com/#/)
Software, algorithmMAGeCKhttps://sourceforge.net/p/mageck/wiki/Home/PMID: 25476604

Additional files

Supplementary file 1

Oligos and Primers.

Tab 1 (sgRNA oligos): oligo name. oligo_seq. sgRNA name. seq. ICE_F oligo. ICE_R oligo. Tab 2 (sequencing primers): oligo_name. sequence.

https://doi.org/10.7554/eLife.39823.022
Transparent reporting form
https://doi.org/10.7554/eLife.39823.023

Download links