A secretory pathway kinase regulates sarcoplasmic reticulum Ca2+ homeostasis and protects against heart failure
- University of California, San Diego, United States
- La Jolla Institute for Allergy and Immunology, United States
Figures
Figure 1
Fam20C phosphorylates luminal SR proteins and regulates CSQ2 polymerization.
(A) Representative autoradiograph and Flag immunoblot (IB) of Flag immunoprecipitates (IPs) of 32P-orthophosphate-labeled HEK293 cells co-expressing HA-tagged WT or D478A kinase-inactive (KI) Fam20C …
Figure 2
Fam20C phosphorylation of Stim1 regulates Stim1 activation (A) Residues of Stim1 from the canonical Ca2+-binding EF-hand loop corresponding to the Fam20C S-x-E phosphorylation motif are highlighted in blue.
Heart disease associated Stim1-Ser88 is noted with an asterisk (h: human, m: mouse, g: gallus, x: xenopus, d: drosophila). (B) Representative autoradiograph and Flag IB of Flag IPs of 32P-orthophosph…
Figure 3 with 1 supplement
Fam20C regulates Ca2+ handling in isolated cardiomyocytes.
(A and B) Tracing of 0.5 Hz stimulated isolated cardiomyocytes for (A) Ca2+ transients (change between the basal and peak ratio (ΔR) of Fura2-AM fluorescence) and (B) sarcomere length for 2 (top) …
Figure 3—figure supplement 1
Generation of cardiac specific Fam20C cKO mice.
(A) Targeting strategy used to generate a floxed allele of Fam20c. (B) PCR-based DNA electrophoresis genotyping to determine floxed and Cre alleles. (C) RT-qPCR of Fam20C expression of whole heart …
Figure 4 with 1 supplement
Fam20C regulates cardiac contractility and relaxation in vivo.
Hemodynamic assessment of contraction and relaxation (n = 9–20). (A) Assessment of maximum pressure difference over time (dP/dt). (B) Assessment of the isovolumetric relaxation constant tau. Data …
Figure 4—figure supplement 1
Role of Fam20C in the acute hemodynamic response to β-adrenergic receptor activation.
(A–D) Changes in LV hemodynamic variables of 2 and 9 months old mice for (A) minimum dP/dt, (B) end-diastolic pressure, (C) heart rate in beats/min (bpm), and (D) maximum LV pressure (n = 9–20). (E–P…
Figure 5
Fam20C cKO mice develop heart failure upon aging.
(A and B) Echocardiographic measurements for Fam20CFl/Fl α-MHC-Cre-positive (cKO) and α-MHC-Cre-negative littermate control mice (WT) (n = 10 mice at 2, 6, and 9 months) of (A) LVIDd, LVIDs, LV FS, …
Figure 6 with 1 supplement
Aging Fam20C cKO mice develop fibrosis, apoptosis, and DCM.
(A) Representative macroscopic view of whole mouse hearts. (B and C) Representative microscopic view of (B) H and E stained (1x magnification) and (C) Masson’s Trichrome stained (40x magnification) …
Figure 6—figure supplement 1
Aging Fam20C cKO mice develop apoptosis and fibrosis.
(A) Representative microscopic view of TUNEL stained cardiac sections (40x magnification) (n = 3 mice). (B) Whole heart lysates were immunoblotted for cleaved PARP and GAPDH loading control. (C) …
Figure 7 with 1 supplement
Fam20C cKO mice develop heart failure following induced pressure overload.
(A) Echocardiographic measurements for baseline (2 months old) mice and after 4 weeks of TAC (n = 7–9) of LVIDd, LVIDs, and LV FS. (B) Heart weight to body weight ratios (n = 5–9) (left). RT-qPCR of …
Figure 7—figure supplement 1
Induced pressure overload causes hypertrophy, apoptosis in Fam20C cKO mice.
(A) Pressure gradient 1 month after TAC (n = 7–9). (B–C) Echocardiographic measurements for baseline (2 months old) mice and 1 month after TAC of (B) IVSd and (C) LVPWd (n = 7–9). (D) Representative …
Figure 8
Fam20C regulates ER Ca2+ homeostasis.
(A) Single-cell [Ca2+]i measurements in HeLa cells expressing Fam20C WT (n = 156), Fam20C KI (n = 139), or in non-transfected HeLa cells (HeLa; n = 126). Cells were exposed to solutions containing …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Mouse monoclonal M2 FLAG | Sigma | A2220-5 ml, RRID:AB_439685 | (1:100) |
| Antibody | Rabbit polyclonal anti-Flag | Sigma | F7425-.2MG, RRID:AB_796202 | (1:1000) |
| Antibody | Rabbit polyclonal anti-Stim1 | Cell Signaling | 4916S, RRID:AB_1849882 | (1:1000) |
| Antibody | Rabbit polyclonal anti 6x-His | Thermo Fisher | MA1-21315- HRP, RRID:AB_10977997 | (1:2000) |
| Antibody | Rabbit polyclonal anti Bip/ GRP78 | Abcam | ab21685, RRID:AB_880312 | (1:1000) |
| Antibody | Rabbit polyclonal anti Calsequestrin 2 | Thermo Fisher | PA1-913, RRID:AB_2540244 | (1:5000) |
| Antibody | Mouse monoclonal anti GAPDH | Calbiochem | CB1001 | (1:10000) |
| Antibody | Mouse monoclonal anti PARP (cleaved) | Cell Signaling | 9541S, RRID:AB_2160592 | (1:1000) |
| Antibody | Rabbit polyclonal anti Fam20C | Tagliabracci et al., 2013 Tagliabracci et al., 2013 | (1:5000) | |
| Chemical compound, drug | Trizol | Thermo Fisher | 15596026 | |
| Chemical compound, drug | Esmolol | abcam | ab146018 | |
| Chemical compound, drug | Dobutamine | abcam | ab120768 | |
| Chemical compound, drug | Thapsigargin | Thermo Fisher | 586005– 1 MG | |
| Chemical compound, drug | 32P-orthophosphate | PerkinElmer | NEX05 3010MC | |
| Chemical compound, drug | Gamma 32P ATP | PerkinElmer | BLU002Z001MC | |
| Chemical compound, drug | Fura-2, AM, cell permeant | Thermo Fisher | F1221 | |
| Software, algorithm | Graph Pad Prism | Version 7 | ||
| Sequence-based reagent | RT-qPCR primers | this paper | Table 1 | |
| Genetic reagent (M. musculus) | Fam20c Fl/+ | inGenious Targeting Laboratory | ||
| Commercial assay or kit | iScript cDNA Synthesis kit | BioRad | 1708891 | |
| Commercial assay or kit | nucleospin RNA kit | MACHEREY- NAGEL | 740955.25 | |
| Commercial assay or kit | ApopTag Peroxidase In Situ Apoptosis Detection | Millipore Sigma | S7100 | |
| Cell line (homo sapiens) | HEK293T | Tagliabracci et al., 2013 Tagliabracci et al., 2013 | RRID:CVCL_6910 | |
| Cell line (homo sapiens) | HeLa | Hirve et al., 2018 | RRID:CVCL_0030 | |
| Cell line (homo sapiens) | U2OS (WT/shFam20C) | Tagliabracci et al., 2013 Tagliabracci et al., 2013 | RRID:CVCL_0042 | |
| Cell line (rattus norvegicus) | H9C2 | ATCC | CRL-1446, RRID:CVCL_0286 |
Table 1
qRT-PCR primers.
m corresponds to mouse, h corresponds to human.
| Gene | Forward | Reverse |
|---|---|---|
| mANP | TCGTCTTGGCCTTTTGGCT | TCCAGGTGGTCTAGCAGGTTCT |
| mBNP | AAGTCCTAGCCAGTCTCCAGA | GAGCTGTCTCTGGGCCATTTC |
| mβ-MCH | ATGTGCCGGACCTTGGAAG | CCTCGGGTTAGCTGAGAGATCA |
| mCol1a1 | GAGAGAGCATGACCGATGGATT | GCTACGCTGTTCTTGCAGTGAT |
| mCol 3a1 | CAGCAGTCCAACGTAGATGAATTG | CATGGTTCTGGCTTCCAGACA |
| mα-SMA | TCCTGACGCTGAAGTATCCG | GGCCACACGAAGCTCGTTAT |
| mCTGF | AATCTCCACCCGAGTTACCA | AACTTAGCCCTGTATGTCTTCAC |
| mFam20C | AACATGGATCGGCATCACTAC | AGGAGCGAGAATGGAAAGC |
| mGAPDH | CACCATCTTCCAGGAGCGAG | CCTTCTCCATGGTGGTGAAGAC |
| hCHOP | GTCTAAGGCACTGAGCGTATC | CAGGTGTGGTGATGTATGAAGA |
| hGAPDH | ACATCGCTCAGACACCATG | TGTAGTTGAGGTCAATGAAGGG |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.41378.015
