1. Biochemistry and Chemical Biology
Download icon

A secretory pathway kinase regulates sarcoplasmic reticulum Ca2+ homeostasis and protects against heart failure

  1. Adam J Pollak
  2. Canzhao Liu
  3. Aparna Gudlur
  4. Joshua E Mayfield
  5. Nancy D Dalton
  6. Yusu Gu
  7. Ju Chen
  8. Joan Heller Brown
  9. Patrick G Hogan
  10. Sandra E Wiley
  11. Kirk L Peterson
  12. Jack E Dixon  Is a corresponding author
  1. University of California, San Diego, United States
  2. La Jolla Institute for Allergy and Immunology, United States
Research Article
Cite this article as: eLife 2018;7:e41378 doi: 10.7554/eLife.41378
8 figures, 2 tables and 1 additional file

Figures

Fam20C phosphorylates luminal SR proteins and regulates CSQ2 polymerization.

(A) Representative autoradiograph and Flag immunoblot (IB) of Flag immunoprecipitates (IPs) of 32P-orthophosphate-labeled HEK293 cells co-expressing HA-tagged WT or D478A kinase-inactive (KI) Fam20C with the indicated substrates (n = 3). (B) Residues of Calsequestrin 2 (CSQ2) corresponding to the only Fam20C S-x-E phosphorylation motif on the protein are highlighted in blue. (C) Representative autoradiograph and Flag IB of Flag IPs of 32P-orthophosphate-labeled rat cardiomyoblast H9C2 cells expressing the indicated variant of CSQ2 (n = 3). (D) Representative autoradiograph of time-dependent incorporation of [γ-32P] ATP into CSQ2 using purified proteins in an in vitro kinase assay (n = 3). CSQ2-His was expressed and purified from E. coli and Fam20C WT or KI was purified from baculovirus. Corresponding IB of α-His is shown below. (E) Turbidity of un- and phosphorylated-CSQ2 as measured by absorbance at 350 nm (n = 3). (F) Model demonstrating the consequence of Fam20C phosphorylation of CSQ2.

https://doi.org/10.7554/eLife.41378.002
Fam20C phosphorylation of Stim1 regulates Stim1 activation (A) Residues of Stim1 from the canonical Ca2+-binding EF-hand loop corresponding to the Fam20C S-x-E phosphorylation motif are highlighted in blue.

Heart disease associated Stim1-Ser88 is noted with an asterisk (h: human, m: mouse, g: gallus, x: xenopus, d: drosophila). (B) Representative autoradiograph and Flag IB of Flag IPs of 32P-orthophosphate-labeled HEK293 cells co-expressing Stim1-Flag and HA-tagged WT or D478A kinase-inactive (KI) Fam20C (n = 3). (C) Representative autoradiograph of time-dependent incorporation of [γ-32P] ATP into Stim one using purified proteins in an in vitro kinase assay. His-tagged Stim1 was expressed and purified from E. coli, and Fam20C WT or KI was purified from baculovirus (n = 6). Corresponding coomassie staining is shown below. (D) Representative autoradiograph and Flag IB of Flag IPs of 32P-orthophosphate-labeled HEK293 cells co-expressed with Stim1 and WT Fam20C (n = 6). (E) Densitometry relative to protein control of autoradiograph from C and D (at 30 min time point). (F) Representative western blots showing the crosslinking of Stim1(A230C) co-expressed with either Fam20C KI (top), or Fam20C WT (bottom), in cellular membranes incubated with increasing Ca2+ concentrations (0–2.0 mM) (n = 3). Crosslinked, multimerized (active) Stim one is indicated by the upper arrow, and monomeric (inactive) Stim1 is indicated by the lower arrow. (G) Model demonstrating Stim1 activation via either low ER Ca2+ or Fam20C phosphorylation. Data are represented as the mean ±SEM. *p < 0.05 by Student’s t test.

https://doi.org/10.7554/eLife.41378.003
Figure 3 with 1 supplement
Fam20C regulates Ca2+ handling in isolated cardiomyocytes.

(A and B) Tracing of 0.5 Hz stimulated isolated cardiomyocytes for (A) Ca2+ transients (change between the basal and peak ratio (ΔR) of Fura2-AM fluorescence) and (B) sarcomere length for 2 (top) and 9 (bottom) months old mice. (C) Quantitation of normalized peak amplitude (left) and relaxation constant tau (right) of Ca2+ transients from A. (D) Quantitation of peak amplitude changed (left) and relaxation constant tau (right) of sarcomere length from B (n = 3 mice, 15–25 cardiomyocytes per mice). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test or ANOVA (when indicated) for WT v. cKO.

https://doi.org/10.7554/eLife.41378.004
Figure 3—figure supplement 1
Generation of cardiac specific Fam20C cKO mice.

(A) Targeting strategy used to generate a floxed allele of Fam20c. (B) PCR-based DNA electrophoresis genotyping to determine floxed and Cre alleles. (C) RT-qPCR of Fam20C expression of whole heart lysates from 2 months old mice (n = 3). (D) Whole heart lysates were subjected to differential centrifugation fractionation and were analyzed by Immunoblotting.

https://doi.org/10.7554/eLife.41378.005
Figure 4 with 1 supplement
Fam20C regulates cardiac contractility and relaxation in vivo.

Hemodynamic assessment of contraction and relaxation (n = 9–20). (A) Assessment of maximum pressure difference over time (dP/dt). (B) Assessment of the isovolumetric relaxation constant tau. Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test or ANOVA (when indicated) for WT v. cKO.

https://doi.org/10.7554/eLife.41378.006
Figure 4—figure supplement 1
Role of Fam20C in the acute hemodynamic response to β-adrenergic receptor activation.

(A–D) Changes in LV hemodynamic variables of 2 and 9 months old mice for (A) minimum dP/dt, (B) end-diastolic pressure, (C) heart rate in beats/min (bpm), and (D) maximum LV pressure (n = 9–20). (E–P) Changes in LV hemodynamic variables with dobutamine (n = 9) (E–J) and esmolol (n = 6) (K–P) infusion of 2 months old mice. Calculated values for (E) maximum LV pressure, (F) end-diastolic pressure (EDP), (G) heart rate in beats/min (bpm), (H) maximum dP/dt, (I) minimum dP/dt, and (J) time constant for relaxation (Tau). Dobutamine doses are given in micrograms per kilogram per minute. Calculated values for (K) maximum LV pressure, (L) end-diastolic pressure (EDP), (M) heart rate in beats/min (bpm), (N) maximum dP/dt, (O) minimum dP/dt, and (P) time constant for relaxation (Tau). Esmolol doses are given in milligrams per kilogram per minute. Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test for WT v. cKO.

https://doi.org/10.7554/eLife.41378.007
Fam20C cKO mice develop heart failure upon aging.

(A and B) Echocardiographic measurements for Fam20CFl/Fl α-MHC-Cre-positive (cKO) and α-MHC-Cre-negative littermate control mice (WT) (n = 10 mice at 2, 6, and 9 months) of (A) LVIDd, LVIDs, LV FS, (B) IVSd, and LVPWd. (C) RT-qPCR of cardiac fetal gene markers of Fam20C WT and cKO mice at 2 and 9 months (n = 3). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, or ns (not significant) by Student’s t test or ANOVA (when indicated) for WT v. cKO.

https://doi.org/10.7554/eLife.41378.008
Figure 6 with 1 supplement
Aging Fam20C cKO mice develop fibrosis, apoptosis, and DCM.

(A) Representative macroscopic view of whole mouse hearts. (B and C) Representative microscopic view of (B) H and E stained (1x magnification) and (C) Masson’s Trichrome stained (40x magnification) cardiac sections (n = 3). (D) Heart weight to body weight ratios (n = 5–13) (left). Quantitation of TUNEL positive nuclei per high powered field (HPF) (n = 3 mice) (right). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test for WT v. cKO.

https://doi.org/10.7554/eLife.41378.009
Figure 6—figure supplement 1
Aging Fam20C cKO mice develop apoptosis and fibrosis.

(A) Representative microscopic view of TUNEL stained cardiac sections (40x magnification) (n = 3 mice). (B) Whole heart lysates were immunoblotted for cleaved PARP and GAPDH loading control. (C) RT-qPCR of profibrotic genes (n = 3). Data are represented as the mean ±SEM. *p < 0.05 for WT v. cKO by Student’s t test.

https://doi.org/10.7554/eLife.41378.010
Figure 7 with 1 supplement
Fam20C cKO mice develop heart failure following induced pressure overload.

(A) Echocardiographic measurements for baseline (2 months old) mice and after 4 weeks of TAC (n = 7–9) of LVIDd, LVIDs, and LV FS. (B) Heart weight to body weight ratios (n = 5–9) (left). RT-qPCR of cardiac fetal gene markers following TAC (n = 3) (right). (C) Representative microscopic view of Masson’s Trichrome stained (40x magnification) cardiac sections following TAC (n = 3 mice). (D) Mice were subjected to 2 weeks of chronic Isoproterenol (ISO) infusion (n = 5–9). Heart weight over body weight ratio (n = 5–9) (left) and RT-qPCR of cardiac fetal gene markers (n = 3) (right). Data are represented as the mean ±SEM. *p < 0.05, **p < 0.01, for WT v. cKO; † p < 0.05 for TAC or ISO treatment by Student’s t test.

https://doi.org/10.7554/eLife.41378.011
Figure 7—figure supplement 1
Induced pressure overload causes hypertrophy, apoptosis in Fam20C cKO mice.

(A) Pressure gradient 1 month after TAC (n = 7–9). (B–C) Echocardiographic measurements for baseline (2 months old) mice and 1 month after TAC of (B) IVSd and (C) LVPWd (n = 7–9). (D) Representative microscopic view of TUNEL stained cardiac sections (40x magnification) (n = 3 mice). (E) Quantitation of TUNEL positive nuclei per high powered field (HPF) (n = 3). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01 for WT v. cKO; † p < 0.05 for TAC or ISO treatment by Student’s t test.

https://doi.org/10.7554/eLife.41378.012
Fam20C regulates ER Ca2+ homeostasis.

(A) Single-cell [Ca2+]i measurements in HeLa cells expressing Fam20C WT (n = 156), Fam20C KI (n = 139), or in non-transfected HeLa cells (HeLa; n = 126). Cells were exposed to solutions containing varied concentrations of CaCl2 or 1 μM thapsigargin (TG) as indicated. (B) Peak Ca2+ release (maximum minus basal, peak ratio (ΔR) of Fura2-AM fluorescence) of WT and Fam20C shRNA knockdown (shFam20C) U2OS cells following 2 μM thapsigargin (Tg) treatment. (C) RT-qPCR of UPR response gene CHOP expression of WT and shRNA Fam20C knockdown U2OS cells following mild stimulation with thapsigargin (250 nM, 4 hr). Data are represented as the mean ±SEM. *p < 0.05; ***p < 0.001, by Student’s t test for WT v. shFam20C.

https://doi.org/10.7554/eLife.41378.013

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
AntibodyMouse
monoclonal
M2 FLAG
SigmaA2220-5 ml,
RRID:AB_439685
(1:100)
AntibodyRabbit
polyclonal
anti-Flag
SigmaF7425-.2MG,
RRID:AB_796202
(1:1000)
AntibodyRabbit
polyclonal
anti-Stim1
Cell Signaling4916S,
RRID:AB_1849882
(1:1000)
AntibodyRabbit
polyclonal
anti 6x-His
Thermo FisherMA1-21315-
HRP,
RRID:AB_10977997
(1:2000)
AntibodyRabbit
polyclonal
anti Bip/
GRP78
Abcamab21685,
RRID:AB_880312
(1:1000)
AntibodyRabbit
polyclonal
anti Calsequestrin 2
Thermo FisherPA1-913,
RRID:AB_2540244
(1:5000)
AntibodyMouse
monoclonal
anti GAPDH
CalbiochemCB1001(1:10000)
AntibodyMouse
monoclonal
anti PARP
(cleaved)
Cell Signaling9541S,
RRID:AB_2160592
(1:1000)
AntibodyRabbit
polyclonal
anti Fam20C
Tagliabracci et al., 2013
Tagliabracci et al., 2013
(1:5000)
Chemical
compound, drug
TrizolThermo Fisher15596026
Chemical
compound, drug
Esmololabcamab146018
Chemical
compound, drug
Dobutamineabcamab120768
Chemical
compound, drug
ThapsigarginThermo Fisher586005–
1 MG
Chemical
compound, drug
32P-orthophosphatePerkinElmerNEX05
3010MC
Chemical
compound, drug
Gamma 32P ATPPerkinElmerBLU002Z001MC
Chemical
compound, drug
Fura-2, AM,
cell permeant
Thermo FisherF1221
Software,
algorithm
Graph Pad PrismVersion 7
Sequence-based
reagent
RT-qPCR primersthis paperTable 1
Genetic reagent
(M. musculus)
Fam20c Fl/+inGenious
Targeting
Laboratory
Commercial
assay or kit
iScript cDNA
Synthesis kit
BioRad1708891
Commercial
assay or kit
nucleospin
RNA kit
MACHEREY-
NAGEL
740955.25
Commercial
assay or kit
ApopTag
Peroxidase
In Situ Apoptosis
Detection
Millipore
Sigma
S7100
Cell line
(homo sapiens)
HEK293TTagliabracci et al., 2013
Tagliabracci et al., 2013
RRID:CVCL_6910
Cell line
(homo sapiens)
HeLaHirve et al., 2018RRID:CVCL_0030
Cell line
(homo sapiens)
U2OS
(WT/shFam20C)
Tagliabracci et al., 2013
Tagliabracci et al., 2013
RRID:CVCL_0042
Cell line
(rattus norvegicus)
H9C2ATCCCRL-1446, RRID:CVCL_0286
Table 1
qRT-PCR primers.

m corresponds to mouse, h corresponds to human.

https://doi.org/10.7554/eLife.41378.014
GeneForwardReverse
mANPTCGTCTTGGCCTTTTGGCTTCCAGGTGGTCTAGCAGGTTCT
mBNPAAGTCCTAGCCAGTCTCCAGAGAGCTGTCTCTGGGCCATTTC
mβ-MCHATGTGCCGGACCTTGGAAGCCTCGGGTTAGCTGAGAGATCA
mCol1a1GAGAGAGCATGACCGATGGATTGCTACGCTGTTCTTGCAGTGAT
mCol 3a1CAGCAGTCCAACGTAGATGAATTGCATGGTTCTGGCTTCCAGACA
-SMATCCTGACGCTGAAGTATCCGGGCCACACGAAGCTCGTTAT
mCTGFAATCTCCACCCGAGTTACCAAACTTAGCCCTGTATGTCTTCAC
mFam20CAACATGGATCGGCATCACTACAGGAGCGAGAATGGAAAGC
mGAPDHCACCATCTTCCAGGAGCGAGCCTTCTCCATGGTGGTGAAGAC
hCHOPGTCTAAGGCACTGAGCGTATCCAGGTGTGGTGATGTATGAAGA
hGAPDHACATCGCTCAGACACCATGTGTAGTTGAGGTCAATGAAGGG

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)