A secretory pathway kinase regulates sarcoplasmic reticulum Ca2+ homeostasis and protects against heart failure
Figures
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig1-v2.tif/full/617,/0/default.jpg)
Fam20C phosphorylates luminal SR proteins and regulates CSQ2 polymerization.
(A) Representative autoradiograph and Flag immunoblot (IB) of Flag immunoprecipitates (IPs) of 32P-orthophosphate-labeled HEK293 cells co-expressing HA-tagged WT or D478A kinase-inactive (KI) Fam20C with the indicated substrates (n = 3). (B) Residues of Calsequestrin 2 (CSQ2) corresponding to the only Fam20C S-x-E phosphorylation motif on the protein are highlighted in blue. (C) Representative autoradiograph and Flag IB of Flag IPs of 32P-orthophosphate-labeled rat cardiomyoblast H9C2 cells expressing the indicated variant of CSQ2 (n = 3). (D) Representative autoradiograph of time-dependent incorporation of [γ-32P] ATP into CSQ2 using purified proteins in an in vitro kinase assay (n = 3). CSQ2-His was expressed and purified from E. coli and Fam20C WT or KI was purified from baculovirus. Corresponding IB of α-His is shown below. (E) Turbidity of un- and phosphorylated-CSQ2 as measured by absorbance at 350 nm (n = 3). (F) Model demonstrating the consequence of Fam20C phosphorylation of CSQ2.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig2-v2.tif/full/617,/0/default.jpg)
Fam20C phosphorylation of Stim1 regulates Stim1 activation (A) Residues of Stim1 from the canonical Ca2+-binding EF-hand loop corresponding to the Fam20C S-x-E phosphorylation motif are highlighted in blue.
Heart disease associated Stim1-Ser88 is noted with an asterisk (h: human, m: mouse, g: gallus, x: xenopus, d: drosophila). (B) Representative autoradiograph and Flag IB of Flag IPs of 32P-orthophosphate-labeled HEK293 cells co-expressing Stim1-Flag and HA-tagged WT or D478A kinase-inactive (KI) Fam20C (n = 3). (C) Representative autoradiograph of time-dependent incorporation of [γ-32P] ATP into Stim one using purified proteins in an in vitro kinase assay. His-tagged Stim1 was expressed and purified from E. coli, and Fam20C WT or KI was purified from baculovirus (n = 6). Corresponding coomassie staining is shown below. (D) Representative autoradiograph and Flag IB of Flag IPs of 32P-orthophosphate-labeled HEK293 cells co-expressed with Stim1 and WT Fam20C (n = 6). (E) Densitometry relative to protein control of autoradiograph from C and D (at 30 min time point). (F) Representative western blots showing the crosslinking of Stim1(A230C) co-expressed with either Fam20C KI (top), or Fam20C WT (bottom), in cellular membranes incubated with increasing Ca2+ concentrations (0–2.0 mM) (n = 3). Crosslinked, multimerized (active) Stim one is indicated by the upper arrow, and monomeric (inactive) Stim1 is indicated by the lower arrow. (G) Model demonstrating Stim1 activation via either low ER Ca2+ or Fam20C phosphorylation. Data are represented as the mean ±SEM. *p < 0.05 by Student’s t test.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig3-v2.tif/full/617,/0/default.jpg)
Fam20C regulates Ca2+ handling in isolated cardiomyocytes.
(A and B) Tracing of 0.5 Hz stimulated isolated cardiomyocytes for (A) Ca2+ transients (change between the basal and peak ratio (ΔR) of Fura2-AM fluorescence) and (B) sarcomere length for 2 (top) and 9 (bottom) months old mice. (C) Quantitation of normalized peak amplitude (left) and relaxation constant tau (right) of Ca2+ transients from A. (D) Quantitation of peak amplitude changed (left) and relaxation constant tau (right) of sarcomere length from B (n = 3 mice, 15–25 cardiomyocytes per mice). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test or ANOVA (when indicated) for WT v. cKO.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig3-figsupp1-v2.tif/full/617,/0/default.jpg)
Generation of cardiac specific Fam20C cKO mice.
(A) Targeting strategy used to generate a floxed allele of Fam20c. (B) PCR-based DNA electrophoresis genotyping to determine floxed and Cre alleles. (C) RT-qPCR of Fam20C expression of whole heart lysates from 2 months old mice (n = 3). (D) Whole heart lysates were subjected to differential centrifugation fractionation and were analyzed by Immunoblotting.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig4-v2.tif/full/617,/0/default.jpg)
Fam20C regulates cardiac contractility and relaxation in vivo.
Hemodynamic assessment of contraction and relaxation (n = 9–20). (A) Assessment of maximum pressure difference over time (dP/dt). (B) Assessment of the isovolumetric relaxation constant tau. Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test or ANOVA (when indicated) for WT v. cKO.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig4-figsupp1-v2.tif/full/617,/0/default.jpg)
Role of Fam20C in the acute hemodynamic response to β-adrenergic receptor activation.
(A–D) Changes in LV hemodynamic variables of 2 and 9 months old mice for (A) minimum dP/dt, (B) end-diastolic pressure, (C) heart rate in beats/min (bpm), and (D) maximum LV pressure (n = 9–20). (E–P) Changes in LV hemodynamic variables with dobutamine (n = 9) (E–J) and esmolol (n = 6) (K–P) infusion of 2 months old mice. Calculated values for (E) maximum LV pressure, (F) end-diastolic pressure (EDP), (G) heart rate in beats/min (bpm), (H) maximum dP/dt, (I) minimum dP/dt, and (J) time constant for relaxation (Tau). Dobutamine doses are given in micrograms per kilogram per minute. Calculated values for (K) maximum LV pressure, (L) end-diastolic pressure (EDP), (M) heart rate in beats/min (bpm), (N) maximum dP/dt, (O) minimum dP/dt, and (P) time constant for relaxation (Tau). Esmolol doses are given in milligrams per kilogram per minute. Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test for WT v. cKO.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig5-v2.tif/full/617,/0/default.jpg)
Fam20C cKO mice develop heart failure upon aging.
(A and B) Echocardiographic measurements for Fam20CFl/Fl α-MHC-Cre-positive (cKO) and α-MHC-Cre-negative littermate control mice (WT) (n = 10 mice at 2, 6, and 9 months) of (A) LVIDd, LVIDs, LV FS, (B) IVSd, and LVPWd. (C) RT-qPCR of cardiac fetal gene markers of Fam20C WT and cKO mice at 2 and 9 months (n = 3). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, or ns (not significant) by Student’s t test or ANOVA (when indicated) for WT v. cKO.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig6-v2.tif/full/617,/0/default.jpg)
Aging Fam20C cKO mice develop fibrosis, apoptosis, and DCM.
(A) Representative macroscopic view of whole mouse hearts. (B and C) Representative microscopic view of (B) H and E stained (1x magnification) and (C) Masson’s Trichrome stained (40x magnification) cardiac sections (n = 3). (D) Heart weight to body weight ratios (n = 5–13) (left). Quantitation of TUNEL positive nuclei per high powered field (HPF) (n = 3 mice) (right). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01, by Student’s t test for WT v. cKO.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig6-figsupp1-v2.tif/full/617,/0/default.jpg)
Aging Fam20C cKO mice develop apoptosis and fibrosis.
(A) Representative microscopic view of TUNEL stained cardiac sections (40x magnification) (n = 3 mice). (B) Whole heart lysates were immunoblotted for cleaved PARP and GAPDH loading control. (C) RT-qPCR of profibrotic genes (n = 3). Data are represented as the mean ±SEM. *p < 0.05 for WT v. cKO by Student’s t test.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig7-v2.tif/full/617,/0/default.jpg)
Fam20C cKO mice develop heart failure following induced pressure overload.
(A) Echocardiographic measurements for baseline (2 months old) mice and after 4 weeks of TAC (n = 7–9) of LVIDd, LVIDs, and LV FS. (B) Heart weight to body weight ratios (n = 5–9) (left). RT-qPCR of cardiac fetal gene markers following TAC (n = 3) (right). (C) Representative microscopic view of Masson’s Trichrome stained (40x magnification) cardiac sections following TAC (n = 3 mice). (D) Mice were subjected to 2 weeks of chronic Isoproterenol (ISO) infusion (n = 5–9). Heart weight over body weight ratio (n = 5–9) (left) and RT-qPCR of cardiac fetal gene markers (n = 3) (right). Data are represented as the mean ±SEM. *p < 0.05, **p < 0.01, for WT v. cKO; † p < 0.05 for TAC or ISO treatment by Student’s t test.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig4-v2.tif/full/617,/0/default.jpg)
Induced pressure overload causes hypertrophy, apoptosis in Fam20C cKO mice.
(A) Pressure gradient 1 month after TAC (n = 7–9). (B–C) Echocardiographic measurements for baseline (2 months old) mice and 1 month after TAC of (B) IVSd and (C) LVPWd (n = 7–9). (D) Representative microscopic view of TUNEL stained cardiac sections (40x magnification) (n = 3 mice). (E) Quantitation of TUNEL positive nuclei per high powered field (HPF) (n = 3). Data are represented as the mean ±SEM. *p < 0.05; **p < 0.01 for WT v. cKO; † p < 0.05 for TAC or ISO treatment by Student’s t test.
![](https://iiif.elifesciences.org/lax/41378%2Felife-41378-fig8-v2.tif/full/617,/0/default.jpg)
Fam20C regulates ER Ca2+ homeostasis.
(A) Single-cell [Ca2+]i measurements in HeLa cells expressing Fam20C WT (n = 156), Fam20C KI (n = 139), or in non-transfected HeLa cells (HeLa; n = 126). Cells were exposed to solutions containing varied concentrations of CaCl2 or 1 μM thapsigargin (TG) as indicated. (B) Peak Ca2+ release (maximum minus basal, peak ratio (ΔR) of Fura2-AM fluorescence) of WT and Fam20C shRNA knockdown (shFam20C) U2OS cells following 2 μM thapsigargin (Tg) treatment. (C) RT-qPCR of UPR response gene CHOP expression of WT and shRNA Fam20C knockdown U2OS cells following mild stimulation with thapsigargin (250 nM, 4 hr). Data are represented as the mean ±SEM. *p < 0.05; ***p < 0.001, by Student’s t test for WT v. shFam20C.
Tables
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Antibody | Mouse monoclonal M2 FLAG | Sigma | A2220-5 ml, RRID:AB_439685 | (1:100) |
Antibody | Rabbit polyclonal anti-Flag | Sigma | F7425-.2MG, RRID:AB_796202 | (1:1000) |
Antibody | Rabbit polyclonal anti-Stim1 | Cell Signaling | 4916S, RRID:AB_1849882 | (1:1000) |
Antibody | Rabbit polyclonal anti 6x-His | Thermo Fisher | MA1-21315- HRP, RRID:AB_10977997 | (1:2000) |
Antibody | Rabbit polyclonal anti Bip/ GRP78 | Abcam | ab21685, RRID:AB_880312 | (1:1000) |
Antibody | Rabbit polyclonal anti Calsequestrin 2 | Thermo Fisher | PA1-913, RRID:AB_2540244 | (1:5000) |
Antibody | Mouse monoclonal anti GAPDH | Calbiochem | CB1001 | (1:10000) |
Antibody | Mouse monoclonal anti PARP (cleaved) | Cell Signaling | 9541S, RRID:AB_2160592 | (1:1000) |
Antibody | Rabbit polyclonal anti Fam20C | Tagliabracci et al., 2013 Tagliabracci et al., 2013 | (1:5000) | |
Chemical compound, drug | Trizol | Thermo Fisher | 15596026 | |
Chemical compound, drug | Esmolol | abcam | ab146018 | |
Chemical compound, drug | Dobutamine | abcam | ab120768 | |
Chemical compound, drug | Thapsigargin | Thermo Fisher | 586005– 1 MG | |
Chemical compound, drug | 32P-orthophosphate | PerkinElmer | NEX05 3010MC | |
Chemical compound, drug | Gamma 32P ATP | PerkinElmer | BLU002Z001MC | |
Chemical compound, drug | Fura-2, AM, cell permeant | Thermo Fisher | F1221 | |
Software, algorithm | Graph Pad Prism | Version 7 | ||
Sequence-based reagent | RT-qPCR primers | this paper | Table 1 | |
Genetic reagent (M. musculus) | Fam20c Fl/+ | inGenious Targeting Laboratory | ||
Commercial assay or kit | iScript cDNA Synthesis kit | BioRad | 1708891 | |
Commercial assay or kit | nucleospin RNA kit | MACHEREY- NAGEL | 740955.25 | |
Commercial assay or kit | ApopTag Peroxidase In Situ Apoptosis Detection | Millipore Sigma | S7100 | |
Cell line (homo sapiens) | HEK293T | Tagliabracci et al., 2013 Tagliabracci et al., 2013 | RRID:CVCL_6910 | |
Cell line (homo sapiens) | HeLa | Hirve et al., 2018 | RRID:CVCL_0030 | |
Cell line (homo sapiens) | U2OS (WT/shFam20C) | Tagliabracci et al., 2013 Tagliabracci et al., 2013 | RRID:CVCL_0042 | |
Cell line (rattus norvegicus) | H9C2 | ATCC | CRL-1446, RRID:CVCL_0286 |
qRT-PCR primers.
m corresponds to mouse, h corresponds to human.
Gene | Forward | Reverse |
---|---|---|
mANP | TCGTCTTGGCCTTTTGGCT | TCCAGGTGGTCTAGCAGGTTCT |
mBNP | AAGTCCTAGCCAGTCTCCAGA | GAGCTGTCTCTGGGCCATTTC |
mβ-MCH | ATGTGCCGGACCTTGGAAG | CCTCGGGTTAGCTGAGAGATCA |
mCol1a1 | GAGAGAGCATGACCGATGGATT | GCTACGCTGTTCTTGCAGTGAT |
mCol 3a1 | CAGCAGTCCAACGTAGATGAATTG | CATGGTTCTGGCTTCCAGACA |
mα-SMA | TCCTGACGCTGAAGTATCCG | GGCCACACGAAGCTCGTTAT |
mCTGF | AATCTCCACCCGAGTTACCA | AACTTAGCCCTGTATGTCTTCAC |
mFam20C | AACATGGATCGGCATCACTAC | AGGAGCGAGAATGGAAAGC |
mGAPDH | CACCATCTTCCAGGAGCGAG | CCTTCTCCATGGTGGTGAAGAC |
hCHOP | GTCTAAGGCACTGAGCGTATC | CAGGTGTGGTGATGTATGAAGA |
hGAPDH | ACATCGCTCAGACACCATG | TGTAGTTGAGGTCAATGAAGGG |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.41378.015