1. Ecology

The cuticular hydrocarbon profiles of honey bee workers develop via a socially-modulated innate process

  1. Cassondra L Vernier
  2. Joshua J Krupp
  3. Katelyn Marcus
  4. Abraham Hefetz
  5. Joel D Levine
  6. Yehuda Ben-Shahar  Is a corresponding author
  1. Washington University in Saint Louis, United States
  2. University of Toronto Mississauga, Canada
  3. Tel Aviv University, Israel
https://doi.org/10.7554/eLife.41855
Share this article
Cite this article
  1. Cassondra L Vernier
  2. Joshua J Krupp
  3. Katelyn Marcus
  4. Abraham Hefetz
  5. Joel D Levine
  6. Yehuda Ben-Shahar
(2019)
The cuticular hydrocarbon profiles of honey bee workers develop via a socially-modulated innate process
eLife 8:e41855.
https://doi.org/10.7554/eLife.41855
  2. Download BibTeX
  3. Download .RIS
5 figures, 2 videos, 7 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
CHC profiles of bees exhibit quantitative and qualitative changes in association with age.

(A) Total CHC amounts (μg) extracted from sister bees of different ages. (B) CHC profiles of sister bees of different ages. (C) Statistically significantly changing amounts (μg) of individual CHCs across sister bees of different ages. (D) A subset of C with low amounts. (E) Statistically significantly changing proportions of individual CHCs across sister bees of different ages. (F) A subset of C with low proportions. Statistics in A using ANOVA followed by Tukey’s HSD post-hoc. Statistics in B using Permutation MANOVA followed by FDR pairwise contrasts shown as a non-metric multidimensional scaling plot depicting Bray-Curtis dissimilarity between samples. Statistics for C and D are listed in Table 1, statistics for E and F are listed in Table 3. Lowercase letters above bars in A and legend in B denote posthoc significance (p<0.05). Sample size per group, N = 8.

https://doi.org/10.7554/eLife.41855.003
Figure 1—source data 1

Amount (ng) of each compound extracted from each bee sample in Figure 1 and Figure 1—figure supplement 1.

https://doi.org/10.7554/eLife.41855.005
Figure 1—figure supplement 1
Download asset Open asset
CHC profiles of bees exhibit quantitative and qualitative changes in association with age.

Data shown here and in Figure 1 were collected from two independent colonies. (A) Total CHC amounts (μg) extracted from sister bees of different ages. (B) CHC profiles of sister bees of different ages. (C) Statistically significantly changing amounts (μg) of individual CHCs across sister bees of different ages. (D) A subset of C with low amounts. (E) Statistically significantly changing proportions of individual CHCs across sister bees of different ages. (F) A subset of C with low proportions. Statistics in A using ANOVA followed by Tukey’s HSD post-hoc. Statistics in B using Permutation MANOVA followed by FDR pairwise contrasts, shown as a non-metric multidimensional scaling plot depicting Bray-Curtis dissimilarity between samples. Statistics for C and D are listed in Table 2, statistics for E and F are listed in Table 4. Letters in graph and legend denote posthoc statistical significance (p<0.05). Sample size per group, N = 8.

https://doi.org/10.7554/eLife.41855.004
Figure 2 with 1 supplement
Download asset Open asset
Effect of task on the CHC profile of bees is independent of age.

Single cohort colony bees differ in CHC profile by behavioral task at one week of age (typical nurse age, (A)) and three weeks of age (typical forager age, (B)). (C) SCC bees do not differ in total CHC amount due to age and/or task. (D) Undertakers and nurses differ from foragers in CHC profile. (E) ‘Big-back’ bees differ from same-aged actively foraging sisters in CHC profile. Total CHC statistics (C) using ANOVA followed by Tukey’s HSD with FDR correction. CHC profile statistics (A, B, D, E) using Permutation MANOVA followed by FDR pairwise contrasts, shown as non-metric multidimensional scaling plots depicting Bray-Curtis dissimilarity between samples. Letters in graphs and legends denote posthoc statistical significance (p<0.05). Sample size per group, N = 8.

https://doi.org/10.7554/eLife.41855.010
Figure 2—source data 1

Amount (ng) of each compound extracted from each bee sample in Figure 2 and Figure 2—figure supplement 1.

https://doi.org/10.7554/eLife.41855.012
Figure 2—figure supplement 1
Download asset Open asset
CHC profiles differ between unknown-aged foragers from two different colonies at a single location.

Statistics using Permutation MANOVA followed by FDR pairwise contrasts shown as a non-metric multidimensional scaling plot depicting Bray-Curtis dissimilarity between samples. Lowercase letters in legend denote posthoc significance (p<0.05). Sample size per group, N = 8.

https://doi.org/10.7554/eLife.41855.011
Figure 3 with 1 supplement
Download asset Open asset
Cross-fostering indicates colony environment drives the signature CHC profiles of foragers.

Age-matched cross-fostered bees differ in CHC profile by source colony at Day 7 (A) and Day 14 (B), and by both source colony and foster colony when they are foragers (C). Number to left of arrow in legend represents the bee’s source colony, and the number to the right represents the bee’s foster colony. All statistics using Permutation MANOVA followed by FDR pairwise contrasts, shown as non-metric multidimensional scaling plots depicting Bray-Curtis dissimilarity between samples. Letters in legends denote posthoc statistical significance (p<0.05). Sample size per group, N = 8.

https://doi.org/10.7554/eLife.41855.014
Figure 3—source data 1

Amount (ng) of each compound extracted from each bee sample in Figure 3.

https://doi.org/10.7554/eLife.41855.016
Figure 3—figure supplement 1
Download asset Open asset
Sample size assessment of cross-fostered bees indicates sample size of 8 is adequate.

Pseudo multivariate dissimilarity-based standard error ‘levels off’ around a sample size of 7 for all cross-fostered groups at Day 7 (A), Day 14 (B), and when they are foragers (C).

https://doi.org/10.7554/eLife.41855.015
Figure 4
Download asset Open asset
Age and social environment affect the expression level of CHC biosynthesis genes.

(A) Elongase gene. (B–C) Desaturase genes. Only genes with different expression levels between at least two groups are shown (See Table 7 for results for all studied genes). Black bars represent bees raised in their own colony. Grey bars represent sister forager bees that were raised in an unrelated colony (‘Fostered’). (D) Heat map of relative expression levels of all genes tested. Aging bee statistics using ANOVA followed by Tukey HSD post-hoc, or Kruskal-Wallis followed by Dunn’s Test with FDR adjustment post-hoc, with letters denoting posthoc statistical significance (p<0.05). Between colony statistics using Mann-Whitney U test, with asterisks above grey bars denoting statistical significance from foraging bees raised in their own colony (*, p<0.05). Sample size per group, N = 4.

https://doi.org/10.7554/eLife.41855.017
Figure 4—source data 1

Average Ct scores across three technical replicates for each bee sample for every elongase and desaturase gene, including those corresponding to Figure 4.

https://doi.org/10.7554/eLife.41855.018
Figure 5
Download asset Open asset
Nestmate recognition cues are forager-specific.

(A) Bees are accepted at a similar rate as Colony one foragers at the entrance to their source colony (Colony 1) at all ages. (B) Bees are rejected at a similar rate as Colony one foragers at an unrelated colony (Colony 2) on Day one and Day 21. However, bees are accepted at a similar rate as Colony two foragers at an unrelated colony (Colony 2) on Day seven and Day 14. All statistics using Pearson’s Chi-Square. Asterisks or letters denote posthoc statistical significance (p<0.05), ns denotes non-significant comparisons. Sample size per group, N = 18–29.

https://doi.org/10.7554/eLife.41855.021
Figure 5—source data 1

Acceptance/Rejection scores for each bee tested in behavioral acceptance assays depicted in Figure 5.

https://doi.org/10.7554/eLife.41855.022

Videos

Video 1
Download asset
An interaction between a guard and focal bee scored as ‘Rejected’.

The focal bee is marked with a green dot on its thorax.

https://doi.org/10.7554/eLife.41855.023
Video 2
Download asset
An interaction between a guard and focal bee scored as ‘Accepted’.

The focal bee is marked with a pink dot on its thorax.

https://doi.org/10.7554/eLife.41855.024

Tables

Table 1
Individual CHCs vary in total amount (ng) across different aged sister bees of a single colony.

Numbers represent mean amount (ng) of compound across bees of that age ±standard error. All p-values are from parametric ANOVA or nonparametric Kruskal Wallis ANOVA (denoted by ‘KW’). Letters denote statistically significant age groups across individual compounds via Tukey’s HSD (ANOVA post-hoc) or Dunn’s Test with FDR adjustment (KW post-hoc) (p<0.05).

https://doi.org/10.7554/eLife.41855.006
CompoundNameRetention timeDay 1Day 7Day 14Foragingp-value
C18:1z-(9)-Octadecenoic acid20.23146.91 ± 52.98 (A)1213.9 ± 250.45 (AB)2193.35 ± 360.14 (B)2465.05 ± 779.73 (B)0.004 (KW)
C23:1Tricosene20.72121.69 ± 7.05 (A)86.74 ± 9.13 (B)68.64 ± 9.57 (B)61.79 ± 9.87 (B)<0.001
C23Tricosane21.211372.77 ± 115.62 (A)811.16 ± 97.45 (B)688.47 ± 50.32 (B)662.47 ± 70.72 (B)0.001 (KW)
C24Tetracosane22.7943.54 ± 2.3341.8 ± 3.5846.47 ± 2.6745.66 ± 4.390.756
C25:1Pentacosene23.89134.75 ± 7.73167.38 ± 15.77131.94 ± 10.87122.74 ± 13.460.123 (KW)
C25Pentacosane24.341280.62 ± 78.611253.94 ± 145.031364.18 ± 51.81465.39 ± 195.170.663
C27:1Heptacosene26.87359.94 ± 109.71 (A)67.55 ± 5.22 (B)299.98 ± 33.28 (A)340.49 ± 29.27 (A)0.006
C27Heptacosane27.35021.35 ± 335.433561.92 ± 394.093875.36 ± 135.844098.48 ± 688.780.071 (KW)
11,13 methyl C2711- + 13 methyl Heptacosane27.751531.35 ± 58.53 (A)676.77 ± 53.97 (B)525.89 ± 19.46 (BC)501.91 ± 32.38 (C)<0.001
C28Octacosane28.67273.28 ± 26.17 (A)164.61 ± 17.67 (B)234.58 ± 29.25 (AB)179.57 ± 26.62 (AB)0.018
C29:1Nonacosene29.71300.3 ± 21.91 (A)415.71 ± 19.53 (B)484.12 ± 21.65 (B)515.79 ± 37.33 (B)<0.001
C29Nonacosane30.053891.37 ± 203.933361.26 ± 373.33535.4 ± 161.93421.62 ± 376.050.626 (KW)
11,13 methyl C2911- + 13 methyl Nonacosane30.481888.38 ± 76.35 (A)621.6 ± 51.82 (B)490.47 ± 27.34 (B)482.86 ± 24.65 (B)<0.001
z(7) C31:1z-(7)-Hentriacontene32.721930.38 ± 95.12 (A)3030.3 ± 152.07 (B)3336.99 ± 139.27 (B)3437.57 ± 146.12 (B)<0.001
z(9) C31:1z-(9)Hentriacontene32.851572.04 ± 82.09 (A)2623.84 ± 145.02 (B)2756.09 ± 101.15 (B)2748.6 ± 137.39 (B)<0.001
C31Hentriacontane33.252471.77 ± 155.093307.06 ± 347.63095.7 ± 150.222904.22 ± 351.690.158 (KW)
C33:2Tritriacontadiene36.44818.13 ± 30.77 (A)3901.71 ± 233.3 (B)4700.8 ± 289.64 (BC)5351.18 ± 332.47 (C)<0.001 (KW)
C33:1Tritriacotene37.135228.89 ± 272.19 (A)8952.18 ± 674.83 (B)7673.85 ± 413.67 (B)6778.42 ± 442.85 (AB)<0.001 (KW)
C33Tritriacotane37.76282.16 ± 19.8 (A)523.87 ± 57.72 (B)485.29 ± 30.47 (B)440.35 ± 70.92 (AB)0.009
Table 2
Individual CHCs vary in total amount (ng) across different aged sister bees of a second colony.

Numbers represent mean amount (ng) of compound across bees of that age ±standard error. All p-values are from parametric ANOVA or nonparametric Kruskal Wallis ANOVA (denoted by ‘KW’). Letters denote statistically significant age groups across individual compounds via Tukey’s HSD (ANOVA post-hoc) or Dunn’s Test with FDR adjustment (KW post-hoc) (p<0.05).

https://doi.org/10.7554/eLife.41855.007
CompoundNameRetention timeDay 1Day 7Day 14Foragingp-value
C18:1z-(9)-Octadecenoic acid20.23969.4 ± 284.09 (A)4062.76 ± 288.4 (B)4410.73 ± 736.18 (B)5711.9 ± 1741.17 (B)0.004 (KW)
C23:1Tricosene20.72188.84 ± 31.5 (A)252.45 ± 41.06 (AB)449.27 ± 129.73 (AB)692.43 ± 192.5 (B)0.022 (KW)
C23Tricosane21.212243.49 ± 329.451154.47 ± 276.643173.75 ± 1310.786778.99 ± 3385.430.108 (KW)
C24Tetracosane22.7992.03 ± 12.8106.76 ± 34.59191.62 ± 59.85259.68 ± 810.078 (KW)
C25:1Pentacosene23.89223.72 ± 29.37 (A)369.19 ± 74.13 (AB)904.72 ± 314.93 (BC)1000.5 ± 254.7 (C)0.005 (KW)
C25Pentacosane24.342897.27 ± 364.492820.94 ± 730.868160.17 ± 3143.658074.9 ± 3225.520.274 (KW)
C27:1Heptacosene26.87189.37 ± 62.24 (A)412.19 ± 85.56 (AB)804.57 ± 288.89 (B)635.81 ± 116.71 (B)0.017 (KW)
C27Heptacosane27.310263.39 ± 1505.499644.33 ± 1394.5515012.59 ± 3058.189042.02 ± 993.340.618 (KW)
11,13 methyl C2711- + 13 methyl Heptacosane27.751373.16 ± 158.58 (A)722.54 ± 92.7 (AB)501.89 ± 82.05 (B)575.83 ± 217.27 (B)0.004 (KW)
C28Octacosane28.67284.5 ± 54.42361.39 ± 56.38430.28 ± 67.21331.85 ± 35.450.348
C29:1Nonacosene29.71420.31 ± 81.15 (A)1047.99 ± 126.61 (B)1491.92 ± 256 (B)925.21 ± 121.1 (B)0.002 (KW)
C29Nonacosane30.055391.23 ± 107110175 ± 1632.1912313.81 ± 2374.128962.64 ± 1385.720.087
11,13 methyl C2911- + 13 methyl Nonacosane30.481702.45 ± 166.85 (A)800.59 ± 95.67 (A)535.16 ± 66.24 (AB)382.5 ± 50.73 (B)<0.001
z(7) C31:1z-(7)-Hentriacontene32.722189.03 ± 291.48 (A)5370.16 ± 756.21 (B)6185.18 ± 761.39 (B)4426.13 ± 737.85 (AB)0.005
z(9) C31:1z-(9)Hentriacontene32.851465.83 ± 254.41 (A)4120.89 ± 652.81 (B)4581.47 ± 665.27 (B)3361.18 ± 661.26 (AB)0.012
C31Hentriacontane33.253796.75 ± 847.9610066.5 ± 1716.9710082.89 ± 2677.187342.33 ± 1569.250.121
C33:2Tritriacontadiene36.44242.82 ± 53.78 (A)1724.73 ± 289.89 (B)1353.86 ± 175.8 (B)1393.43 ± 313.9 (B)0.002
C33:1Tritriacotene37.137454.8 ± 1388.34 (A)18126.35 ± 2516.57 (B)17031.3 ± 3257.55 (AB)9630.94 ± 1791.06 (AB)0.014
C33Tritriacotane37.76540.28 ± 149 (A)2165.09 ± 457.66 (B)1734.79 ± 523.36 (AB)1214.4 ± 271.66 (AB)0.037 (KW)
Table 3
Individual CHCs vary in proportion across different aged sister bees of a single colony.

Numbers represent mean percentage of compound across bees of that age ±standard error. All p-values are from parametric ANOVA or nonparametric Kruskal Wallis ANOVA (denoted by ‘KW’). Letters denote statistically significant age groups across individual compounds via Tukey’s HSD (ANOVA post-hoc) or Dunn’s Test with FDR adjustment (KW post-hoc) (p<0.05).

https://doi.org/10.7554/eLife.41855.008
CompoundNameRetention timeDay 1Day 7Day 14Foragingp-value
C18:1z-(9)-Octadecenoic acid20.230.51 ± 0.19 (A)3.55 ± 0.81 (B)6.05 ± 0.95 (B)6.68 ± 1.83 (B)<0.001 (KW)
C23:1Tricosene20.720.43 ± 0.03 (A)0.25 ± 0.02 (B)0.19 ± 0.03 (B)0.17 ± 0.03 (B)<0.001 (KW)
C23Tricosane21.214.79 ± 0.33 (A)2.30 ± 0.18 (B)1.93 ± 0.16 (B)1.83 ± 0.14 (B)<0.001
C24Tetracosane22.790.15 ± 0.010.12 ± 0.010.13 ± 0.010.13 ± 0.010.051
C25:1Pentacosene23.890.47 ± 0.02 (A)0.48 ± 0.03 (A)0.37 ± 0.03 (AB)0.35 ± 0.04 (B)0.006
C25Pentacosane24.344.46 ± 0.173.54 ± 0.233.82 ± 0.194.02 ± 0.350.051 (KW)
C27:1Heptacosene26.871.25 ± 0.36 (A)0.19 ± 0.01 (B)0.85 ± 0.11 (A)0.98 ± 0.11 (A)0.002 (KW)
C27Heptacosane27.3017.45 ± 0.77 (A)10.05 ± 0.62 (B)10.79 ± 0.38 (B)11.06 ± 1.29 (B)0.001 (KW)
11,13 methyl C2711- + 13 methyl Heptacosane27.755.38 ± 0.24 (A)1.95 ± 0.09 (B)1.47 ± 0.07 (B)1.43 ± 0.11 (B)<0.001
C28Octacosane28.670.94 ± 0.06 (A)0.47 ± 0.03 (B)0.65 ± 0.08 (AB)0.51 ± 0.08 (B)0.001 (KW)
C29:1Nonacosene29.711.05 ± 0.06 (A)1.21 ± 0.04 (AB)1.35 ± 0.06 (B)1.46 ± 0.10 (B)0.001
C29Nonacosane30.0513.58 ± 0.33 (A)9.49 ± 0.55 (B)9.82 ± 0.37 (B)9.34 ± 0.47 (B)<0.001
11,13 methyl C2911- + 13 methyl Nonacosane30.486.62 ± 0.24 (A)1.79 ± 0.08 (B)1.37 ± 0.08 (B)1.37 ± 0.08 (B)<0.001
z(7) C31:1z-(7)-Hentriacontene32.726.75 ± 0.23 (A)8.82 ± 0.39 (B)9.26 ± 0.26 (B)9.72 ± 0.44 (B)<0.001
z(9) C31:1z-(9)Hentriacontene32.855.48 ± 0.16 (A)7.60 ± 0.23 (B)7.65 ± 0.16 (B)7.73 ± 0.26 (B)<0.001
C31Hentriacontane33.258.58 ± 0.269.39 ± 0.558.61 ± 0.377.90 ± 0.510.148
C33:2Tritriacontadiene36.442.88 ±. 14 (A)11.33 ± 0.46 (B)13.08 ± 0.77 (B)15.27 ± 1.26 (B)<0.001 (KW)
C33:1Tritriacotene37.1318.29 ± 0.78 (A)25.97 ± 1.58 (B)21.26 ± 0.75 (A)18.88 ± 0.32 (A)<0.001
C33Tritriacotane37.760.98 ± 0.06 (A)1.50 ± 0.13 (B)1.35 ± 0.08 (AB)1.19 ± 0.13 (AB)0.012
Table 4
Individual CHCs vary in proportion across different aged sister bees of a second colony.

Numbers represent mean percentage of compound across bees of that age ±standard error. All p-values are from parametric ANOVA or nonparametric Kruskal Wallis ANOVA (denoted by ‘KW’). Letters denote statistically significant age groups across individual compounds via Tukey’s HSD (ANOVA post-hoc) or Dunn’s Test with FDR adjustment (KW post-hoc) (p<0.05).

https://doi.org/10.7554/eLife.41855.009
CompoundNameRetention timeDay 1Day 7Day 14Foragingp-value
C18:1z-(9)-Octadecenoic acid20.232.47 ± 0.64 (A)6.06 ± 0.91 (B)5.34 ± 0.98 (AB)7.66 ± 1.78 (B)0.020 (KW)
C23:1Tricosene20.720.47 ± 0.06 (AB)0.36 ± 0.07 (A)0.51 ± 0.13 (AB)0.95 ± 0.23 (B)0.034
C23Tricosane21.215.61 ± 0.71 (A)1.82 ± 0.63 (B)3.59 ± 1.50 (AB)9.13 ± 4.29 (AB)0.017 (KW)
C24Tetracosane22.790.13 ± 0.030.11 ± 0.020.09 ± 0.020.12 ± 0.020.662
C25:1Pentacosene23.890.54 ± 0.040.55 ± 0.141.02 ± 0.321.40 ± 0.320.050 (KW)
C25Pentacosane24.347.09 ± 0.614.55 ± 1.739.17 ± 3.5411.10 ± 4.180.106 (KW)
C27:1Heptacosene26.870.28 ± 0.065 (A)0.62 ± 0.17 (AB)0.92 ± 0.29 (AB)0.91 ± 0.15 (B)0.030 (KW)
C27Heptacosane27.324.41 ± 0.59 (A)13.81 ± 2.39 (B)16.22 ± 2.35 (B)12.97 ± 1.28 (B)0.012 (KW)
11,13 methyl C2711- + 13 methyl Heptacosane27.753.76 ± 0.83 (A)0.93 ± 0.07 (A)0.57 ± 0.08 (B)0.44 ± 0.08 (B)<0.001 (KW)
C28Octacosane28.670.68 ± 0.110.48 ± 0.040.48 ± 0.050.49 ± 0.060.347 (KW)
C29:1Nonacosene29.710.98 ± 0.080.93 ± 0.211.71 ± 0.241.23 ± 0.320.095
C29Nonacosane30.0512.39 ± 0.8013.18 ± 1.1513.80 ± 2.0813.14 ± 2.020.952
11,13 methyl C2911- + 13 methyl Nonacosane30.484.62 ± 0.95 (A)1.11 ± 0.09 (A)0.60 ± 0.05 (B)0.58 ± 0.10 (B)<0.001 (KW)
z(7) C31:1z-(7)-Hentriacontene32.725.27 ± 0.307.30 ± 0.757.20 ± 0.966.65 ± 1.290.450
z(9) C31:1z-(9)Hentriacontene32.853.43 ± 0.245.47 ± 0.625.25 ± 0.714.99 ± 1.040.257
C31Hentriacontane33.258.64 ± 0.7213.02 ± 1.5210.97 ± 2.1310.50 ± 2.030.418
C33:2Tritriacontadiene36.440.55 ± 0.07 (A)2.38 ± 0.35 (B)1.58 ± 0.22 (AB)2.09 ± 0.49 (B)0.006
C33:1Tritriacotene37.1317.47 ± 1.3124.51 ± 2.8319.14 ± 3.0613.95 ± 2.380.056
C33Tritriacotane37.761.21 ± 0.162.83 ± 0.511.84 ± 0.361.73 ± 0.350.116 (KW)
Table 5
CHCs vary in relative proportion between foragers and in-hive bees across studies.

Numbers represent difference in mean percentage of each compound in forager bees relative to in-hive bees. ‘Hive 1’ denotes forager bees minus Day 14 bees corresponding to Figure 1; ‘Hive 2’ denotes forager bees minus Day 14 bees corresponding to Figure 1—figure supplement 1; ‘SCC week 1’ and ‘SCC week 3’ denote forager bees minus nurse bees corresponding to Figure 2A and B, respectively; ‘Undertaker’ denotes forager bees minus undertaker bees corresponding to Figure 2D; ‘Big-back’ denotes forager bees minus big-back bees corresponding to Figure 2E. Statistics using Student’s t-test or Mann-Whitney U between the forager and in-hive bee group. Asterisks (*) or plus sign (+) denote statistical significance for t-test or Mann-Whitney U, respectively. ‘ns’ denotes non-significant differences.

https://doi.org/10.7554/eLife.41855.013
CompoundHive 1Hive 2SCC 1 weekSCC 3 weeksUndertaker‘Big-back’
C18:1nsns3.71 (+)ns−8.86 (*)ns
C23:1nsns0.51 (+)1.56 (+)0.78 (+)ns
C23nsns3.48 (+)11.45 (*)10.8 (+)−0.85 (+)
C24nsns0.25 (+)0.54 (+)0.52 (*)−0.09 (+)
C25:1nsns1.28 (+)4.15 (+)1.66 (*)ns
C25nsns11.58 (+)24.22 (+)21.12 (+)−3.83 (+)
C27:1nsns1.43 (+)2.18 (+)ns−0.29 (+)
C27nsns8.83 (*)9.38 (*)ns−8.35 (+)
11,13 methyl C27nsnsns−0.35 (*)−0.23 (+)−0.45 (*)
C28nsnsnsns−0.07 (*)−0.05 (*)
C29:1nsns0.69 (+)ns−1.08 (*)ns
C29nsns−4.19 (*)−3.31 (*)−2.58 (*)ns
11,13 methyl C29nsnsns−0.24 (+)−0.52 (*)ns
z(7) C31:1nsns−2.92 (*)−5.53 (+)−4.78 (+)1.6 (+)
z(9) C31:1nsns−2.94 (*)−5.23 (+)−2.93 (+)ns
C31nsns−6.09 (+)−6.75 (+)−2.12 (*)ns
C33:2nsns−1.25 (+)−6.63 (+)−2.9 (+)ns
C33:1−2.38 (*)ns−13.81 (*)−21.39 (+)−8.07 (+)6.65 (*)
C33nsns−1.1 (+)−1.56 (+)−0.48 (*)
Table 6
CHC biosynthesis genes, BLAST E-values, and quantitative real-time PCR primers used in this study.

BLAST E-values listed with known Drosophila melanogaster enzyme gene compared to.

https://doi.org/10.7554/eLife.41855.019
GeneFunctionBLAST E-value
(D. melanogaster gene)		Forward primerReverse primerPreviously published
LOC724867Elongase2E-37 (EloF)TGGGACCGGAATATCAAAAAGCAGTAAAAGTGCCGCTACCFalcón et al. (2014)
LOC724552Elongase1E-38 (EloF)TCGGTAATCATGGAGTTATATAAGGAATCTTGGTCCAGCTGATAAGGFalcón et al. (2014)
LOC550828Elongase1E-37 (EloF)TCGTCAAAGTTTTGGGTCCTGACCTCCCCATCCTGCTATC
LOC409638Elongase9E-38 (EloF)TGGATCGATTCCACGAGATACATCAGCTTTGGCCCTAAAA
LOC413789Elongase2E-38 (EloF)CAGATCTGGTGCACGGGTATTCTCCATTATCCTCGGTCCTFalcón et al. (2014)
LOC100578829Elongase1E-36 (EloF)ATGGCCTCGTTCGGTATTTTACGAATTGGACCATTTGCACFalcón et al. (2014)
LOC726467Elongase2E-13 (Elo68α)GAGTTCATTACTTTCATTGTTTTCCAAACATCCATGACCAAAAACCAFalcón et al. (2014)
LOC725842Elongase5E-10 (Elo68α)ATTAACGTATCACGGTTTTTATCATTTAATTCCTGCTTTCGTAACACTFalcón et al. (2014)
LOC725031Elongase1E-8 (Elo68α)TGGAACACATTGCTTGCATCTGTCCAAAAACCAGACACGAFalcón et al. (2014)
GB51249Elongase7E-7 (EloF)ATGTCGATTTTAATGCAATACGTGAAACTTTTACACCATATACGTAGCTCAFalcón et al. (2014)
LOC412166Desaturase5E-174 (desat1)CGCTGCTCATATCTTTGGAAATTTCCCAATTCTGCCGTTTFalcón et al. (2014)
LOC551527Desaturase1E-138 (desat1)TTAATGGTCCGAAAGCATCCCCCATGTAGGAATTACAAAGCAFalcón et al. (2014)
LOC552417Desaturase2E-137 (desat1)TACGTTTCGTGCTGATGCTTACCAACCCATATGCGAGAAGFalcón et al. (2014)
LOC100576797Desaturase8E-127 (desat1)ACGGGTGAACTTGGTGGTTATTTTGTTGCAGCTCGATTCAFalcón et al. (2014)
LOC552176Desaturase2E-113 (desat1)ACTACCGGATTCGGCATAACTCTGTGATCCAATGCCCATCTFalcón et al. (2014)
LOC727166Desaturase4E-56 (desat1)TGGTCTGGAATATCAAGGAAGGACCGAATTCACCACATTTCC
LOC727333Desaturase4E-54 (desat1)GGGCCCATAAAACATACGAATGTATGGATCTTTATCAGTCCCATAATFalcón et al. (2014)
eIF3-S8Eukaryotic translation initiation factorTCTTGGACCAGCAGTAGCAGGCATATCGAGCATTTCCGTA
Table 7
Genes differ in relative mRNA expression level between bees of different ages (Age), and foraging sister bees raised in two different colonies (Hive).

Numbers represent mean relative mRNA expression level ±standard error across four biological replicates. All p-values are from parametric ANOVA or nonparametric Kruskal Wallis ANOVA (denoted by ‘KW’). Letters denote statistically significant age groups across individual compounds via Tukey’s HSD (ANOVA post-hoc) or Dunn’s Test with FDR adjustment (KW post-hoc) (p<0.05).

https://doi.org/10.7554/eLife.41855.020
GeneDay 1Day 7Day 14ForagerFDR adjusted p-value
Age		FosteredFDR adjusted p-value
Hive
LOC7248671.22 ± 0.192.41 ± 0.7512.62 ± 7.231.58 ± 0.880.328 (KW)1.22 ± 0.181 (KW)
LOC7245521.05 ± 0.261.28 ± 0.662.94 ± 1.650.09 ± 0.020.177 (KW)0.03 ± 0.010.456
LOC5508281.02 ± 0.124.09 ± 1.996.17 ± 2.100.38 ± 0.090.097 (KW)0.30 ± 0.060.53 (KW)
LOC4096381.14 ± 0.212.47 ± 0.414.36 ± 1.652.81 ± 0.260.097 (KW)4.07 ± 0.670.530
LOC4137891.03 ± 0.104.17 ± 0.685.31 ± 2.071.98 ± 0.150.056 (KW)2.38 ± 1.211 (KW)
LOC1005788290.84 ± 0.082.30 ± 0.423.34 ± 0.713.12 ± 0.430.0563.61 ± 2.250.53 (KW)
LOC7264670.58 ± 0.180.12 ± 0.060.19 ± 0.060.03 ± 0.010.064 (KW)0.02 ± 0.000.53 (KW)
LOC7258421.10 ± 0.270.46 ± 0.240.98 ± 0.470.05 ± 0.030.081 (KW)0.01 ± 0.000.53 (KW)
LOC7250310.92 ± 0.04 (A)0.61 ± 0.09 (BC)0.71 ± 0.10 (AB)0.33 ± 0.04 (C)0.0050.43 ± 0.100.573
GB512491.16 ± 0.202.78 ± 0.444.98 ± 1.883.11 ± 0.250.097 (KW)4.14 ± 0.790.530
LOC4121661.06 ± 0.070.84 ± 0.121.08 ± 0.060.61 ± 0.050.081 (KW)0.76 ± 0.430.456 (KW)
LOC5515270.92 ± 0.185.62 ± 1.084.89 ± 1.375.18 ± 0.820.0564.99 ± 1.481
LOC5524170.93 ± 0.060.62 ± 0.071.19 ± 0.491.76 ± 0.970.352 (KW)1.76 ± 0.690.897 (KW)
LOC1005767971.24 ± 0.176.38 ± 2.487.61 ± 2.011.96 ± 0.320.081 (KW)0.44 ± 0.22 (*)0.015
LOC5521761.08 ± 0.03 (A)1.87 ± 0.10 (B)2.51 ± 0.27 (B)2.18 ± 0.11 (B)0.0031.76 ± 0.260.53
LOC7271661.42 ± 0.233.99 ± 0.676.41 ± 1.473.89 ± 0.770.0568.58 ± 1.861
LOC7273331.16 ± 0.104.96 ± 1.445.11 ± 1.122.77 ± 0.910.0811.95 ± 0.090.53 (KW)

Additional files

Transparent reporting form
https://doi.org/10.7554/eLife.41855.025

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Cassondra L Vernier
  2. Joshua J Krupp
  3. Katelyn Marcus
  4. Abraham Hefetz
  5. Joel D Levine
  6. Yehuda Ben-Shahar
(2019)
The cuticular hydrocarbon profiles of honey bee workers develop via a socially-modulated innate process
eLife 8:e41855.
https://doi.org/10.7554/eLife.41855