1. Neuroscience
Download icon

Dual separable feedback systems govern firing rate homeostasis

  1. Yelena Kulik
  2. Ryan Jones
  3. Armen J Moughamian
  4. Jenna Whippen
  5. Graeme W Davis  Is a corresponding author
  1. University of California, San Francisco, United States
Research Article
Cite this article as: eLife 2019;8:e45717 doi: 10.7554/eLife.45717
8 figures, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements
Firing rate homeostasis in Drosophila motoneurons.

(A) Confocal max projection of Drosophila 3rd instar larval VNC shows selective Gal4 expression in MN1 (MN1-GAL4 > UAS-CD8:GFP). (B) I-V plots of MN1 IKA in WT (black, n = 20) and Shal-RNAi (blue, n = 10). (C) Representative voltage traces from WT (black), WT + 4 AP (orange) and Shal-RNAi (blue) at 50 pA (left) and 200 pA (right) current injections. Arrow indicates impaired action potentials due to depolarization block. (D) F-I curves of WT (n = 10), WT + 4 AP (n = 4) and Shal-RNAi (n = 15). (E) Example action potential waveforms (left) and overlay (right). (F) Quantification of action potential, after-hyperpolarization amplitudes (AP amp. AP AHP amp., respectively) and action potential half-width (AP HW). (G) CRISPR strategy for generating a targeted pore-blocking point mutation in Shal. Dark and light blue regions represent 5’ and 3’ 1 kb homology arms designed for recombination of mutated segment from pHD-ScarlessDsRed donor vector into the endogenous Shal gene locus. Selection marker represented in pink. (H) Elimination of IKA across all motoneurons in the ShalW362F mutant. WT (black, n = 7) and ShalW362F (blue, n = 13). (I) F-I curves of WT (n = 19) and ShalW362F (n = 15). Inset: Representative voltage trace from ShalW362F motoneuron at 200 pA current injection. Mean ± S.E.M.; *p<0.05; **p<0.005; ***p<0.0005. N.S., not significant; two-way RM-ANOVA with post-hoc tests (I-V plots and F-I curves) or one-way ANOVA with Bonferoni post-hoc tests (AP waveform measurements).

https://doi.org/10.7554/eLife.45717.002
Figure 1—figure supplement 1
Action potential waveform measurements.

Action potential threshold was the membrane potential at the first inflection point, calculated as 1.5 standard deviations away from the mean second derivative of the AP wave at baseline. Action potential amplitude (AP amp) was the difference in voltage between the threshold and the maximum potential. Action potential half-width (AP HW) was the AP width at half-max amplitude. After-hyperpolarization amplitude (AHP) was the difference in voltage between threshold and the minimum potential after the peak. AP amp, AP HW, and AHP measurements were averaged from all action potentials elicited from a standard current step protocol for each cell.

https://doi.org/10.7554/eLife.45717.003
Figure 1—figure supplement 2
4-AP Does Not Increase Firing Rates in ShalW362F Motoneurons.

(A) F-I curves of WT (black, n = 9) and WT +4 AP (orange, n = 9). (B) F-I curves of ShalW362F (dark blue, n = 5) and ShalW362F +4-AP (light blue, n = 9). Mean ± S.E.M.; two-way RM-ANOVA and Bonferroni's multiple comparisons test.

https://doi.org/10.7554/eLife.45717.004
Homeostatic potassium current rebalancing stabilizes MN1 excitability in the absence of Shal-dependent IKA.

(A, B) I-V plots and representative traces of voltage-dependent delayed rectifier (IKDR, (A) and Ca2+-dependent (IKCa, (B) potassium currents in WT (black; n = 7 and n = 9 for IKDR and IKCa, respectively) and Shal-RNAi (blue; n = 12 and n = 8 for KDR and KCa, respectively) MN1. The specificity of the IKCa current protocol was confirmed in slo1 mutants (B, grey; n = 4), which exhibited minimal Ca2+-dependent potassium currents. (C, D) I-V plots and representative traces of persistent sodium currents (INaP, C, WT: n = 9; Shal-RNAi: n = 9) and voltage dependent calcium currents (ICa, D; WT, n = 8; Shal-RNAi, n = 6) in WT (black) and Shal-RNAi (blue) MN1. Mean ± S.E.M.; *p<0.05; **p<0.005; ***p<0.0005. N.S., not significant; two-way RM-ANOVA with Bonferoni post-hoc tests (I-V plots).

https://doi.org/10.7554/eLife.45717.005
Figure 3 with 2 supplements
Krüppel is necessary for firing rate homeostasis and preservation of AP waveform.

(A) F-I curves of WT (black; n = 10) and double Shal-RNAi; Kr-RNAi (red; n = 16). (B) Representative voltage traces from WT (black), Shal-RNAi (blue), Kr-RNAi (green) and double Shal-RNAi; Kr-RNAi (red) at 200 pA current injections. (C) Left: Example action potential waveforms for WT (black), Shal-RNAi (blue), Kr-RNAi (green) and double Shal-RNAi; Kr-RNAi (red). Right: Action potential overlays. (D) Action potential waveform quantification. (E) Phase plane plots of normalized example action potential waveforms for each genotype (left four panels) and overlays (far right panel). Each plot contains five sequential action potentials from a representative cell to illustrate AP to AP consistency. Mean ± S.E.M.; *p<0.05; **p<0.005; ***p<0.0005. N.S., not significant; two-way RM-ANOVA (F-I curves), one-way ANOVA with Bonferoni post-hoc tests (AP waveform comparisons).

https://doi.org/10.7554/eLife.45717.006
Figure 3—figure supplement 1
Kr does not contribute to setting MN1 baseline firing rate.

(A) F-I curves of WT (black, n = 10) and Shal-RNAi (blue, n = 15). (B) F-I curves of WT (black, n = 10) and Kr-RNAi (green, n = 8). Mean ± S.E.M.; two-way RM-ANOVA and Bonferroni's multiple comparisons test.

https://doi.org/10.7554/eLife.45717.007
Figure 3—figure supplement 2
Normal motoneuron morphology.

(A–D) Confocal max projections of MN1-Ib motorneurons (MN1-GAL4 > UAS-CD8:GFP) in WT (A), Shal-RNAi (B), Krüppel (Kr)-RNAi, (C) and combined Shal and Krüppel-RNAi (Shal-RNAi; Kr-RNAi, (D). Representative MN1-Ibs shown at higher magnification in inserts to reveal single neuron morphology. Arrows indicate MN1-Ib primary dendrite. (E, F) Quantification of somatic diameter (E) and proximal dendrite width (F) in WT (back), Shal-RNAi (blue), Krüppel-RNAi (Kr, green) and combined Shal and Krüppel-RNAi (Shal-RNAi; Kr-RNAi, red). (G, H) Whole-cell capacitance (G) and input resistance (H) in WT (back), Shal-RNAi (blue), Krüppel-RNAi (Kr, green) and combined Shal-RNAi and Krüppel-RNAi (Shal-RNAi; Kr-RNAi, red). Mean ± S.E.M.; *p<0.05; **p<0.005; ***p<0.0005. N.S., not significant; one-way ANOVA with Bonferoni post-hoc tests.

https://doi.org/10.7554/eLife.45717.008
Krüppel constrains cell-to-cell firing rate variance.

(A) Individual motorneuron F-I curves for WT (black), Shal-RNAi (blue), Kr-RNAi (green) and double Shal-RNAi; Kr-RNAi (red) groups. (B) The coefficient of variation across cells is calculated for each genotype at each current injection step and plotted. Data at 25 pA are not shown since a large fraction of cells in each genotype failed to fire an action potential.

https://doi.org/10.7554/eLife.45717.009
Krüppel controls IKCa but not IKDRduring firing rate homeostasis.

(A) IKDR I-V plots (right) and representative traces (left) in WT (black, n = 7) and Shal-RNAi; Kr-RNAi (red, n = 19) MN1. (B) I-V plots of WT (black, n = 7) and Kr-RNAi (green, n = 14) MN1. (C) IKCa I-V plots (right) and representative traces (left) in WT (black) and Shal-RNAi; Kr-RNAi (red) MN1. (D) I-V plots of WT (black, n = 7) and Kr-RNAi (green, n = 9) MN1. (E) I-V plots (right) and representative traces (left) of voltage dependent calcium currents (ICa) in WT (black; n = 8) and double Shal-RNAi; Kr-RNAi (red; n = 6) MN1. (F) I-V plots of MN1 IKA currents in WT (black, n = 20) and double Shal-RNAi, Kr-RNAi (red, n = 10). Mean ± S.E.M.; *p<0.05; **p<0.005; ***p<0.0005; two-way RM-ANOVA with Sidak post-hoc tests. Mean ± S.E.M.; *p<0.05; **p<0.005; ***p<0.0005. N.S., not significant; two-way RMANOVA (I-V plots), one-way ANOVA with Bonferoni post-hoc tests.

https://doi.org/10.7554/eLife.45717.010
IKCa is necessary to maintaining WT firing rates.

(A) Representative voltage traces from Shal-RNAi and Shal-RNAi +Paxilline at 200 pA step current injection. (B) F-I curves of Shal-RNAi at baseline (filled circles) and Shal-RNAi +Paxilline (open circles), paired recordings, n = 8. (C) F-I curves of WT at baseline (filled circles) and WT + Paxilline (open circles), paired recordings, n = 10; WT at baseline (filled squares) and WT + DMSO (open squares), paired recordings, n = 6. Paxilline was dissolved in DMSO. (D) Example action potential waveforms for WT ± Paxilline overlayed (black, grey) and Shal-RNAi ± Paxilline overlayed (dark blue, light blue). (E) Action potential waveform quantification. Mean ± S.E.M.; *p≤0.05; **p<0.01; ***p<0.0001 ****p≤0.0001. N.S., not significant; two-way RM-ANOVA (F-I curves), one-way ANOVA (AP waveform comparisons) with Tukey post-hoc tests.

https://doi.org/10.7554/eLife.45717.011
Shal activity block engages distinct homeostatic rebalancing mechanism.

(A) IKDR I-V plots (left) and representative traces (right) in WT (black, n = 7) and ShalW362F (blue, n = 13) motoneurons. (B) IKCa I-V plots (left) and representative traces (right) in WT (black; n = 12) and ShalW362F (blue; n = 10) motoneurons. (C) Example action potential waveforms for WT (black) and Shal495 (blue) overlaid. (D) Action potential waveform quantification. (E) Quantitative PCR from WT (black) and Shal495 (blue) whole third instar larval brains (≥3 biological replicates, each). (F) Quantitative PCR from WT (black) and ShalW362F (blue) whole third instar larval brains (≥3 biological replicates, each). (G) Cartoon representation of negative geotaxis assay. A single animal was placed in a 20 cm tall clean glass tube. The fly was startled by tapping and time to climb to 10 cm high mark was recorded. (H) Results of climbing assay. WT n = 10, ShalW362F n = 10, Shal-RNAi/+ n = 10, Shal-RNAi/OK371 n = 10, elav-Gal4;Shal-RNAi n = 10, elav-Gal4;Shal-RNAi;Kr-RNAi n = 10. (I) Cartoon diagramming how loss of Shal induces compensatory upregulation of Shaker in motoneuron axons and nerve terminals. (J) Diagrams illustrating the consequences of ion channel rebalancing on presynaptic homeostatic potentiation (PHP). Top: reduced postsynaptic receptor sensitivity triggers compensatory upregulation of presynaptic neurotransmitter release during PHP. Bottom: Shal knockout animals fail to express PHP. (K) Sample traces showing representative EPSP and mEPSP amplitudes in the absence and presence of PhTX for WT (black) and ShalW362F (blue). (L) Reduction in mEPSP amplitudes and increase in quantal content (QC) following incubation in PhTX expressed as percent change relative to baseline for each genotype in absence of PhTX. WT baseline n = 9,+PhTX n = 12; ShalW362F/+baseline n = 6,+PhTX n = 6; ShalW362F/ShalWW362F baseline n = 9,+PhTX n = 10. Mean ± S.E.M.; *p<0.05; **p<0.005; ***p<0.0005, ****p<0.0001. N.S., not significant; two-way RM-ANOVA with Bonferoni post-hoc tests (I-V plots); Student’s t test (AP waveform comparisons); one-way ANOVA (climbing assay) with Tukey post-hoc tests.

https://doi.org/10.7554/eLife.45717.012
Model for FRH in Drosophila motoneurons.

A set point is operationally defined as the level of a variable that is retargeted by a homeostatic signaling system. We propose the existence of a set point for abundance of the Shal protein and a separate set point for neuronal activity. Each set point is connected to a dedicated sensor (S) that monitors either protein levels or neuronal activity. If the sensor detects deviation from the set point, an error signal is produced. The sign and magnitude of the error is computed, over time, and drives changes in actuators (A) that implement negative feedback and restoration of the set point. Actuators in the Shal proteostasis feedback system (green) include the transcription factor Kruppel and downstream transcriptional changes in ion channels that include, but are not be limited to, Shaker and slo. Actuators for the activity-dependent homeostat (purple) remain unknown in Drosophila, but could include changes in ion channel transcription in other systems. We propose that the activity-dependent homeostat (purple) could be connected to the mechanisms of ion channel homeostasis. In this manner, activity-dependent homeostatic signaling could act primarily on the ion channel proteostatic program. If actuators of the activity-dependent proteostat include changes in ion channel gene expression, then channel proteostasis mechanisms could be secondarlily engaged. This might suggest the existence of repressors that couple channel and activity-dependent homeostatic systems, though there remains no experimental evidence to date.

https://doi.org/10.7554/eLife.45717.013

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional information
Chemical compound, drugProtease (Type XIV, Streptomyces griseus)SigmaP5147; CAS 9036-06-0
Chemical compound, drug1-naphthylacetyl spermine trihydrochloride (NASP)SigmaN193; CAS 1049731-36-3
Chemical compound, drugTetrodotoxin citrate (TTX)Tocris1069; CAS 18660-81-6
Chemical compound, drugTetraethylamonium chloride (TEA-Cl)SigmaT2265; CAS 56-34-8
Chemical compound, drug/drug4-Aminopyridine (4-AP)SigmaA78403; CAS 504-24-5
Chemical compound, drugPaxillineTocris2006; CAS 57186-25-1
Chemical compound, drugXE-991 dihydrochlorideTocris2000; CAS 122955-13-9
Chemical compound, drugPhilanthotoxin-433 (PhTX)Santa Cruz Biotechnologysc-255421; CAS 276684-27-6
Gene (Drosophila melanogaster)w1118N/AFLYB: FBal0018186
Genetic reagent (D. melanogaster)MN1-Ib-GAL4Kim et al., 2009Yuh-Nung Jan (UCSF, San Francisco, CA)
Genetic reagent (D. melanogaster)UAS-Shal-RNAiVienna Drosophila RNAi Center (VDRC)VDRC:103363P{KK100264}VIE-260B
Gene (D. melanogaster)ShalW362FThis paperN/ACRISPR-Cas9 engineered point mutation
Genetic reagent (D. melanogaster)elavC155-GAL4Bloomington Drosophila Stock CenterBDSC:458P{w[+mW.hs]=GawB}elav[C155]
Genetic reagent (D. melanogaster)OK371-GAL4Bloomington Drosophila Stock CenterBDSC:26160P{GawB}VGlut[OK371]
Gene (D. melanogaster)Slo1Bloomington Drosophila Stock CenterBDSC:4587
Genetic reagent (D. melanogaster)UAS-Kr-RNAiBloomington Drosophila Stock CenterBDSC:27666P{TRiP.JF02745}attP2
Genetic reagent (D. melanogaster)UAS-CD8:GFP/UASmCD8:GFPN/AFLYB: FBti0012686
Gene (D. melanogaster)Shal495Bloomington Drosophila Stock CenterBDSC:18338PBac{WH}Shal[f00495]
Sequence-based reagentForward primer to clone Shal upstream gRNA into pCFD4This paperN/ATATATAGGAAAGATATCCGGGTGAACTTCGCAACTTCACATCGATTCCGGGTTTTAGAGCTAGAAATAGCAAG
Sequence-based reagentReverse primer to clone Shal downstream gRNA into pCFD4This paperN/AATTTTAACTTGCTATTTCTAGCTCTAAAACTCTGGCATTAGAGAACGATTCGACGTTAAATTGAAAATAGGTC
Sequence-based reagentForward primer for Shal 5’ homology arm amplification, for insertion into pHD-ScarlessDsRedThis paperN/AGGAGACCTATAGTGTCTTCGGGGCCGAgcataattgctcccaagaac
Sequence-based reagentReverse primer for Shal 5’ homology arm amplification, for insertion into pHD-ScarlessDsRedThis paperN/ACGTCACAATATGATTATCTTTCTAGGGTTAACAAAATGCACATACAAAAGATGC
Sequence-based reagentForward primer for Shal 3’ homology arm amplification, for insertion into pHD-ScarlessDsRedThis paperN/ACGCAGACTATCTTTCTAGGGTTAAGCGTTTTAGTTTTATCGATTTATTTG
Sequence-based reagentReverse primer for Shal 3’ homology arm amplification, for insertion into pHD-ScarlessDsRedThis paperN/AGGAGACGTATATGGTCTTCTTTTCCcgggaaacagccagggggcgaggc
Sequence-based reagentPrimer for mutagenesis: Shal W362F and upstream PAMThis paperN/ACTTCACATCGATTCCGGCCGCCTTCTTTTATACCATCGTCACAATG
Sequence-based reagentPrimer for mutagenesis: downstream PAMThis paperN/Agttttttgttgatttcaaatacactctggcattagagaacg
Recombinant DNA reagentpHD-ScarlessDsRedDrosophila Genomics Resource CenterDGRC:1364
Recombinant DNA reagentpCFD4: U6:1-gRNA U6:3-gRNAAddgene49411
Commercial assay or kitRNeasy Plus Micro KitQiagen74034
Commercial assay or kitTurbo DNA-free KitAmbionAM1907
Commercial assay or kitSuperScript III First-StrandInvitrogen18080–051
Commercial assay or kitTaqMan Fast Universal PCR Master Mix (2X), no AmpErase UNGApplied Biosystems4352042
Commercial assay or kitKCNQ FAM Taqman gene expression assayApplied BiosystemsDm01846741_g1
Commercial assay or kitKr FAM Taqman gene expression assayApplied BiosystemsDm01821853_g1
Commercial assay or kitRpL32 FAM Taqman gene expression assayApplied BiosystemsDm02151827_g1
Commercial assay or kitSh FAM Taqman gene expression assayApplied BiosystemsDm01828717_m1
Commercial assay or kitShab FAM Taqman gene expression assayApplied BiosystemsDm01821965_m1
Commercial assay or kitShaw FAM Taqman gene expression assayApplied BiosystemsDm01841512_g1
Commercial assay or kitShawl FAM Taqman gene expression assayApplied BiosystemsDm01809871_m1
Commercial assay or kitSlo FAM Taqman gene expression assayApplied BiosystemsDm02150795_m1
Software, algorithmClampex 10.3Molecular Deviceshttps://www.moleculardevices.com
Software, algorithmIgor Pro 7.02WaveMetricshttps://www.wavemetrics.net/
Software, algorithmMiniAnalysis 6.0.7Synapsofthttp://www.synaptosoft.com/MiniAnalysis/
Software, algorithmSDS 2.4Applied Biosystemshttps://www.thermofisher.com/order/catalog/product/4350490
Software, algorithmExcel 2013Microsofthttps://www.microsoft.com/
Software, algorithmGraphPad Prism 7GraphPadhttps://www.graphpad.com/
Software, algorithmAdobe Illustrator CC 2018ADOBE ILLUSTRATOR CChttps://www.adobe.com

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)