Stimulation of Piezo1 by mechanical signals promotes bone anabolism
- University of Arkansas for Medical Sciences, United States
- Washington University, United States
Figures
Figure 1 with 2 supplements
Piezo1 mediates mechanotransduction in an osteocyte cell line.
(A) mRNA levels of calcium channels regulated by fluid shear stress in MLO-Y4 cells determined by RNA-seq (here and throughout, values are the mean ± s.d.). (B) qPCR of Piezo1 and Piezo2 mRNA in …
Figure 1—figure supplement 1
Sequencing analysis of mRNA isolated from MLO-Y4 cells cultured under static or fluid shear stress conditions.
(A) PCA analysis of RNAseq. (B) Volcano plot of differentially expressed transcripts in MLO-Y4 cells cultured under fluid shear stress (FF) versus static (ST) conditions.
Figure 1—figure supplement 2
Sequencing analysis of mRNA isolated from MLO-Y4 cells cultured under static or fluid shear stress conditions.
(A) GO-enrichment analysis of genes isloated from MLO-Y4 cells cultured under fluid shear stress (FF) and static (ST) conditions. (B) Calcium channels expressed in MLO-Y4 cells.
Figure 2 with 3 supplements
Loss of Piezo1 in osteoblasts and osteocytes decreases bone formation and bone mass.
(A) qPCR of loxP-flanked Piezo1 genomic DNA isolated from tibial cortical bone of Dmp1-Cre;Piezo1f/f (n = 6) and Piezo1f/f (n = 6) littermates. *p<0.05 using Student’s t-test. (B) Serial BMD of …
Figure 2—figure supplement 1
Loss of Piezo1 in osteoblasts and osteocytes decreases bone mass.
(A) Body weight of female and male Dmp1-Cre;Piezo1f/f (n = 9 f, 8 m) and Piezo1f/f (n = 9 f, 9 m) mice at 12 weeks of age. (B) Femoral, spinal, and total body bone mineral density of male mice of …
Figure 2—figure supplement 2
Deletion of Piezo1 in osteoblasts and osteocytes decreases cortical bone.
(A) Representative images of cross sections of femoral diaphysis from 5-week-old Dmp1-Cre;Piezo1f/f and Piezo1f/f mice. (B,C) Empty lacunae (B) and osteocyte number (C) measured in the longitudinal …
Figure 2—figure supplement 3
Deletion of Piezo1 from Dmp1-Cre-targeted cells does not affect muscle mass.
(A) Abundance of Piezo1 genomic DNA measured by qRT-PCR in gastrocnemius of Dmp1-Cre;Piezo1f/f and Piezo1f/f mice. (B) Piezo1 mRNA in tibia and gastrocnemius muscle in male wild type mice (n = 5). (C…
Figure 3
Loss of Piezo1 in osteoblasts and osteocytes blunts the skeletal response to mechanical loads.
(A) Schematic illustration of anabolic loading on mouse tibia. (B) Cortical thickness (Ct.Th) in the tibial shaft of 4-month-old loaded or control Dmp1-Cre;Piezo1f/f (n = 5) and Piezo1f/f (n = 7) …
Figure 4 with 2 supplements
Piezo1 controls Wnt1 expression via YAP1 and TAZ.
(A) qPCR of Wnt1 mRNA in tibial cortical bone of 5-week-old female Piezo1f/f (n = 6) and Dmp1-Cre;Piezo1f/f mice (n = 6). *p<0.05 using Student’s t-test. (B) Relative mRNA levels of Wnt1, Sost, Tnfsf…
Figure 4—figure supplement 1
Loss of YAP1 and TAZ in osteoblasts and osteocytes decreases cortical bone.
(A) Cortical thickness (left), periosteal circumference (middle), and endocortical circumference (right) at the femoral diaphysis of Dmp1-Cre;Yap1f/f,Tazf/f (n = 10) and Yap1f/f,Tazf/f (n = 12) …
Figure 4—figure supplement 2
Deletion of Piezo1 in osteoblastic cells blunts their response to fluid flow.
qRT-PCR of Piezo1, Ptgs2, Wnt1, and Cyr61 in control (Cas9) and Piezo1 knockout (Cas9 + Piezo1 sgRNAs) UAMS-32 cells cultured under static and fluid flow conditions. *p<0.05 using 2-way ANOVA. …
Figure 5 with 1 supplement
Activation of Piezo1 mimics the effects of mechanical stimulation on osteocytes.
(A) Intracellular calcium concentration measured in control or Piezo1 knock-down MLO-Y4 cells immediately after the treatment of DMSO or 10 µM Yoda1. (B) qPCR of Ptgs2, Wnt1, and Tnfrsf11b in …
Figure 5—figure supplement 1
Yoda1 does not affect body weight and serum bone resorption marker.
(A) Body weight of C57BL/6J mice before and after 2 weeks of vehicle or Yoda1 administration (n = 12 mice per group). (B) Serum CTX measured by ELISA in mice as described in (A).
Author response image 1
Gene expression analysis of Piezo1-deficient cells.
(A) RT-qPCR analysis of Sost, Dkk1, Wnt1, Wnt7b, Bmp2, and Tgfb1 in tibia cortical bone of12-week-old female Piezo1f/f (n = 9) and Dmp1-Cre;Piezo1f/f (n = 9) mice. *p < 0.05 using Student’s t-test. …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Mouse: Piezo1f/f(Piezo1tm2.1Apat/J) | Jackson Laboratories | JAX: 029213; RRID:IMSR_JAX:029213 | |
| Genetic reagent (M. musculus) | Mouse: Dmp1-Cre | Bivi et al., 2012 | N/A | |
| Genetic reagent (M. musculus) | Mouse: Yap1f/f;Tazf/f | Xin et al., 2013 | N/A | |
| Genetic reagent (M. musculus) | Mouse: WT C57BL/6J | Jackson Laboratories | JAX: 000664; RRID:IMSR_JAX:000664 | |
| Commercial assay or kit | Mouse Osteocalcin Immunoassay Kit | Thermo Fisher | Cat# J64239 | |
| Commercial assay or kit | Fluo-8 Calcium Flux Assay Kit | Abcam | Cat# ab112129 | |
| Commercial assay or kit | RatLaps (CTX-I) EIA kit | Immunodiagnostic Systems | Cat# AC-06F1 | |
| Commercial assay or kit | TruSeq stranded mRNA kit | Illumina | Cat# 20020594 | |
| Commercial assay or kit | High-capacity cDNA reverse transcription kit | Life Technologies | Cat# 4368813 | |
| Commercial assay or kit | RNeasy mini kit | QIAGEN | Cat# 74106 | |
| Cell line (Murine) | 293T | ATCC | CRL-3216 | |
| Cell line (Murine) | MLO-Y4 | Kato et al., 1997 | ||
| Cell line(Murine) | UAMS-32 | O'Brien et al., 1999 | Cell line maintained in Charles O’Brien lab | |
| Transfected construct (M. musculus) | Piezo1 shRNA forward | Zhang et al., 2017 | Oligo | CCGGTCGGCGCTTGCTAGAACTTCACTCGAGTGAAGTTCTAGCAAGCGCCGATTTTTG |
| Transfected construct (M. musculus) | Piezo1 shRNA reverse | Zhang et al., 2017 | Oligo | AATTCAAAAATCGGCGCTTGCTAGAACTTCACTCGAGTGAAGTTCTAGCAAGCGCCGA |
| Transfected construct (M. musculus) | Yap1 shRNA | Sigma-Aldrich | TRCN0000238432 | |
| Transfected construct (M. musculus) | Taz shRNA | Sigma-Aldrich | TRCN0000095951 | |
| Sequenced-based reagent | Piezo1 | Life Technologies | Mm01241549_m1 | |
| Sequenced-based reagent | Piezo2 | Life Technologies | Mm01265861_m1 | |
| Sequenced-based reagent | Ptgs2 | Life Technologies | Mm00478374_m1 | |
| Sequenced-based reagent | Cyr61 | Life Technologies | Mm00487498_m1 | |
| Sequenced-based reagent | Wnt1 | Life Technologies | Mm01300555_g1 | |
| Sequenced-based reagent | Yap1 | Life Technologies | Mm01143263_m1 | |
| Sequence-based reagent | Taz | Life Technologies | Mm01289583_m1 | |
| Sequence-based reagent | Tnfsf11 | Life Technologies | Mm00441906_m1 | |
| Sequence-based reagent | Tnfrsf11b | Life Technologies | Mm00435452_m1 | |
| Sequence-based reagent | Sost | Life Technologies | Mm00470479_m1 | |
| Sequence-based reagent | Mrps2 | Life Technologies | Mm00475529_m1 | |
| Sequence-based reagent | Piezo1 sgRNA | This paper | GGTTATTCCTGTGAGGCCCG | |
| Sequence-based reagent | Piezo1 sgRNA | This paper | TTAGGATTCGGCTCACAGAG | |
| Chemical compound, drug | Yoda1 | Sigma-Aldrich | Cat# SML1558 | |
| Chemical compound, drug | Puromycin dihydrochloride | Sigma-Aldrich | Cat# P8833 | |
| Chemical compound, drug | G418 disulfate | Sigma-Aldrich | Cat# G8168 | |
| Antibody | YAP1 | Cell Signaling | Cat# 14074S; RRID:AB_2650491 | 1:200 |
| Antibody | Goat anti-Rabbit IgG (Alexa Fluor 488) | Abcam | Cat# ab150077; RRID:AB_2630356 | 1:200 |
| Software, algorithm | Prism 8 | GraphPad | https://www.graphpad.com/scientific-software/prism/ | |
| Software, algorithm | ImageJ | NIH | https://imagej.nih.gov/ij |
Additional files
-
Supplementary file 1
RNAseq analysis of MLO-Y4 cells cultured under fluid shear stress (FF) and static (ST) conditions.
- https://doi.org/10.7554/eLife.49631.016
-
Transparent reporting form
- https://doi.org/10.7554/eLife.49631.017
