Figures and data in Sexual transmission of murine papillomavirus (MmuPV1) in Mus musculus

Figures
Tables
Additional files

3 figures, 2 tables and 1 additional file

Figures

Figure 1

Download asset Open asset

Rationale and experimental design for MmuPV1 sexual transmission studies.

(A) A full-slide scan of a representative H and E-stained female reproductive tract from a Donor infected for 4 months with MmuPV1+UV+E2 with anatomical regions labeled. On the right, higher magnification images of the cervicovaginal fornix (inset) stained with H and E (left) or immunofluorescence for keratin (KRT; red) and MmuPV1 L1 capsid protein (L1; green). (B) Schematic of MmuPV1 sexual transmission experimental design. Mice infected or potentially infected are indicated in red. (C) DNA was isolated from cervicovaginal lavage samples from a group of representative MmuPV1+UV+E2-infected females that were used as Donors in Experiments 3 and 4. Lavages were conducted at the onset of Experiment 3 (4 months post-infection), the onset of Experiment 4 (8 months post-infection) and Experiment four endpoint (10 months post-infection. DNA was analyzed by PCR for the MmuPV1 E2 gene (top) or for the p53 gene (bottom) to verify DNA presence/quality.

https://doi.org/10.7554/eLife.50056.003

Figure 2

Download asset Open asset

Evidence for sexual transmission: Assessment of MmuPV1 infection status in female Recipient reproductive organs.

(A) DNA was isolated from cervicovaginal lavage (CVL) samples collected from a group of representative Recipient female mice at three different occasions. The numerical mouse identifiers correspond to mice listed in Table 1. The three different CVL time points are as follows (time is listed in weeks following introduction to male Breeder): Mock Recipient mice #1–3 and Recipients #1–3 from Experiment 1 (CVL1: 6 weeks, CVL2: 13 weeks, CVL3: 17 weeks), Recipient mice #5, #8, and #9 from Experiment 2 (CVL1: 8 weeks, CVL2: 11 weeks, CVL3: 13 weeks), Recipient mouse #16 from Experiment 3* (CVL1: 3 weeks, CVL2: 4.5 weeks, CVL3: 9 weeks), and Recipient mice #19, #21, and #22 from Experiment 4 (CVL1: 4.5 weeks, CVL2: 7 weeks, CVL3: 9 weeks). DNA was analyzed by PCR for the MmuPV1 E2 gene (top) or for the p53 gene (bottom) to verify DNA presence/quality. (B) Incidence of MmuPV1 infection via sexual transmission in Recipient females as determined by CVL for MmuPV1 E2 gene. (C) Schematic of co-habitation study in which each co-housed pair consisted of an experimentally MmuPV1-infected female mouse and an uninfected female mouse. After 3 weeks of co-habitation, DNA isolated from cervicovaginal lavages was analyzed by PCR for the MmuPV1 E2 gene (top) or for the p53 gene (bottom) to verify DNA presence/quality. (D) Full-slide scans of the female reproductive tract harvested from Recipient Mouse #3 with a prolonged MmuPV1 infection as a result of sexual contact. Tissue is stained with H and E (left) or for the MmuPV1 E4 viral transcript using RNAscope (right). Higher magnification images of the infected regions of epithelia are shown stained with H and E (top), RNAscope for the MmuPV1 E4 transcript (middle), and the MmuPV1 L1 protein (green) and keratin 14 (red) by immunofluorescence (bottom). White arrow indicates junction between uninfected and MmuPV1-infected epithelia. All scale bars = 100 µM.

https://doi.org/10.7554/eLife.50056.005

Figure 3

Download asset Open asset

Male Breeders harbor infections in their reproductive organs.

(A) Incidence of MmuPV1 infection via sexual transmission in male Breeders as determined by staining tissue for MmuPV1 E4 transcript using RNAscope. (B) Various regions of the penis in MmuPV1-positive male Breeders stained with H and E or RNAscope for MmuPV1 E4 viral transcripts. Lower magnification images on the left for Male #1 include inset boxes (red) indicating the region staining positive for E4, which is shown on the far right. Higher magnification H and E-stained image of the region is shown in the center. Top: Male #1 (did not transmit to Recipient) with MmuPV1-positive region in the glans penile epithelium (red inset). Bottom: Male #5 (transmitted to Recipient) with MmuPV1-positive region in the glans penile epithelium stained for L1 (green) and K14 (KRT; red) (white inset; left), H and E (red inset; middle), and E4 by RNAscope (red inset; right). (C) Tissue from Male #3 (transmitted to Recipient #3 shown in Figure 2C) is stained with H and E (left two columns) or for the MmuPV1 E4 viral transcript using RNAscope (right) three panels). Lower magnification images on the left include inset boxes (red) indicating the region staining positive for E4. Higher magnification images of the infected regions of epithelia are shown stained with H and E and RNAscope for the MmuPV1 E4 transcript (bottom). In the RNAscope analysis, slides were left untreated, treated with DNase to remove any signal from viral DNA, and with DNase+RNase to verify signal is specific for viral RNA transcripts. Top: Male #3 (transmitted to Recipient) with MmuPV1-positive region in the mump ridge groove of the glans penis (red inset). Bottom: Male #3 (transmitted to Recipient) with MmuPV1-positive region in the prepuce (foreskin)/inner preputial space (red inset). All scale bars = 100 µM.

https://doi.org/10.7554/eLife.50056.006

Tables

Table 1

Overview of MmuPV1 sexual transmission experiments and results

https://doi.org/10.7554/eLife.50056.004

Expt.	Experimental Conditions	Treatment of DONOR Female	DONOR pregnancy	Infection status of MALE BREEDER	Infection status of RECIPIENT female	RECIPIENT pregnancy (# if > 1)	# Positive CVL (total # of CVLs) in RECIPIENT Female
1	3 weeks breeding; Recipients untreated prior to breeding, placed on E2 8 weeks after introduction of male.	No Virus #1	Yes	Negative	Negative	Yes	0 (4)
		No Virus #2	No	Negative	Negative	Yes	0 (4)
		No Virus #3	Yes	Negative	Negative	Yes	0 (4)
3	3 weeks breeding; Recipients untreated prior to breeding.	No Virus #4	Yes	Negative	Negative	Yes	0 (3)
		No Virus #5	Yes	Negative	Negative	No	0 (3)
		No Virus #6	Yes	Negative	Negative	No	0 (3)
4	Prolonged Donor and Recipient breeding with male (8 weeks). Recipients untreated prior to breeding.	No Virus #7	Yes	Negative	Negative	Yes (2)	0 (4)
		No Virus #8	Yes	Negative	Negative	Yes (2)	0 (4)
		No Virus #9	Yes	Negative	Negative	Yes (2)	0 (4)
1	3 weeks breeding, Recipients untreated prior to breeding, placed on E2 8 weeks after introduction of male.	MmuPV1+UV+E2 #1	No	Positive	Negative	Yes	0 (4)
		MmuPV1+UV+E2 #2	Yes	Negative	Negative	Yes	0 (4)
		MmuPV1+UV+E2 #3	Yes	Positive	Positive (Prolonged)	Yes	3 (4)
2	3 weeks breeding, Recipients untreated prior to breeding, placed on E2 8 weeks after introduction of male.	MmuPV1+UV+E2 #4	No	Negative	Negative	Yes	0 (5)
		MmuPV1+UV+E2 #5	No	Positive	Positive (Transient)	Yes	1 (5)
		MmuPV1+UV+E2 #6	No	Negative	Negative	Yes	0 (5)
		MmuPV1+UV+E2 #7	No	Negative	Negative	Yes	0 (5)
		MmuPV1+UV+E2 #8	No	Negative	Negative	Yes	0 (5)
		MmuPV1+UV+E2 #9	Yes	Negative	Positive (Transient)	Yes	1 (5)
3	3 weeks breeding; Recipients untreated prior to breeding, not treated with E2.	MmuPV1+UV+E2 #10	No	Positive	Negative	Yes	0 (3)
		MmuPV1+UV+E2 #11	No	Negative	Negative	Yes (2)	0 (3)
		MmuPV1+UV+E2 #12	Yes	Negative	Negative	Yes	0 (3)
3*	3 weeks breeding; female Recipients treated with Depo-Provera 5d prior to breeding, not treated with E2.	MmuPV1+UV+E2 #13	No	Negative	Negative	No	0 (3)
		MmuPV1+UV+E2 #14	No	Negative	Negative	No	0 (3)
		MmuPV1+UV+E2 #15	Yes	Negative	Negative	No	0 (3)
		MmuPV1+UV+E2 #16	Yes	Negative	Positive (Prolonged)	No	2 (3)
4	Prolonged Donor and Recipient breeding with male (8 weeks). Recipients untreated prior to breeding, not treated with E2.	MmuPV1+UV+E2 #17	No	Negative	Negative	Yes (2)	0 (4)
		MmuPV1+UV+E2 #18	No	Negative	Negative	Yes (2)	0 (4)
		MmuPV1+UV+E2 #19	Yes	Negative	Positive (Prolonged)	Yes (3)	3 (4)
		MmuPV1+UV+E2 #20	No	Negative	Negative	Yes	0 (4)
		MmuPV1+UV+E2 #21	No	Negative	Positive (Transient)	Yes (3)	1 (4)
		MmuPV1+UV+E2 #22	No	Negative	Positive (Prolonged)	Yes (2)	2 (4)

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background	FVB/N	Taconic Biosciences	RRID:IMSR_TAC:fvb	Males (n = 31) Females (n = 31)
Strain, strain background	MmuPV1	Joh et al., 2012 Uberoi et al., 2016	GenBank: GU808564.1	In-lab stock ‘AU 11/13’, pAU.4
Antibody	Anti-MusPV1 L1 (rabbit polyclonal immune serum)	Chris Buck, NCI/NIH		IF (1:5000)
Antibody	Anti-K14 (rabbit polyclonal)	BioLegend	Cat#905301; RRID:AB_2565048	IF (1:1000)
Sequence-based reagent	MmuPV1_E2_1	Hu et al., 2015 Cladel et al., 2017a Spurgeon et al., 2019	PCR primers	GCCCGAAGACAACACCGCCACG
Sequenced-based reagent	MmuPV1_E2_2	Hu et al., 2015 Cladel et al., 2017a Spurgeon et al., 2019	PCR primers	CCTCCGCCTCGTCCCCAAATGG
Sequenced-based reagent	p53-1	Spurgeon et al., 2019	PCR primers	TATACTCAGAGCCGGCCT
Sequenced-based reagent	p53-2	Spurgeon et al., 2019	PCR primers	ACAGCGTGGTGGTACCTTAT
Sequenced-based reagent	p53-3	Spurgeon et al., 2019	PCR primers	TCCTCGTGCTTTACGGTATC
Sequenced-based reagent	MusPV-E4	Xue et al., 2017	RNAscope probe Cat#473281
Commercial assay or kit	RNAscope 2.5 HD Detection Kit Brown	ACDBio	Cat# 322300
Chemical compound, drug	Tyramide signal amplification (TSA)-related reagents	Online protocol: https://doi.org/10.17504/protocols.io.i8cchsw
Chemical compound, drug	medroxyprogesterone acetate	Amphastar Pharmaceuticals	Depo-Provera	3 mg/animal, subcutaneous injection
Chemical compound, drug	Nonoxynol-9 (4%)	Options Conceptrol	Cat#247149	50 µl/mouse, intravaginal
Chemical compound, drug	Carboxyl methylcellulose (4%)	Sigma Aldrich	Cat# C4888	25 µl/mouse, intravaginal
Chemical compound, drug	17β-estradiol pellet, 0.05 mg/60 days	Innovative Research of America	Cat#SE-121	0.05 mg/60 days, subcutaneous pellet
Other	Hematoxylin QS	Vector	Cat#H-3404	Counterstain
Other	Shandon Instant Hematoxylin	Thermo Fisher	Cat#6765015	H and E stain
Other	Eosin	Sigma Aldrich	Cat#E4382	H and E stain
Other	DNase I	Thermo Fisher Scientific	Cat#EN0521	20 units/sample
Other	RNase A	Qiagen	Cat#1006657	500 µg/sample
Other	RNase T1	Fermentas	Cat#EN0542	2000 units/sample