Agonist-specific voltage-dependent gating of lysosomal two-pore Na+ channels
- University of Michigan, United States
- Zhejiang University of Technology, China
- Medical Center Drive, United States
- The Fourth Hospital of Harbin Medical University, China
Figures
Figure 1 with 3 supplements
Screening of small-molecule agonists of TPC2.
(A) High-throughput screening of the LOPAC library with Fluo-4 Ca2+ imaging in HEK293 cells stably expressing hTPC2 (Dryad, http://doi.org/10.5061/dryad.s5f6j9h). Each trace represented the average …
-
Figure 1—source data 1
Screening of small-molecule agonists of TPC2.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
TCAs act as TPC agonists.
(A) An example of a negative responder (MDL) in high- throughput screening of the LOPAC library with Fluo-4 Ca2+ imaging in HEK293 cells stably expressing hTPC2. (B, C, D) Representative whole-cell I…
Figure 1—figure supplement 2
Time courses of LyNa-VA1.2-induced TPC2 activation under different recording configurations.
(A) Representative ITPC2 evoked by LyNa-VA1.2 (200 µM) in an inside-out patch from TPC2LL/AA-transfected cells. (B) Representative time course of LyNa-VA1.2- induced TPC2 activation under whole-cell …
-
Figure 1—figure supplement 2—source data 1
Time course of LyNa-VA1.2- induced ITPC2 .
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig1-figsupp2-data1-v1.xlsx
Figure 1—figure supplement 3
LyNA1 activates TPC2 channels.
(A) Chemical structure of LyNA1. (B) The effects of LyNa-VA1.2 and LyNA1 on whole-cell ITPC2 under the recording conditions of extracellular 150 mM Na+ and cytosolic 150 mM K+.
Figure 2 with 2 supplements
LyNa-VAs activate lysosomal TPC2 channels in a voltage-dependent manner.
(A) Representative basal ITPC2 step currents elicited by a voltage step protocol in the whole-endolysosome (EL) configuration. Voltage steps from −140 to 100 mV with a voltage increment (∆V) of 20 …
-
Figure 2—source data 1
The inactivation of ITPC2 and rectification index of TPC2.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
LyNA1 activates lysosomal TPC2 channels.
(A) Time course of dose-dependent activation of whole-endolysosome ITPC2 by LyNA1. (B) Representative traces of ITPC2 evoked by 100 µM and 300 µM LyNA1 at the time points indicated in (A). (C) The …
Figure 2—figure supplement 2
TCAs induce voltage-dependent activation and inactivation of TPC2 channels.
(A, B) Whole-cell ITPC2 elicited by voltage steps from −140 to 80 mV (∆V = 20 mV; see the voltage protocol in the left panel) in the presence of LyNa-VA1.2 (A) or LyNA1 (B). (C) Agonist-specific …
-
Figure 2—figure supplement 2—source data 1
Agonist-specific voltage-dependent inactivation of ITPC2 induced by LyNa-VA1.2 and LyNA1.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig2-figsupp2-data1-v1.xlsx
Figure 3 with 1 supplement
Synergistic activation of TPC2 channels by TCAs and PI(3,5)P2.
(A) The effects of PI(3,5)P2 (0.3 µM) and LyNa-VA1.2 (100 µM) on whole-endolysosome ITPC2-K204A in TPC2K204A-transfected HEK293 cells (She et al., 2019). (B) Comparison effects of LyNa-VA1.2 and …
-
Figure 3—source data 1
Synergistic activation of TPC2 channels by TCAs and PI(3,5)P2.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
LyNa-VAs and LyNA1 activate TPCs independent of PI(3,5)P2.
(A) The effects of PI(3,5)P2 (0.3 µM) and LyNa-VA1.2 (100 µM) on whole-endolysosome ITPC2 in TPC2-transfected Cos1 cells. (B) Whole-cell ITPC2-K204A activated by LyNa-VA1.2 and LyNA1 in TPC2K204A-tra…
-
Figure 3—figure supplement 1—source data 1
Dose-dependent activation of TPC2 by LyNA1 in the presence or absence of PI(3,5)P2.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 2 supplements
Activation of lysosomal TPC1 channels by LyNa-VAs.
(A) Whole-endolysosome TPC1 current (ITPC1) was activated by LyNa-VA1.1 (right) and elicited by a voltage step protocol (left), in which a preconditioning voltage (80 mV, 0.3 s) was applied before …
-
Figure 4—source data 1
Activation of lysosomal TPC1 channels by LyNa-VAs.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Inhibition of lysosomal TPC1 channels by LyNA-1.
(A) A voltage protocol that elicited ITPC1 tail currents as shown in Figure 4E (from −140 to 100 mV with a ∆V = 20 mV, 1 s with a 10 s inter-step interval). Arrows indicate where tail currents were …
Figure 4—figure supplement 2
Voltage-dependence and PI(3,5)P2-sensitivity of R540I mutant TPC1 channels.
(A) Basal whole-endolysosome ITPC1 (left) or ITPC1-R540I (right) was elicited by voltage steps (−140 to +100 mV with ΔV = 20 mV) in the absence of PI(3,5)P2 in TPC1-transfected Cos1 cells (She et …
Figure 5 with 1 supplement
LyNa-VAs do not change the cationic selectivity of TPC2 channels.
(A) Representative PI(3,5)P2-evoked whole-endolysosome ITPC2 elicited by a voltage ramp from −120 to 120 mV. The recordings were performed under a bi-ionic condition with 150 (in mM) Na+ in the …
-
Figure 5—source data 1
Ionic selectivity of WT TPC2 and N653G mutant channels.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
LyNA1 does not change the Na+ selectivity of TPC2 channels.
(A) LyNA1 (300 µM)- activated whole-cell ITPC2-LL/AA under the bi-ionic conditions (in mM), that is pipette/cytosolic 150 Na+ and bath/extracellular 150 Na+, 150 K+ or 105 Ca2+. Right panel: zoom-in …
-
Figure 5—figure supplement 1—source data 1
LyNA1 does not change ionic selectivity of TPC2 channels.
- https://cdn.elifesciences.org/articles/51423/elife-51423-fig5-figsupp1-data1-v1.xlsx
Author response image 1
LyNa-VA-induced currents are inhibited by LyNI-1, a small-molecule TPC2 inhibitor.
(A) Dose-dependent inhibition of LyNI-1 on PI(3,5)P2 (0.1 µM)-induced whole-endolysosome ITPC2 (IC50 = 3 ± 1 µM, n=3 patches). (B) Co-application of LyNI-1(100 µM) inhibited LyNa-VA1.1 (50 …
Tables
Table 1
Summary of electrophysiology-based screening of TPC agonists.
Based on chemical structures, LyNa-VAs were divided into two groups: LyNa-VA1.x and LyNa-VA2.x. EC50 and the average TPC2 currents (ITPC2) were calculated based on 3–5 whole-cell or …
| LyNa-VAs | Chemical name | Structure | EC50 (μM)* | ITPC2 (pA)** |
|---|---|---|---|---|
| LyNa-VA1.1 | Clomipramine |  | 43 ± 2 | 945 ± 111 |
| LyNa-VA1.2 | Desipramine |  | 87 ± 8 | 1120 ± 94 |
| LyNa-VA1.3 | Imipramine |  | 112 ± 1 | 433 ± 94 |
| LyNa-VA1.4 | Amitriptyline |  | 102 ± 3 | 876 ± 196 |
| LyNa-VA1.5 | Nortriptyline |  | 52 ± 10 | 1916 ± 361 |
| Carbamazepine |  | No activation | No activation | |
| LyNa-VA2.1 | Chlorpromazine |  | 60 ± 2 | 1101 ± 508 |
| LyNa-VA2.2 | Triflupromazine |  | 63 ± 2 | 984 ± 294 |
| Phenothiazine |  | No activation | No activation |
-
*Data were obtained from whole-cell recordings at −140 mV.
**Data were obtained from whole endolysosome recordings with 100 µM of LyNa-VAs at −120 mV.
-
Table 1—source data 1
Electrophysiology-based screening of TPC agonists.
- https://cdn.elifesciences.org/articles/51423/elife-51423-table1-data1-v1.xlsx
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HEK293 | ATCC | RRID:CVCL_0045 | |
| Cell line (Homo sapiens) | HAP1 | Horizon Discovery | Cat. #: C631 | |
| Cell line (Chlorocebus aethiops) | Cos1 | ATCC | RRID:CVCL_0223 | |
| Recombinant DNA reagent | pEGFP-C2-TPC2 (plasmid) | Wang et al., 2012 | ||
| Recombinant DNA reagent | pEGFP-C2-TPC1 (plasmid) | Wang et al., 2012 | ||
| Sequence-based reagent | TPC1-sgRNA | This paper | sgRNA | CTTGCAGTACTTCAGCACCC |
| Sequence-based reagent | TPC2-sgRNA | This paper | sgRNA | CCCCAGCGTCGGGCTGCTGC |
| Sequence-based reagent | TPC1-fw | This paper | PCR primers | ATGGCCCAGACATGTGACTC |
| Sequence-based reagent | TPC1-re | This paper | PCR primers | TGCCTGTCTCCATCCTCTCA |
| Sequence-based reagent | TPC2-fw | This paper | PCR primers | TGAGCTGAGCATGAGGCAAG |
| Sequence-based reagent | TPC2-re | This paper | PCR primers | AAAGGACAAGTGGCCCTGAG |
| Chemical compound, drug | Desipramin hydrochloride | Sigma | Cat. #: D3900 | |
| Chemical compound, drug | Carbamazepine | Sigma | Cat. #: C4024 | |
| Chemical compound, drug | monensin | Sigma | Cat. #: M5273 | |
| Chemical compound, drug | ionomycin | Sigma | Cat. #: I0634 | |
| Chemical compound, drug | Clomipramine | Cayman Chemical | Cat. #: 15884 | |
| Chemical compound, drug | Imipramine | Cayman Chemical | Cat. #: 15890 | |
| Chemical compound, drug | Amitriptyline | Cayman Chemical | Cat. #: 15881 | |
| Chemical compound, drug | Nortriptyline | Cayman Chemical | Cat. #: 15904 | |
| Chemical compound, drug | Phenothiazine | NCATS | CAS: 92-84-2 | |
| Chemical compound, drug | Triflupromazine | NCATS | CAS: 146-54-3 | |
| Chemical compound, drug | Chlorpromazine | Cayman Chemical | Cat. #: 16129 | |
| Chemical compound, drug | ML-SA1 | Princeton BioMolecular Research Inc | Cat. #: OSSK_389119 | |
| Chemical compound, drug | PI(3,5)P2 | Echelon Biosciences | Cat. #: P-3508 | |
| Chemical compound, drug | vacuolin-1 | Calbiochem | Cat. #: 673000 | |
| Software, algorithm | pClamp | pClamp | RRID:SCR_011323 |
